ID: 915564513

View in Genome Browser
Species Human (GRCh38)
Location 1:156706182-156706204
Sequence GTGAGCCCGAAGCAGGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915564513_915564520 -3 Left 915564513 1:156706182-156706204 CCTCCACCCTGCTTCGGGCTCAC 0: 1
1: 0
2: 1
3: 19
4: 205
Right 915564520 1:156706202-156706224 CACGTAATGCCTGGGGACTCTGG 0: 1
1: 0
2: 1
3: 9
4: 104
915564513_915564519 -10 Left 915564513 1:156706182-156706204 CCTCCACCCTGCTTCGGGCTCAC 0: 1
1: 0
2: 1
3: 19
4: 205
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG 0: 1
1: 0
2: 0
3: 0
4: 43
915564513_915564522 11 Left 915564513 1:156706182-156706204 CCTCCACCCTGCTTCGGGCTCAC 0: 1
1: 0
2: 1
3: 19
4: 205
Right 915564522 1:156706216-156706238 GGACTCTGGAAGTAGTCGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915564513 Original CRISPR GTGAGCCCGAAGCAGGGTGG AGG (reversed) Intergenic
900862271 1:5242134-5242156 GTGAGTCCTGAGCAGGGAGGAGG + Intergenic
901004216 1:6164044-6164066 CTGTGCCCTCAGCAGGGTGGGGG - Intronic
901251851 1:7784816-7784838 GTGAGCGAGAAGCAGGCTGCGGG + Exonic
902055717 1:13598909-13598931 GCGAGCAGGTAGCAGGGTGGGGG + Intronic
902339682 1:15774839-15774861 GCGAGACCCAAGCAGGGTGAAGG + Exonic
902372039 1:16013288-16013310 GTGAGCCTGACCCCGGGTGGGGG + Intergenic
903180167 1:21601365-21601387 AGGAACCCGAAGCAGGGTTGGGG - Intronic
904809941 1:33156947-33156969 GTGGGCGTGAAGCAGGGTGGTGG - Intronic
906154209 1:43604682-43604704 GTGAGCACCAAACAGGGCGGGGG - Intronic
909047769 1:70730710-70730732 GTGACCAGGGAGCAGGGTGGTGG + Intergenic
909441891 1:75705759-75705781 TTGAACCCGGTGCAGGGTGGAGG - Intergenic
909650663 1:77972503-77972525 GGGAGGCCGAGGCAGGGCGGGGG + Intronic
910907902 1:92201013-92201035 GTGAGGCTGAGGCAGGGTGATGG - Intergenic
912338257 1:108883996-108884018 GTGAGCCTGAACCCGGGAGGCGG - Intronic
915564513 1:156706182-156706204 GTGAGCCCGAAGCAGGGTGGAGG - Intergenic
915604405 1:156941620-156941642 CTGAGCCTGAAGAAGGGTGAGGG - Intronic
919030318 1:192234120-192234142 GTGAGCCCTGAGGAGGGTGTGGG - Intergenic
920293177 1:204938529-204938551 GGGAGCCGGCGGCAGGGTGGGGG - Intronic
922213882 1:223505427-223505449 GGGAGGCTGAGGCAGGGTGGCGG - Intergenic
922452934 1:225751197-225751219 GGGACCCCGAAGAAGGGAGGTGG + Intergenic
923325082 1:232873753-232873775 GAGAGCCCGAGGCAGTGTGAGGG + Intergenic
1063520401 10:6735830-6735852 ATAAGCCAGAAGCAAGGTGGGGG - Intergenic
1063629919 10:7723648-7723670 TTCAGCCCTAAGCAGGGAGGAGG - Intronic
1070544251 10:77440191-77440213 GTGGGCCAGATGCTGGGTGGAGG + Intronic
1071603809 10:86971375-86971397 GTGAGAACGAAGCACGGTTGTGG + Intronic
1075923977 10:126235848-126235870 GTAAGCAAGAAGCAGGGTGTGGG + Intronic
1076563204 10:131381032-131381054 GTGGGCCCTGAGCAGGGTGCAGG + Intergenic
