ID: 915564512

View in Genome Browser
Species Human (GRCh38)
Location 1:156706181-156706203
Sequence TGAGCCCGAAGCAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915564512_915564520 -2 Left 915564512 1:156706181-156706203 CCCTCCACCCTGCTTCGGGCTCA 0: 1
1: 0
2: 2
3: 12
4: 201
Right 915564520 1:156706202-156706224 CACGTAATGCCTGGGGACTCTGG 0: 1
1: 0
2: 1
3: 9
4: 104
915564512_915564519 -9 Left 915564512 1:156706181-156706203 CCCTCCACCCTGCTTCGGGCTCA 0: 1
1: 0
2: 2
3: 12
4: 201
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG 0: 1
1: 0
2: 0
3: 0
4: 43
915564512_915564522 12 Left 915564512 1:156706181-156706203 CCCTCCACCCTGCTTCGGGCTCA 0: 1
1: 0
2: 2
3: 12
4: 201
Right 915564522 1:156706216-156706238 GGACTCTGGAAGTAGTCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 129
915564512_915564518 -10 Left 915564512 1:156706181-156706203 CCCTCCACCCTGCTTCGGGCTCA 0: 1
1: 0
2: 2
3: 12
4: 201
Right 915564518 1:156706194-156706216 TTCGGGCTCACGTAATGCCTGGG 0: 1
1: 0
2: 0
3: 1
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915564512 Original CRISPR TGAGCCCGAAGCAGGGTGGA GGG (reversed) Intergenic
900862272 1:5242135-5242157 TGAGTCCTGAGCAGGGAGGAGGG + Intergenic
901644702 1:10710178-10710200 TGAGCCAGCCTCAGGGTGGAGGG - Intronic
901679494 1:10904854-10904876 GGAGCCTGAGGCAGGCTGGATGG - Intergenic
902286548 1:15411325-15411347 TGTGCCCTCACCAGGGTGGATGG + Intronic
902627251 1:17683692-17683714 TGAGCCCAAAGCGGGGAGGCCGG - Intronic
903180166 1:21601364-21601386 GGAACCCGAAGCAGGGTTGGGGG - Intronic
905081938 1:35330434-35330456 TGAGCCTGGAGTAGGGAGGAAGG + Intronic
911265088 1:95733877-95733899 TGAGCCCTTTGCAGGGTGGGAGG - Intergenic
912196411 1:107402289-107402311 TGACCCTGAGGCAGGATGGATGG - Intronic
915564512 1:156706181-156706203 TGAGCCCGAAGCAGGGTGGAGGG - Intergenic
915604404 1:156941619-156941641 TGAGCCTGAAGAAGGGTGAGGGG - Intronic
919422645 1:197389903-197389925 TCAGCACGCAGCAGGGTGGCAGG - Intronic
923299780 1:232630271-232630293 TGCGCCCGGAGCCGGGCGGACGG - Intergenic
924128210 1:240878066-240878088 TGAGGCTCAGGCAGGGTGGAAGG - Intronic
924226618 1:241927355-241927377 TGAGCTGGAAGCAGGATGGAAGG - Intergenic
1063520400 10:6735829-6735851 TAAGCCAGAAGCAAGGTGGGGGG - Intergenic
1063629918 10:7723647-7723669 TCAGCCCTAAGCAGGGAGGAGGG - Intronic
1066066132 10:31762204-31762226 TGAGCCCACTGCAGGGTGGGAGG - Intergenic
1067055191 10:43045886-43045908 TGAGCCCACAGCAGGTGGGATGG + Intergenic
1069590663 10:69639786-69639808 GGAGCCCTAGGGAGGGTGGAAGG + Intergenic
1069909556 10:71751130-71751152 TGAGCCCAGAGCAGGAGGGAGGG + Exonic
1070544252 10:77440192-77440214 TGGGCCAGATGCTGGGTGGAGGG + Intronic
1071545967 10:86529783-86529805 GGAGTCCGAGGCAGGGTGGGTGG + Intergenic
