ID: 915564519

View in Genome Browser
Species Human (GRCh38)
Location 1:156706195-156706217
Sequence TCGGGCTCACGTAATGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915564509_915564519 -5 Left 915564509 1:156706177-156706199 CCACCCCTCCACCCTGCTTCGGG No data
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG No data
915564511_915564519 -8 Left 915564511 1:156706180-156706202 CCCCTCCACCCTGCTTCGGGCTC No data
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG No data
915564504_915564519 -1 Left 915564504 1:156706173-156706195 CCCCCCACCCCTCCACCCTGCTT No data
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG No data
915564505_915564519 -2 Left 915564505 1:156706174-156706196 CCCCCACCCCTCCACCCTGCTTC No data
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG No data
915564506_915564519 -3 Left 915564506 1:156706175-156706197 CCCCACCCCTCCACCCTGCTTCG No data
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG No data
915564512_915564519 -9 Left 915564512 1:156706181-156706203 CCCTCCACCCTGCTTCGGGCTCA No data
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG No data
915564513_915564519 -10 Left 915564513 1:156706182-156706204 CCTCCACCCTGCTTCGGGCTCAC No data
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG No data
915564507_915564519 -4 Left 915564507 1:156706176-156706198 CCCACCCCTCCACCCTGCTTCGG No data
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915564519 Original CRISPR TCGGGCTCACGTAATGCCTG GGG Intergenic