1076725333 10:132410457-132410479 GGGAGCAGGAAGGAGGGTGGCGG + Intronic
1077704198 11:4468388-4468410 GTGAGCAGGAAGGTGGGTGGGGG + Intergenic
1077886257 11:6390301-6390323 GTGCGCCCGGGGCAGGGCGGGGG + Intergenic
1080099186 11:28439591-28439613 GTGGGCCCAATGCGGGGTGGAGG + Intergenic
1080571764 11:33563392-33563414 GTCAGCCTGTAACAGGGTGGAGG + Intronic
1083419111 11:62543632-62543654 GTGTGCCCGAGGGAGTGTGGGGG - Intronic
1083755075 11:64787966-64787988 GTGAGCCCCAAGGAGGGTGAGGG - Intergenic
1084165468 11:67373104-67373126 GGGAGCCCGAGGCCGGGCGGCGG - Intronic
1084448874 11:69220835-69220857 GCGAGGCTGAGGCAGGGTGGAGG - Intergenic
1084966986 11:72750148-72750170 GGGAGCCTGAAGCGGGGTAGAGG + Intronic
1085076604 11:73597718-73597740 GTGGGACCCAAGCAGGTTGGGGG - Intronic
1085283614 11:75346198-75346220 GTGACCCCGGAGCTGGGTGCTGG - Intronic
1085886916 11:80532820-80532842 GGGAGCCCACCGCAGGGTGGTGG + Intergenic
1089214106 11:116825356-116825378 GTGGGCCAGAGGCAGGGTGATGG + Intergenic
1089505231 11:118958035-118958057 GTGAGCCTCAGGCAGGCTGGGGG + Intronic
1090375159 11:126283154-126283176 GTGAGCCCGGGGCGGGGTCGCGG + Intronic
1090982737 11:131737755-131737777 GTGAGCAGGAGGCAGGATGGGGG + Intronic
1091566576 12:1653128-1653150 GGGAGGCCGAAGCGGGGGGGGGG + Intergenic
1094123431 12:26998070-26998092 GGGAGGCCGAAGCAGGTTGCAGG - Intronic
1096230508 12:49894310-49894332 GTGAGACCAGAGCTGGGTGGAGG - Intronic
1097195956 12:57242628-57242650 TTGAGCTCGATGCCGGGTGGGGG - Intergenic
1099738308 12:86599615-86599637 CTGAGCTCACAGCAGGGTGGTGG + Intronic
1104262538 12:127197629-127197651 GTGAGCAAGGAGTAGGGTGGTGG - Intergenic
1104969360 12:132524242-132524264 GGGAGCCGGGGGCAGGGTGGTGG - Intronic
1105635526 13:22212084-22212106 GTGAGTCAGAAGCAGGGTCAGGG + Intergenic
1105986905 13:25576391-25576413 GTGTGCTCGAAGCCTGGTGGTGG + Intronic
1106935228 13:34711129-34711151 GTGAGGCCTAGGCAAGGTGGAGG + Intergenic
1107929885 13:45298541-45298563 GTGGGCCTGCAGCAGGGGGGAGG - Intergenic
1114559301 14:23578903-23578925 GGGAGGCCGAAGCCGGGCGGGGG + Intergenic
1114720743 14:24879462-24879484 GTCAGCCTGGAGCAGGGAGGAGG - Intronic
1116564454 14:46427797-46427819 ATGAGCCCGGAGCATGGTGGTGG - Intergenic
1116988223 14:51244114-51244136 CTGAGCCCCCAGCAGGGAGGTGG - Intronic
1119487785 14:75003048-75003070 GAGACCCTGAAGCGGGGTGGTGG + Exonic
1119558652 14:75572433-75572455 GAGAGGCTGCAGCAGGGTGGTGG + Intergenic
1121350164 14:93167120-93167142 GGGAGGCCGAGGCAGGGTGGAGG - Intergenic
1122388138 14:101362731-101362753 GTGAGTGCGGAGCAGAGTGGAGG - Intergenic
1122806474 14:104262576-104262598 GTTGGCCCCAAGCAGGATGGTGG + Intergenic
1123996364 15:25720620-25720642 GGGAGGCCGAAGGAGGCTGGTGG + Intronic
1124251008 15:28106602-28106624 GGGAGCGCACAGCAGGGTGGGGG + Intergenic