1072069258 10:91900715-91900737 TGGGCCCAGAGCAGGGTAGATGG - Intergenic
1073009610 10:100349045-100349067 GGGGCCTGAAGCAGGCTGGACGG - Intronic
1073288802 10:102403255-102403277 TGAGCCCGGGGCTGGCTGGAGGG + Exonic
1075121180 10:119666112-119666134 TGAGCACAAAGCAGGGCAGAGGG - Intronic
1076772093 10:132671340-132671362 GGAGTCCGAAGCAGGGAGGGCGG - Intronic
1076772099 10:132671361-132671383 GGAGTCCGAAGCAGGGAGGGCGG - Intronic
1076772111 10:132671403-132671425 GGAGTCCGAAGCAGGGAGGGCGG - Intronic
1076772117 10:132671424-132671446 CGAGTCCGAAGCAGGGAGGGCGG - Intronic
1077327914 11:1971640-1971662 TGGGCCCGAGGCAGGTTGGGTGG - Intronic
1078185331 11:9047253-9047275 TGAGCCCTGAGAAGGGAGGATGG + Intronic
1078203136 11:9202725-9202747 AGAACCAGAAGCTGGGTGGATGG - Intronic
1078660857 11:13284535-13284557 TGCGCCGGGAGCAGGATGGATGG + Intronic
1078666917 11:13333500-13333522 TCAGCCCGAAGGAAGGAGGATGG - Intronic
1080123527 11:28704618-28704640 TGAGCCTGAGGAAGGGTGGTAGG + Intergenic
1080130861 11:28792939-28792961 TGAGCACGTAGCAGGATGGGTGG - Intergenic
1081059972 11:38462101-38462123 GGAGCCAGAAGCAGGGGAGATGG + Intergenic
1081473405 11:43399424-43399446 GGAGACTGAGGCAGGGTGGAGGG + Intronic
1081687041 11:45049990-45050012 TGAGACTGAAGCAGGGAGCAGGG + Intergenic
1081914285 11:46720719-46720741 TGAGCTGGAGTCAGGGTGGATGG - Intronic
1082993183 11:59226534-59226556 AGTGCCCTCAGCAGGGTGGATGG + Intergenic
1083330957 11:61898159-61898181 TGAGCCAGAGGCAGAATGGATGG - Exonic
1083755074 11:64787965-64787987 TGAGCCCCAAGGAGGGTGAGGGG - Intergenic
1084966987 11:72750149-72750171 GGAGCCTGAAGCGGGGTAGAGGG + Intronic
1085837701 11:79974294-79974316 TGAGCCTGAGGCAGAGAGGAAGG + Intergenic
1086013270 11:82132010-82132032 TGGGCATGAAGCAGGGTGCAGGG - Intergenic
1087695374 11:101370063-101370085 TCAGACCGAAGCAGGGTGGTCGG - Intergenic
1088521243 11:110703038-110703060 TGACCCAGAAGCAAGGTGCAAGG - Intronic
1088791567 11:113231591-113231613 AGAGCCCAAGGCAGGGTGAAGGG - Intronic
1089561817 11:119346983-119347005 TGAGAAAGAAGCAGGGTGTAGGG + Intergenic
1089589860 11:119533369-119533391 TGAGCCCACAGCAGGGTGCCTGG + Intergenic
1089629503 11:119775346-119775368 GGAGCCCCAGGTAGGGTGGAGGG + Intergenic
1089917845 11:122176285-122176307 TGAGCCAGATGCAGTGTGCAAGG + Intergenic
1090838021 11:130467407-130467429 TGAGGCCAAAGCAGGGTGGAAGG + Intronic
1202810894 11_KI270721v1_random:26820-26842 TGGGCCCGAGGCAGGTTGGGTGG - Intergenic
1091641454 12:2240545-2240567 TGAGCCACAAGCTGGCTGGAAGG + Intronic
1096337120 12:50764650-50764672 TGGGCCCGGAGCCGGGCGGAGGG + Intronic
1099661478 12:85568596-85568618 TGGGCCCTGAGCAGGGAGGAAGG + Intergenic
1099738309 12:86599616-86599638 TGAGCTCACAGCAGGGTGGTGGG + Intronic
