ID: 915569350

View in Genome Browser
Species Human (GRCh38)
Location 1:156735894-156735916
Sequence TACCTTCAGGAACAGGGTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915569341_915569350 17 Left 915569341 1:156735854-156735876 CCCACTGGTGGAGACGCTTATTC 0: 1
1: 0
2: 0
3: 1
4: 45
Right 915569350 1:156735894-156735916 TACCTTCAGGAACAGGGTGAGGG 0: 1
1: 0
2: 2
3: 14
4: 170
915569342_915569350 16 Left 915569342 1:156735855-156735877 CCACTGGTGGAGACGCTTATTCT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 915569350 1:156735894-156735916 TACCTTCAGGAACAGGGTGAGGG 0: 1
1: 0
2: 2
3: 14
4: 170
915569340_915569350 18 Left 915569340 1:156735853-156735875 CCCCACTGGTGGAGACGCTTATT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 915569350 1:156735894-156735916 TACCTTCAGGAACAGGGTGAGGG 0: 1
1: 0
2: 2
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915569350 Original CRISPR TACCTTCAGGAACAGGGTGA GGG Exonic
900567417 1:3340323-3340345 TTGTTTCAGGAACGGGGTGAAGG - Intronic
901530304 1:9848839-9848861 CTCCTTCTGGAACAGGCTGATGG + Exonic
913474389 1:119223065-119223087 TGCCTTAAGGGACATGGTGAGGG - Intergenic
915569350 1:156735894-156735916 TACCTTCAGGAACAGGGTGAGGG + Exonic
915667244 1:157456301-157456323 CACCTTCAGGGGAAGGGTGAAGG - Intergenic
917051453 1:170929301-170929323 TAACTTCAGGAAAAGCCTGAGGG - Intergenic
918135928 1:181673916-181673938 TACACTGAGGAGCAGGGTGAAGG - Intronic
921976038 1:221204366-221204388 TACCTTCTGGATCAGGGAAAAGG + Intergenic
922942651 1:229481175-229481197 TACCCTCAGGAACAGTGTCATGG - Intronic
1064714943 10:18167065-18167087 CACCTTGAAGAACAGGGTGCAGG - Intronic
1067659390 10:48223155-48223177 TATCCTCAGGAAGAGTGTGAAGG + Exonic
1068146672 10:53080482-53080504 TACCCTCAGTAACTGGATGATGG - Intergenic
1068494858 10:57774845-57774867 TACCTTAGGGAAATGGGTGATGG - Intergenic
1069527215 10:69183099-69183121 CACCTGCAGGAGCAGGCTGAGGG - Intronic
1069831497 10:71284878-71284900 TTCCTGCAGGGACAGGGTGGGGG - Intronic
1071859471 10:89657253-89657275 TACAATCAGGCAGAGGGTGAAGG - Intergenic
1072717407 10:97760987-97761009 TTCCTGCAGGACCAGGCTGAGGG + Intergenic
1072965087 10:99964945-99964967 TAGCTTCAGGAAAAGGAAGAAGG + Intronic
1073420984 10:103423494-103423516 ATCCTTCTGGAACAGAGTGAAGG - Intronic
1073446349 10:103582729-103582751 TCTCTTCAGGAACTGGGTTAAGG - Intronic
1074267487 10:111918965-111918987 TACCAACAGGAAGAGGGTGTAGG + Intergenic
1074451703 10:113564521-113564543 TGCCTGCAGAAACAGGGTGTGGG + Intronic
1075811693 10:125228814-125228836 TACCTGCAGGCACAGGGTAGTGG + Intergenic
1077252271 11:1565932-1565954 GACCTGCAGGGACAGGGGGATGG + Exonic
1077488399 11:2849569-2849591 AAGCTGCAGGAACAGGGTCAGGG - Intergenic
1078197115 11:9145315-9145337 TACCTAGAAGAACAGGGTCAGGG + Intronic
1080190403 11:29538428-29538450 TACCTTCTAATACAGGGTGATGG - Intergenic
1083940971 11:65895632-65895654 CACCCTCAGGACCAGGCTGAAGG + Intronic
1086449893 11:86905667-86905689 CACCTTCTGGAAAAGTGTGAAGG - Intronic
1087146953 11:94822028-94822050 TACCTTCAGTAAGAGTGTGAAGG + Intronic
1089559760 11:119337950-119337972 TGCCTTCAGGAAGGGGGTGCCGG + Intergenic
1091263936 11:134255601-134255623 TACCCTCAGGAACAGAGTTAGGG - Intronic