1124965316 15:34429053-34429075 GTGAGGACGCAGGAGGGTGGCGG - Intronic
1124981932 15:34575255-34575277 GTGAGGACGCAGGAGGGTGGCGG - Intronic
1127727523 15:61764610-61764632 GGGAGCCCTGAGCTGGGTGGAGG - Intergenic
1127825123 15:62696256-62696278 GTGAGGCGGAAGGAAGGTGGAGG - Intronic
1128229612 15:66025377-66025399 GTCAGCCTGAGGCAGGGAGGAGG + Intronic
1128566080 15:68701037-68701059 GTGTGCAGGAGGCAGGGTGGTGG - Intronic
1129194286 15:73954903-73954925 GTGTGTCCGTGGCAGGGTGGGGG - Intergenic
1132748117 16:1445401-1445423 GTGAGGGCTAAGCAGGGTGGTGG + Exonic
1132822188 16:1879798-1879820 GTGAGCCCCAAGAAGGAAGGTGG - Intronic
1132869492 16:2109469-2109491 GTGGGCCAGCAGCAAGGTGGTGG - Exonic
1133460617 16:5983668-5983690 GGAAGCCCCAAGCAGGATGGAGG - Intergenic
1134717924 16:16366130-16366152 GTGGGCCAGCAGCAAGGTGGTGG + Intergenic
1134956827 16:18386029-18386051 GTGGGCCAGCAGCAAGGTGGTGG - Intergenic
1135616787 16:23917621-23917643 GTGAGCCCCATGCCAGGTGGCGG + Intronic
1139444437 16:66988204-66988226 GTGAGCCCAGAGCCGGGTGGTGG - Intergenic
1140664058 16:77212650-77212672 GGGAGCCCGAGGAAGGGAGGCGG + Intronic
1141700764 16:85641007-85641029 GGGAGCCCTGGGCAGGGTGGAGG + Intronic
1143203317 17:5127009-5127031 CTGACCCCGCACCAGGGTGGGGG + Intronic
1143380558 17:6493569-6493591 GTGACCACGTAGCAGGGTGCTGG + Intronic
1143485741 17:7252599-7252621 GAGAGCCAGAGGCACGGTGGCGG + Intronic
1143539295 17:7559757-7559779 GTAAGCCCGAGTCAGGGTGAGGG + Intronic
1143874950 17:9984595-9984617 GTGGGCCCTAAGCAGGGCAGTGG - Intronic
1144717746 17:17446145-17446167 TTGTGCCTGATGCAGGGTGGAGG - Intergenic
1144835970 17:18156927-18156949 GTCAGCCAGAGGCAGGGTGAGGG - Intronic
1146375177 17:32288978-32289000 GTGATCATGAACCAGGGTGGGGG - Exonic
1147235881 17:39057160-39057182 GTGAGCCTGGGCCAGGGTGGAGG + Intergenic
1147258186 17:39194576-39194598 GACAGCCCGAAGCAAGCTGGAGG + Intronic
1147323089 17:39657710-39657732 GTCAGCCTGCAGCAGGGTGGGGG + Intronic
1147614030 17:41818064-41818086 GTGAGAGCGCAGCAGCGTGGAGG - Intronic
1148354943 17:46969347-46969369 GTCAGCAGGAAGGAGGGTGGTGG + Intronic
1148852230 17:50560896-50560918 GTGAGCCCGCGGCGGGGCGGGGG + Intergenic
1151472777 17:74328160-74328182 GTGAGGCTGAGGCAGGCTGGAGG + Intronic
1152056467 17:78031749-78031771 GTGAGCCCAACCCAGGGTGCTGG + Exonic
1152281850 17:79389561-79389583 CTGAGGCCGAGGCAGGGTGGGGG - Intronic
1152937449 17:83148728-83148750 CTGTGCAGGAAGCAGGGTGGAGG - Intergenic
1154210719 18:12376920-12376942 GTGGGCCCGAGGCAGGGTGGAGG + Intronic
1155229281 18:23757359-23757381 GAGAGCGCCAAGCAGGCTGGAGG - Intronic
1157426870 18:47591643-47591665 GAGAGAAGGAAGCAGGGTGGAGG + Intergenic
1157736626 18:50055239-50055261 GTGAGTCCGGGGCAGGGGGGCGG - Intronic
1157867362 18:51197771-51197793 CGGGGCCCGAAGGAGGGTGGGGG - Intronic