1106373837 13:29164224-29164246 TGTGCCCGCAACAGGCTGGAGGG + Intronic
1106935229 13:34711130-34711152 TGAGGCCTAGGCAAGGTGGAGGG + Intergenic
1111658211 13:91177774-91177796 TGAGCCTGAAGCAGAGTGACAGG + Intergenic
1112407291 13:99132469-99132491 GGAGTCTGAAGCAGGGAGGAGGG + Intergenic
1113912841 13:113852434-113852456 TGAACCTGAAGCAGCTTGGAGGG + Intronic
1114720742 14:24879461-24879483 TCAGCCTGGAGCAGGGAGGAGGG - Intronic
1116564453 14:46427796-46427818 TGAGCCCGGAGCATGGTGGTGGG - Intergenic
1119758354 14:77134308-77134330 TGGGCTAGAAGCAGGGTGAAGGG + Intronic
1121332580 14:93058589-93058611 TGGTCACGAGGCAGGGTGGAGGG + Intronic
1125731967 15:41897565-41897587 GGAGGCGGAAGCAGGTTGGAAGG + Exonic
1126352496 15:47759134-47759156 TGACCCTGAATCAGGGTGAAAGG - Intronic
1127484273 15:59404921-59404943 TGAGATGGAAGCAGGGTGGTAGG - Intronic
1127862190 15:63003668-63003690 TGAGAAGGAAGCAGGGAGGAAGG + Intergenic
1128229613 15:66025378-66025400 TCAGCCTGAGGCAGGGAGGAGGG + Intronic
1128330033 15:66749720-66749742 TGAGCTCAATGCATGGTGGAAGG + Intronic
1128736998 15:70058985-70059007 TGAGGCCTAGGGAGGGTGGAAGG + Intronic
1129454151 15:75667563-75667585 TGAGCCTAAGGCAGGGTGGGAGG - Intergenic
1131264185 15:90906054-90906076 TGAGCCCCAGGCTGGGTGGACGG + Intronic
1133333591 16:4991788-4991810 TGAGCACGGGGCAGGATGGAGGG - Intronic
1136459096 16:30398781-30398803 TGTGGCCGCAGCAGAGTGGATGG - Exonic
1136625777 16:31461441-31461463 TTTGCCAGAAGCACGGTGGATGG - Intronic
1139444436 16:66988203-66988225 TGAGCCCAGAGCCGGGTGGTGGG - Intergenic
1140478168 16:75249317-75249339 TGGGGCAGAAGTAGGGTGGAGGG - Intronic
1143174582 17:4948827-4948849 TGAGCCAGAAGAAGGAAGGAAGG + Exonic
1143203318 17:5127010-5127032 TGACCCCGCACCAGGGTGGGGGG + Intronic
1143539079 17:7558798-7558820 TGAGGCTGAGGGAGGGTGGAGGG + Exonic
1144793973 17:17878588-17878610 TGTGCCAGCAGCAGGGTAGAAGG + Intronic
1144954912 17:19014295-19014317 GGAGCCCTAAGGAAGGTGGAAGG - Intronic
1146443141 17:32914572-32914594 TGAGCCAGAAGCACTGTGAATGG - Intergenic
1147235882 17:39057161-39057183 TGAGCCTGGGCCAGGGTGGAGGG + Intergenic
1147258187 17:39194577-39194599 ACAGCCCGAAGCAAGCTGGAGGG + Intronic
1147323090 17:39657711-39657733 TCAGCCTGCAGCAGGGTGGGGGG + Intronic
1147888885 17:43703229-43703251 TGAGAACGAACCAGGGAGGAAGG - Intergenic
1147919987 17:43910160-43910182 TGAGGCTGAGGCAGGGAGGAAGG - Intergenic
1148457802 17:47820313-47820335 AGAGCAGGGAGCAGGGTGGAAGG + Exonic
1149569611 17:57663158-57663180 TGAGCCAGTGGCGGGGTGGAGGG + Intronic
1151243190 17:72774195-72774217 GGAACCAGAAGCAGGGAGGAAGG + Intronic
1151720568 17:75853468-75853490 TGAGCCCTAAGCCAGGTAGAAGG + Intronic
1151812085 17:76450277-76450299 TGACCACCAAGCAGGGTGGTAGG - Intronic