1091686795 12:2568070-2568092 TGCCTTCAAGAAGAGGGTCAGGG + Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1091920434 12:4299920-4299942 TACCGTCAGGACCAACGTGACGG + Exonic
1092329235 12:7567329-7567351 TGCCTACAGTAACAAGGTGATGG + Intergenic
1092651927 12:10644167-10644189 TACCAGTAGGAACAGGGAGAAGG + Intronic
1100710986 12:97256849-97256871 TGCCTTGAGGAGCACGGTGAAGG - Intergenic
1100848427 12:98684226-98684248 TAGCTTCCTGAACAGGGGGATGG - Intronic
1102247867 12:111366614-111366636 TACCTTGAGGAACATGGACAGGG - Intronic
1104890942 12:132139864-132139886 CACTTTCAGGAGCAGTGTGAAGG + Exonic
1106388102 13:29307731-29307753 TGGCTACAGCAACAGGGTGATGG + Intronic
1106634657 13:31514851-31514873 AACATTCAGTAACAAGGTGATGG - Intergenic
1106799703 13:33243565-33243587 TACCTCTAGCAACAGTGTGAAGG + Intronic
1107031027 13:35853908-35853930 CACCCTAAGGAAGAGGGTGAGGG - Intronic
1108020947 13:46127155-46127177 GACCTCCAGGAACAGGGTTTAGG + Exonic
1110124292 13:71923071-71923093 TACCTTCATCAACAGAGTGAAGG - Intergenic
1111562326 13:89967463-89967485 TGCCTTCAGGAGCTGGGTGTGGG - Intergenic
1112742761 13:102493924-102493946 GACCTTCATGAACGGGATGAGGG + Intergenic
1115935757 14:38550319-38550341 TAGGTTCAGGAACAGTGTCAGGG - Intergenic
1116032782 14:39592525-39592547 TACCTTCTAGAATAGGGTGTAGG + Intergenic
1118927291 14:70204161-70204183 CACCTTGAGGAACCGGGAGAAGG + Intergenic
1123574328 15:21651748-21651770 TGGCTTCAGGACCAGGGTGTTGG + Intergenic
1123610943 15:22094335-22094357 TGGCTTCAGGACCAGGGTGTTGG + Intergenic
1124068137 15:26365237-26365259 TTTCTCCAGGGACAGGGTGATGG + Intergenic
1127139508 15:55960505-55960527 TACCTTCAGCCACAGACTGAAGG + Intronic
1127536764 15:59897182-59897204 TACCTGGAGGCACAAGGTGAAGG + Intergenic
1128358704 15:66945697-66945719 TGCCCTCAGGATCAGGGAGAGGG - Intergenic
1129023695 15:72548316-72548338 TACTTTCAAGAACTGGGGGATGG + Intronic
1129313015 15:74725522-74725544 CACCTTCAGGGTGAGGGTGAAGG + Exonic
1131171024 15:90178256-90178278 TACTTTCATGAAAAGGGTGGTGG - Intronic
1202983192 15_KI270727v1_random:386091-386113 TGGCTTCAGGACCAGGGTGTTGG + Intergenic
1132938173 16:2492670-2492692 GACCTTCAGGACCAGGGAAAGGG + Intronic
1133850680 16:9500444-9500466 CACCTTCAGAAACAGGGAGTGGG + Intergenic
1137930630 16:52584055-52584077 CACCTGGAGGCACAGGGTGAGGG - Intergenic
1139576919 16:67847493-67847515 TATGGTCGGGAACAGGGTGAGGG - Intronic
1143588681 17:7866484-7866506 TACCTTCTGGACCATGGTAAGGG - Intronic
1145912687 17:28551852-28551874 TTCCTGGAGGATCAGGGTGAGGG + Intronic
1148456930 17:47816200-47816222 GACCTGCAGGGAGAGGGTGAGGG + Exonic
1148738309 17:49877555-49877577 TACCCACAGGAAGAGGGTGAGGG - Intergenic
1148843601 17:50515251-50515273 TAACTACAGGAACATGGTGGGGG - Intronic
1151080580 17:71324514-71324536 TATCTTCAGGAAGATGGTGTTGG - Intergenic
1151152090 17:72097100-72097122 CTCCTGCAGGAACTGGGTGAGGG - Intergenic
1151980848 17:77507539-77507561 TCCCTCCAGGGACACGGTGATGG - Intergenic
1152747912 17:82049674-82049696 TACCTGCTGGAGCAGGGTGTCGG + Exonic
1153967760 18:10197121-10197143 AACCTTCAGGGACAGGGTACAGG - Intergenic
1155280249 18:24231986-24232008 TACCTTCAGTAACAGGAGGAAGG - Intronic
1155297779 18:24401080-24401102 TACCTGCAGGAAAAGAGAGATGG - Intergenic
1157519468 18:48335404-48335426 GACCTTCAGGAACCGCCTGAAGG + Intronic
