ID: 915564519

View in Genome Browser
Species Human (GRCh38)
Location 1:156706195-156706217
Sequence TCGGGCTCACGTAATGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 43}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915564506_915564519 -3 Left 915564506 1:156706175-156706197 CCCCACCCCTCCACCCTGCTTCG 0: 1
1: 1
2: 4
3: 45
4: 635
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG 0: 1
1: 0
2: 0
3: 0
4: 43
915564512_915564519 -9 Left 915564512 1:156706181-156706203 CCCTCCACCCTGCTTCGGGCTCA 0: 1
1: 0
2: 2
3: 12
4: 201
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG 0: 1
1: 0
2: 0
3: 0
4: 43
915564511_915564519 -8 Left 915564511 1:156706180-156706202 CCCCTCCACCCTGCTTCGGGCTC 0: 1
1: 0
2: 6
3: 35
4: 315
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG 0: 1
1: 0
2: 0
3: 0
4: 43
915564505_915564519 -2 Left 915564505 1:156706174-156706196 CCCCCACCCCTCCACCCTGCTTC 0: 1
1: 3
2: 18
3: 195
4: 1553
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG 0: 1
1: 0
2: 0
3: 0
4: 43
915564507_915564519 -4 Left 915564507 1:156706176-156706198 CCCACCCCTCCACCCTGCTTCGG 0: 1
1: 0
2: 6
3: 28
4: 340
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG 0: 1
1: 0
2: 0
3: 0
4: 43
915564509_915564519 -5 Left 915564509 1:156706177-156706199 CCACCCCTCCACCCTGCTTCGGG 0: 1
1: 0
2: 1
3: 49
4: 401
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG 0: 1
1: 0
2: 0
3: 0
4: 43
915564504_915564519 -1 Left 915564504 1:156706173-156706195 CCCCCCACCCCTCCACCCTGCTT 0: 1
1: 2
2: 14
3: 200
4: 1765
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG 0: 1
1: 0
2: 0
3: 0
4: 43
915564513_915564519 -10 Left 915564513 1:156706182-156706204 CCTCCACCCTGCTTCGGGCTCAC 0: 1
1: 0
2: 1
3: 19
4: 205
Right 915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG 0: 1
1: 0
2: 0
3: 0
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915564519 Original CRISPR TCGGGCTCACGTAATGCCTG GGG Intergenic
907441588 1:54481873-54481895 TTGGACTCAGGTACTGCCTGAGG + Intergenic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
921274943 1:213510200-213510222 ACAGGCACAGGTAATGCCTGGGG - Intergenic
1066478988 10:35777230-35777252 TGTGGCTCACTTAGTGCCTGCGG - Intergenic
1068491705 10:57732561-57732583 TAAGGCTCACATAATGCCGGTGG + Intergenic
1068987713 10:63122535-63122557 TAGGGCTCACCTGAAGCCTGGGG + Intergenic
1071976655 10:90962566-90962588 TAGTGCTCACATAAGGCCTGTGG - Intergenic
1073156520 10:101351472-101351494 TCTGGCTCAGGTAATGAATGAGG - Intergenic
1073229839 10:101959728-101959750 TCTGGCTCCGCTAATGCCTGTGG - Intronic
1088075709 11:105845795-105845817 CCGGGTTCACGTCATTCCTGAGG - Intronic
1090919968 11:131198745-131198767 CTGGGCTCAGGTCATGCCTGAGG + Intergenic
1098523519 12:71460650-71460672 TCAGGGACACGTAATGTCTGTGG - Intronic
1112476882 13:99739479-99739501 ACGGGCCCACGGAAAGCCTGTGG + Intronic
1113829488 13:113284115-113284137 CCGTGTTCACGTCATGCCTGAGG - Intergenic
1128185973 15:65643778-65643800 TCGGGCTCTTGTTGTGCCTGGGG + Intronic
1142070258 16:88087923-88087945 AAGGGCTGACGAAATGCCTGTGG + Intronic
1145761264 17:27426467-27426489 TCGGGCTCACCCCGTGCCTGTGG + Intergenic
1146161310 17:30560624-30560646 TCGGGCTCACCCCGTGCCTGTGG + Exonic
1147536732 17:41326637-41326659 TCGGGCTCACCCTAAGCCTGTGG + Intergenic
1149813004 17:59696106-59696128 TCTGGCTCAGGTAATTTCTGAGG - Exonic
1152575632 17:81139629-81139651 TTGGGCTCTCATAAGGCCTGCGG - Intronic
1154106265 18:11526439-11526461 TTGGGCTCAAGAGATGCCTGGGG + Intergenic
1160624452 18:80193256-80193278 TCGGCCTCACGCATGGCCTGGGG + Intronic
1164705631 19:30317353-30317375 AGGGGCTCTCCTAATGCCTGGGG - Intronic
937165590 2:119813021-119813043 TCTGACTCACGGAATCCCTGAGG - Intronic
1179677311 21:42992570-42992592 TGGGGGTGACGTAATGACTGAGG + Intronic
1184286177 22:43472942-43472964 TGGAGCTCACGTAAGGGCTGGGG + Intronic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
983755472 4:171329285-171329307 TGGGGCTCACCCAGTGCCTGTGG - Intergenic
1000626929 5:163549252-163549274 TCGGGCTCACTGAATGTGTGTGG + Intergenic
1002670302 5:180861205-180861227 GCGGACTCACGTACTGGCTGTGG + Exonic
1004557402 6:16712770-16712792 TAGGGCTAACGTCCTGCCTGTGG + Intronic
1007415352 6:41688290-41688312 TAGGGCTTCCATAATGCCTGGGG - Intronic
1015142911 6:129955819-129955841 TCTGGCTCACTGAAGGCCTGAGG + Intergenic
1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG + Intronic
1019404426 7:876338-876360 TCTGGGTCACGTGTTGCCTGCGG + Intronic
1019404433 7:876368-876390 TCTGGGTCACGTGTTGCCTGCGG + Intronic
1035419101 7:158712163-158712185 TCTGGCTCACGTTGTCCCTGAGG - Intergenic
1042980353 8:74519357-74519379 TGGGCCTCACCTAAGGCCTGTGG - Intergenic
1049598354 8:143494868-143494890 TCGGGCTAACGTAAGGCCACTGG - Intronic
1049827402 8:144678435-144678457 TCAGACTCAGGTAATGTCTGTGG - Intergenic
1051343741 9:16134022-16134044 CCGTGCTCACTTAGTGCCTGCGG - Intergenic
1058985768 9:110207507-110207529 TAGGTCTCACTTAATGGCTGAGG - Exonic
1197717258 X:129718590-129718612 TCAGGCCCACCTGATGCCTGAGG - Intergenic