1152384773 17:79965809-79965831 TGAGCCAGGAGCAGGGGTGAAGG - Intronic
1152937448 17:83148727-83148749 TGTGCAGGAAGCAGGGTGGAGGG - Intergenic
1154210720 18:12376921-12376943 TGGGCCCGAGGCAGGGTGGAGGG + Intronic
1157157750 18:45284475-45284497 GGAGCCCAGGGCAGGGTGGAGGG - Intronic
1157446249 18:47748741-47748763 TGCGACGGAAGCAGGATGGATGG - Intergenic
1157867361 18:51197770-51197792 GGGGCCCGAAGGAGGGTGGGGGG - Intronic
1158169984 18:54586620-54586642 TGAGCCCTAAGAAGGATGGGGGG - Intergenic
1158591584 18:58783037-58783059 AGAGGCCGAGGCTGGGTGGATGG + Intergenic
1160450875 18:78965317-78965339 TGAGCCTGGAGCCAGGTGGAGGG - Intergenic
1161135861 19:2619478-2619500 TGAGCCCTAATCAGGGTGAAGGG + Intronic
1162719721 19:12655237-12655259 TGTGGCTGAAGCAGGGTGAACGG - Intronic
1163284602 19:16338550-16338572 TGAGCACCCAGCAGGGTGGCAGG - Intergenic
1164696025 19:30245052-30245074 TGAGGCTGAAGCCTGGTGGATGG - Intronic
1165431867 19:35777512-35777534 TGAGCATGAAGCAGGATGGCAGG - Intronic
1166049856 19:40252207-40252229 TCAGCCAGGAGCAGAGTGGAGGG + Intronic
1166097062 19:40546897-40546919 TGAAGACGAAGCAGGATGGAGGG + Intronic
1166978064 19:46616725-46616747 TGGTCATGAAGCAGGGTGGAAGG - Intergenic
1166991745 19:46697015-46697037 TGAGCTGGAAGCAGGGAGGCTGG + Intronic
1167577805 19:50326098-50326120 TGAGGCCAAAGCAAAGTGGAGGG - Intronic
1168377734 19:55894547-55894569 TGAGTCCCAAGGAGGCTGGAAGG - Intronic
925157495 2:1658751-1658773 TGAGCCCGATGCCGGGGGGTGGG - Intronic
926140605 2:10365684-10365706 GGAGCCTGAAGGAGGGTGGGCGG - Intronic
927377673 2:22437246-22437268 TGAGTCTCAAGCAGAGTGGATGG - Intergenic
927940928 2:27102352-27102374 TGAGCCGGGAGCAGGGTGAGGGG - Exonic
935211693 2:100944313-100944335 TGAGCTGGAAGTAGGCTGGATGG - Intronic
938976174 2:136480693-136480715 TCAGCCCGCAGAAGGGTGGCAGG + Intergenic
944715732 2:202375260-202375282 TGACCCCGCAGCGGGGTGTAAGG + Intergenic
946321530 2:218957512-218957534 TGAGCCAGAAACAGGGTTGGAGG + Intergenic
948571084 2:238917357-238917379 TGAGCCCCAACCAGAGGGGAGGG + Intergenic
948823980 2:240565613-240565635 AGAGCCCAAAGCTGGGGGGATGG + Intronic
949069955 2:242018447-242018469 AGGGCCCGAGGGAGGGTGGATGG + Intergenic
1172033078 20:31995317-31995339 GGAGCCTGAAGCAGGGAGAAAGG - Intronic
1173125377 20:40331717-40331739 TGTGCCCCATGGAGGGTGGAGGG - Intergenic
1174393304 20:50231452-50231474 AGTGGCCGAGGCAGGGTGGATGG + Intergenic
1175838395 20:62011129-62011151 TGAGGAGGCAGCAGGGTGGAGGG + Intronic
1180049561 21:45325069-45325091 TGAGCCCGAAGCAGGGGCACCGG - Intergenic
1180081307 21:45488992-45489014 TGAGCACGCAGCGGGGTGAAAGG - Intronic
1182566785 22:31206060-31206082 TTAGCCAGGAGCAGTGTGGATGG - Exonic