1158169985 18:54586621-54586643 CTGAGCCCTAAGAAGGATGGGGG - Intergenic
1160724121 19:610133-610155 GTGTGCCCGCTGCAGGCTGGGGG + Intronic
1160754208 19:749237-749259 CTGAGGCCCCAGCAGGGTGGAGG - Intergenic
1161135860 19:2619477-2619499 CTGAGCCCTAATCAGGGTGAAGG + Intronic
1161491636 19:4565391-4565413 GTGAGGCTGAAGCAGGATGATGG + Intergenic
1163324571 19:16594933-16594955 GTGAGGCCGAGGCAGGCTGATGG - Intronic
1163829729 19:19541860-19541882 GGGAGCCCGTCACAGGGTGGGGG + Intronic
1166049855 19:40252206-40252228 GTCAGCCAGGAGCAGAGTGGAGG + Intronic
1166097061 19:40546896-40546918 GTGAAGACGAAGCAGGATGGAGG + Intronic
1166130744 19:40744238-40744260 GTGAGCCCTCAGCACGGTGCTGG - Intronic
1166780262 19:45338582-45338604 ATGAGCCCCAAGAAGGGAGGAGG - Intronic
1166948915 19:46413498-46413520 GTCAGCCTGGAGCTGGGTGGCGG - Exonic
1167145086 19:47676551-47676573 GGGAGGCCGAAGGAAGGTGGGGG - Intronic
1167356204 19:49005877-49005899 GGGAGGCCGAGGCAGGGGGGTGG - Intronic
1167418651 19:49390231-49390253 GTGAAGCCGAAGCAGGATGCAGG + Intronic
925157496 2:1658752-1658774 ATGAGCCCGATGCCGGGGGGTGG - Intronic
927714075 2:25341520-25341542 TTGAGCCCGGAGCCGGGCGGGGG + Intronic
927940929 2:27102353-27102375 CTGAGCCGGGAGCAGGGTGAGGG - Exonic
929211874 2:39366252-39366274 GACAGCTTGAAGCAGGGTGGTGG + Intronic
933228034 2:79773440-79773462 GACAGCTCGAAGCAGGGAGGGGG + Intronic
933901996 2:86856618-86856640 GTGAGCAGGAAGCAGGGCAGTGG + Intronic
935778551 2:106492654-106492676 GTGAGCAGGAAGCAGGGCAGTGG - Intergenic
935878327 2:107536175-107536197 TGGAGCCCACAGCAGGGTGGAGG + Intergenic
940653188 2:156457684-156457706 GTTAGGCCAAAGCAGGGTTGTGG + Intronic
941119854 2:161515634-161515656 GGGGGCCTGTAGCAGGGTGGGGG + Intronic
942329084 2:174803095-174803117 CTGAGTCCTAATCAGGGTGGTGG + Intronic
947878065 2:233480811-233480833 GGGAGCCCGCAGCAGGGCTGAGG + Intronic
1169033779 20:2433169-2433191 GTGAGCTAGAGGCAGAGTGGAGG + Intergenic
1169268690 20:4182876-4182898 GTGAGGAAGAAGCAGGGTGGGGG - Intronic
1169927712 20:10800302-10800324 GAGACCCAGAGGCAGGGTGGTGG - Intergenic
1170663724 20:18366852-18366874 ATAAGCCAGGAGCAGGGTGGAGG + Intergenic
1172094937 20:32455990-32456012 GTGACACCGAGCCAGGGTGGTGG - Intronic
1173569189 20:44065925-44065947 CTGAGCGGGAAGGAGGGTGGCGG - Exonic
1173925731 20:46779881-46779903 GTAAGCCCTAAGCAAGGCGGGGG - Intergenic
1175577018 20:60067766-60067788 GTGGCCCTGAAGCAGGCTGGAGG - Intronic
1175696307 20:61105676-61105698 CTGGGCACGGAGCAGGGTGGGGG + Intergenic
1175838394 20:62011128-62011150 GTGAGGAGGCAGCAGGGTGGAGG + Intronic
1178532856 21:33389709-33389731 GGGAGGCCCAGGCAGGGTGGAGG + Intergenic
1180950314 22:19717953-19717975 GTCAGCCCCAAGCAGGGCTGGGG + Intronic
1181015635 22:20066887-20066909 GGGAGCCCTGGGCAGGGTGGGGG - Intergenic
1181063136 22:20291484-20291506 CTGAGCAGGTAGCAGGGTGGGGG - Intergenic