1183306729 22:37086732-37086754 TGATTCTGTAGCAGGGTGGAGGG - Intronic
1183391313 22:37546943-37546965 TGAGCCCGCAGCGGGCTGCAAGG - Intergenic
1183769694 22:39913250-39913272 TGAGCCCCAGGAGGGGTGGAAGG + Intronic
1183930210 22:41231750-41231772 TGAGGCAGAAGCAGGGATGAGGG - Intronic
950043951 3:9937991-9938013 TGAGGCAGGGGCAGGGTGGAGGG - Intronic
953305082 3:41821573-41821595 TGACCCTGAAGAAGGGAGGATGG - Intronic
953877989 3:46677132-46677154 CAAGCCCCAAGAAGGGTGGATGG + Intronic
956035807 3:65089971-65089993 TGATCCTGAAGTGGGGTGGAGGG - Intergenic
960439600 3:117670497-117670519 TGAGCCTGAAGAAGTGTGCAGGG - Intergenic
962251665 3:133839688-133839710 TGAGCCAGGAGCAGGAGGGAGGG + Intronic
962900062 3:139754255-139754277 TTAGCCCAAAGGAGGGTGTAAGG + Intergenic
963215921 3:142747524-142747546 TGAGCCACAAACAGGGTGGCTGG - Intronic
964945057 3:162211549-162211571 TGAGCTGGGAGCAGTGTGGAAGG - Intergenic
968049176 3:195642385-195642407 AGGGCCCGAGGGAGGGTGGATGG + Intergenic
968098224 3:195947245-195947267 AGGGCCCGAGGGAGGGTGGATGG - Intergenic
968305440 3:197647549-197647571 AGGGCCCGAGGGAGGGTGGATGG - Intergenic
969285339 4:6199388-6199410 GGAGCCCACAGCAGGGGGGATGG + Intronic
969846449 4:9923788-9923810 TGAGGCCCAAGGAGGGTGGATGG - Intronic
970379107 4:15488793-15488815 TGTGCCCGAAGCAGTGTGTGAGG - Intronic
974926303 4:68302959-68302981 TAAGCCCTAAACAAGGTGGAGGG + Intergenic
978627854 4:110707732-110707754 TCAGCCAGATGCAGGCTGGAAGG - Intergenic
979461810 4:120992492-120992514 TGCGCCAGAAGAAGGTTGGAAGG - Intergenic
979558377 4:122076340-122076362 TTAGCCAGGAGCAGTGTGGATGG + Intergenic
979775467 4:124583571-124583593 TGAGCCCCTAGCAGGATGGGTGG + Intergenic
983589620 4:169393434-169393456 TGAGTCCAAAGCAGGCTGGTTGG - Exonic
985742461 5:1626692-1626714 AGGGCCCGAGGGAGGGTGGATGG - Intergenic
986975858 5:13393024-13393046 TGATCCCCAGGCAGGGTGCAGGG - Intergenic
988582679 5:32481935-32481957 TGGGCCCCCAGCAGGTTGGATGG - Intergenic
988777645 5:34491411-34491433 TGAGCCAGACGCTGGGGGGATGG + Intergenic
989741534 5:44779220-44779242 TGAGACCGAAACTGTGTGGAAGG + Intergenic
990225989 5:53654380-53654402 TTGGCCTGATGCAGGGTGGAGGG + Intronic
992484513 5:77181545-77181567 TGAGCCAGAAGCAGAATGGATGG - Intergenic
997854822 5:137363922-137363944 TCTGCAGGAAGCAGGGTGGATGG + Intronic
998851775 5:146357867-146357889 TTAGCCTGAAGCAGGTTAGAAGG - Intergenic
998951078 5:147393619-147393641 GGAGCCTGGAGCAAGGTGGAGGG - Exonic
1002022387 5:176372082-176372104 TGAAGCCGAAGCAGGGAGGTGGG + Exonic
1003774661 6:9346943-9346965 TGGTCAGGAAGCAGGGTGGAAGG + Intergenic
1004265933 6:14148566-14148588 TGAGCCCTGAGCAGGGAGGTGGG - Intergenic
1006171413 6:32095519-32095541 TGAGCCTGAGGAAGAGTGGAGGG - Intronic
1007316536 6:40993774-40993796 TGAGCTGGAAATAGGGTGGATGG + Intergenic
1007719464 6:43876550-43876572 TGAGCCCGGAGTGGGGTGGCCGG - Intergenic
1009995117 6:70888530-70888552 TGAGCCCGTAGCGGGCTGGGAGG - Intronic
1015835633 6:137417247-137417269 TCAGCCTGAATCAGGGTGGAAGG + Intergenic
1015914595 6:138203233-138203255 TGAGACCAAAGGAGGTTGGAAGG + Intronic
1015998232 6:139016235-139016257 TGAGCCCTCAGCAGGATTGAGGG + Intergenic
1016056247 6:139580494-139580516 TGAACCAGAAGGAGGGTGGTGGG - Intergenic
1016873597 6:148842572-148842594 AGAGCCCGAAGGAAGGTGGTGGG + Intronic
1022449872 7:30504731-30504753 GGAGCCTGAAGCAGAGTGTAAGG + Exonic
1023338752 7:39197099-39197121 TGAGCGTGTAGGAGGGTGGAGGG + Intronic
1023773595 7:43583008-43583030 GGGGCCAGAAGCAGGGTGCAGGG + Intronic
1029996600 7:105013497-105013519 TTACCCCGAAGCACGGTGGCAGG + Intergenic
1030214843 7:107033869-107033891 TGACCCTGAAGCAGGGTAAATGG + Intergenic
1034569211 7:151941577-151941599 TGGGGCTGAAGCAGTGTGGAGGG + Intergenic
1035037173 7:155902912-155902934 TGAGCCCTCTGCAGAGTGGAAGG + Intergenic
1037700316 8:21267818-21267840 TGAGACAGAAGCAGGGAAGAGGG + Intergenic
1039881919 8:41630502-41630524 TGAGCCGGAAGCATGGAGGAGGG - Intergenic
1042362785 8:67901489-67901511 TTAGCCAGAAGCAGAGTAGAGGG - Intergenic
1042812340 8:72840062-72840084 TGAGCCTGTTGCAGGGTGGGGGG - Intronic
1043784498 8:84380938-84380960 TCAGACAGAAGCTGGGTGGAGGG + Intronic
1045295916 8:100871704-100871726 TGAGAGCAGAGCAGGGTGGATGG + Intergenic
1046982880 8:120355657-120355679 TGAGGCCGAGGCGGGGTGGGGGG - Intronic
1048896902 8:139000476-139000498 TGGTCCTGAAGCAGGGTGCATGG + Intergenic
1048977743 8:139682399-139682421 TGAGCACGACACAGGGTGGCAGG + Intronic
1049426356 8:142539614-142539636 TGAGGCCGAAGGAGGGTCCATGG + Intronic
1049580720 8:143409312-143409334 TGAGACTGAAGGAGGGTGAAGGG - Intergenic
1060742828 9:126110798-126110820 TGAGCACTAAACAGGTTGGAGGG + Intergenic
1060750075 9:126163110-126163132 TGAGCACGAAGCCTGGTGCATGG + Intergenic
1061445247 9:130633879-130633901 GTAGCCTGAAGCAGGGAGGAAGG - Intronic
1062529326 9:136992976-136992998 TGAGACCCAAGCAGGGAGGAAGG + Intronic
1186766328 X:12773997-12774019 TGAGCAGGAAGCAGGGTTCAGGG - Intergenic
1187077289 X:15947783-15947805 GTAGCCAGCAGCAGGGTGGAGGG + Intergenic
1188101223 X:26090449-26090471 GGAGCCTGTAGGAGGGTGGAAGG + Intergenic
1190303829 X:49071530-49071552 TGAGCATGGAGAAGGGTGGATGG + Exonic
1190626484 X:52342911-52342933 TGAGCCCACAGCTGGGGGGAAGG + Intergenic
1193698816 X:84739830-84739852 AGAGTCAGAAGCAGGGTGGTTGG - Intergenic
1194985284 X:100483631-100483653 TGAGCCTGAAACAGGCTGGCAGG - Intergenic
1200066343 X:153505845-153505867 AGGGCCTGAAGCAGGGTGGGCGG - Exonic
1201724054 Y:17134685-17134707 TGATCCAGCAGCAGGATGGAGGG - Intergenic