1181618483 22:24071343-24071365 GTGAGCCAGAGGCAGAATGGGGG + Intronic
1183386443 22:37518177-37518199 GTGGGCCTGGAGCATGGTGGGGG - Intronic
1183746383 22:39694308-39694330 GTGAGCTGCAGGCAGGGTGGTGG - Intergenic
1184339707 22:43879477-43879499 GTGAGAGTGAGGCAGGGTGGGGG - Intergenic
1184658035 22:45952002-45952024 GTGAGCTGGAAGGAGGGGGGCGG + Intronic
1184734344 22:46389255-46389277 GTGTCCCCGAGCCAGGGTGGCGG + Intronic
955159181 3:56447397-56447419 GTAAGCCCGAAGCAGCGGGGAGG + Intronic
958749917 3:98183475-98183497 GTGGGCCCCAAGCAAGGAGGAGG - Intronic
958784048 3:98577425-98577447 GTGAGACTAAAGTAGGGTGGTGG + Intronic
962251664 3:133839687-133839709 GTGAGCCAGGAGCAGGAGGGAGG + Intronic
967244933 3:187477169-187477191 GACAACCCGAAGCAGGGAGGGGG - Intergenic
968566574 4:1316616-1316638 GTTAGACAGAAGCAGGGAGGAGG - Intronic
968994388 4:3936508-3936530 TTGAGACCGTGGCAGGGTGGGGG - Intergenic
969388727 4:6874800-6874822 CATAGCCCGAAACAGGGTGGTGG + Intronic
971695439 4:29896341-29896363 GTGAGTCCGAAGAATGGTGTTGG - Intergenic
974145645 4:57943933-57943955 GTGCGCCAGAGGCTGGGTGGGGG + Intergenic
974926302 4:68302958-68302980 GTAAGCCCTAAACAAGGTGGAGG + Intergenic
976718764 4:88150413-88150435 GTGAGGCTGAAGCAGAGTGAGGG + Intronic
983497079 4:168454824-168454846 GTGAGGCAGAAGCAGGTTTGGGG + Intronic
985669430 5:1200095-1200117 ATGAGCCCTGTGCAGGGTGGAGG + Intergenic
985745929 5:1647737-1647759 GTGGGCACCAAGCAGGGTGGTGG - Intergenic
986737676 5:10680251-10680273 GTGACCACGGACCAGGGTGGAGG - Exonic
990471157 5:56116927-56116949 ATGAGCCCGAAGGATGATGGTGG + Intronic
997766518 5:136509904-136509926 GTGTGCCAGTAGCAGGGTGGTGG + Intergenic
998951079 5:147393620-147393642 GGGAGCCTGGAGCAAGGTGGAGG - Exonic
999330276 5:150669200-150669222 GGGAGCCCGAGGGGGGGTGGGGG + Intronic
1001740880 5:174051869-174051891 CTGAGCCCTCAGAAGGGTGGAGG + Intronic
1002022386 5:176372081-176372103 GTGAAGCCGAAGCAGGGAGGTGG + Exonic
1002700829 5:181123449-181123471 GACAGCTCGAAGCAGGGAGGGGG + Intergenic
1004265934 6:14148567-14148589 ATGAGCCCTGAGCAGGGAGGTGG - Intergenic
1006463390 6:34176971-34176993 GTGTCCCTGAGGCAGGGTGGTGG - Intergenic
1006491382 6:34391754-34391776 GTGAGCCCAAAGCTGAGGGGTGG - Intronic
1006844821 6:37054918-37054940 GGGAGCACGACGCAGGGTGAGGG - Intergenic
1007302470 6:40877670-40877692 GTGAGCCAGTTGCAGGGTGGTGG - Intergenic
1007841579 6:44720440-44720462 GGCAGCCAGAAACAGGGTGGGGG + Intergenic
1011826371 6:91310210-91310232 ATGAGCCCAAAGCAGGGTAGTGG + Intergenic
1013498199 6:110719987-110720009 GGGAGGCCGAAGCAGGGGGGGGG - Intronic
1014269709 6:119322906-119322928 CTGAGCCCACAGCAAGGTGGTGG + Intronic
1015198558 6:130552317-130552339 CTGAGTCCGAAGCTGAGTGGTGG + Intergenic
1016056248 6:139580495-139580517 TTGAACCAGAAGGAGGGTGGTGG - Intergenic
1016527380 6:145017455-145017477 GAGAGGCTGAAGCAGTGTGGTGG - Intergenic
1016873596 6:148842571-148842593 CAGAGCCCGAAGGAAGGTGGTGG + Intronic
1017763073 6:157585941-157585963 GTGATTCCCAGGCAGGGTGGAGG + Intronic
1017801309 6:157898804-157898826 GTAAGCCCAAAGCAGGGTGCAGG + Intronic
1019482883 7:1274514-1274536 GTGCCCCCCAAGCAGGGTAGTGG - Intergenic
1023791773 7:43758614-43758636 GGGGCCCCGAAGCGGGGTGGCGG - Intergenic
1024045298 7:45581571-45581593 TTGAGCCCCAAGCAGCATGGGGG + Intronic
1027662651 7:81005826-81005848 GTGAGCCCGATGCAGAGAGAAGG + Intergenic
1029509871 7:100987403-100987425 GTGGGCCTGAACCAGGGTGCAGG + Intronic
1034433820 7:151053718-151053740 TTGAGCCAGAAGCAGGATTGCGG + Intergenic
1039881920 8:41630503-41630525 GTGAGCCGGAAGCATGGAGGAGG - Intergenic
1041097262 8:54362054-54362076 GTGAGCCTGAGGGAGGTTGGGGG + Intergenic
1042551130 8:69994910-69994932 ATAAACCCGCAGCAGGGTGGGGG - Intergenic
1042812341 8:72840063-72840085 CTGAGCCTGTTGCAGGGTGGGGG - Intronic
1045033907 8:98162714-98162736 GGGACCCTGAAGCAGGGTGTGGG + Intergenic
1045625857 8:104049336-104049358 GTGAACCCGAACCCGGGAGGCGG + Intronic
1046982881 8:120355658-120355680 GTGAGGCCGAGGCGGGGTGGGGG - Intronic
1049445698 8:142630374-142630396 GTGGGGCAGAAGCTGGGTGGGGG - Intergenic
1049783293 8:144438791-144438813 GGGAGCTTGCAGCAGGGTGGGGG - Intronic
1056372616 9:85972426-85972448 TTGAGCCCAGAGCGGGGTGGAGG + Intronic
1056677213 9:88685999-88686021 GTGAGCCCACAGCAGCGGGGAGG + Intergenic
1057226076 9:93293877-93293899 GTGTGCCAGAAACAGAGTGGTGG - Intronic
1059552297 9:115241362-115241384 TTGAACCTGAAGCAGGGCGGAGG + Intronic
1060759593 9:126236063-126236085 GTCAACCAGACGCAGGGTGGTGG - Intergenic
1061390475 9:130314907-130314929 GTGAGGCAGAGGCAGAGTGGGGG + Intronic
1061845317 9:133384971-133384993 GTGTGACCGAAGCACAGTGGTGG + Intronic
1061899223 9:133664461-133664483 GGGAGCCCGAGCCAGGGTGTGGG - Intronic
1062030758 9:134360897-134360919 CTGAGCCCGATGCAGGGCGAGGG + Intronic
1062273935 9:135721873-135721895 GTGGGCCTGAGTCAGGGTGGGGG + Intronic
1062555337 9:137111242-137111264 GTGAGACGGGAGCAGGGTAGGGG + Intronic
1062555355 9:137111299-137111321 GTGAGACGGGAGCAGGGTAGGGG + Intronic
1062555373 9:137111356-137111378 GTGAGACGGGAGCAGGGTAGGGG + Intronic
1186766329 X:12773998-12774020 GTGAGCAGGAAGCAGGGTTCAGG - Intergenic
1187048705 X:15675241-15675263 GTGAGCCCAAGGGAGGGAGGTGG + Intergenic
1192331087 X:70175747-70175769 GGAAGCCCAAAGCAGAGTGGGGG + Intergenic
1196248316 X:113427758-113427780 GTGAGCCACATGCAGAGTGGGGG + Intergenic
1196694238 X:118594069-118594091 GTGAGCCAGAGGGAGGTTGGGGG + Intronic
1200108217 X:153725943-153725965 GGCCGCCCGAAGCAGGGTGTAGG - Exonic
1201157819 Y:11149445-11149467 GTGAGCCTGTGGCAGGGTAGGGG + Intergenic