1157622666 18:49025296-49025318 AACCTTCAGGAACTGGGGGAGGG - Intergenic
1158863626 18:61616883-61616905 TACCTATAGGAAGAGGGTCAAGG - Intergenic
1159522528 18:69544636-69544658 AACCTTCAGGAACTGGGTCTTGG + Intronic
1159877580 18:73829438-73829460 TAATTTGAGGAACAGGGTGAAGG - Intergenic
1160300455 18:77673212-77673234 TATGTTCATGAACAGCGTGATGG - Intergenic
1165771892 19:38385087-38385109 TACCCTCAGGGACAGGGTCAAGG + Intronic
1166914614 19:46186472-46186494 TCCCTGCAGGAACAAGGTCAAGG - Intergenic
1167154616 19:47730375-47730397 AACCTGCAGGAAGAGGGGGAGGG - Intronic
928759930 2:34570314-34570336 CACCTTTAGGAACTGGGAGAAGG - Intergenic
933243845 2:79953191-79953213 TACCTTCCAGAAGAGAGTGAGGG - Intronic
935321601 2:101894916-101894938 TGTCTTCAGGAACCTGGTGATGG - Intergenic
938949161 2:136241391-136241413 GAGCTTCAGGGACAGGGTGTAGG - Intergenic
940797319 2:158094172-158094194 TACCTTCAGGAAGAAAGTGAAGG + Intronic
941594825 2:167463047-167463069 TACCTTCAGGAAAAGGCTTATGG - Intergenic
943801518 2:192064830-192064852 TTCCTTCTGGAACTGGTTGAAGG - Intronic
945856662 2:215077019-215077041 TTCCTTCAGGAACAGAAGGAAGG + Intronic
947127818 2:226890053-226890075 CACCTGCAGGTACAAGGTGAGGG + Intronic
947870837 2:233437057-233437079 AACTTTCAGGACGAGGGTGAGGG - Intronic
947924099 2:233905833-233905855 CTCCTTCAGGAACATGGTGGAGG + Intergenic
948206217 2:236164077-236164099 AAACTTCAGGCGCAGGGTGAAGG - Intergenic
949020411 2:241738156-241738178 TTACTTCGGGAGCAGGGTGAGGG - Intronic
1170513578 20:17104653-17104675 TGCATGGAGGAACAGGGTGAGGG - Intergenic
1171477317 20:25422172-25422194 TTCTTTCTTGAACAGGGTGATGG - Intronic
1172207339 20:33173298-33173320 TAATTTCAGGGTCAGGGTGAAGG + Intronic
1173476455 20:43363338-43363360 TTTCTTCAGGAACTGGGTGCTGG - Intergenic
1174799590 20:53552075-53552097 TAGCATCAGGATCAGAGTGAGGG + Intergenic
1175543400 20:59762314-59762336 TGCCTTAAGGCACAGGGTAAAGG - Intronic
1175605631 20:60310225-60310247 TACCTCAAGGGACATGGTGATGG + Intergenic
1178991343 21:37359082-37359104 AGCCTTGAGGAACCGGGTGAAGG + Intergenic
1180056593 21:45362185-45362207 TCCCCTTAGGAGCAGGGTGAGGG + Intergenic
1180163418 21:46007897-46007919 TCCCTTCAGGAAGAGGGTCTTGG - Intergenic
1180933229 22:19607461-19607483 TGCCTCCAGGAGCAGGGAGAGGG + Intergenic
1181547081 22:23608178-23608200 CAGCTTCAGGAGCAGGCTGATGG - Intergenic
1181934009 22:26427281-26427303 TACATTCTGGAACAGGGTGAAGG + Intergenic
1181934188 22:26427902-26427924 TAGGTTCTGGCACAGGGTGAAGG + Intergenic
1181934206 22:26427971-26427993 TATGTTCTGGAACAGGGTGAAGG + Intergenic
1181934293 22:26428271-26428293 TACGTTCTGGAACAGGGTGAAGG + Intergenic
1182466443 22:30519804-30519826 TAATTTCAGGAGCAGGGTGGGGG + Intergenic
1183726071 22:39590338-39590360 TACCTGCAGGAAGAAGGGGAGGG - Intronic
1184566790 22:45296865-45296887 TTCCTTCAGCAACAGGAAGACGG - Intergenic
950092244 3:10304263-10304285 TCTCTGCAGGAACAGGGTGGGGG + Intronic
950119015 3:10469598-10469620 GACTTCCAGGAAGAGGGTGATGG + Intronic
956273413 3:67471717-67471739 TACCCTCAGGACCTGGCTGAGGG - Intronic
956603338 3:71046939-71046961 TACCTTGAGCAAGAGGTTGAAGG + Exonic
957357858 3:79115128-79115150 AACCATCATGAACTGGGTGATGG + Intronic
959674121 3:109015234-109015256 GACCTCCAGTAACAGGGTGAAGG + Intronic
960234707 3:115268601-115268623 TACTTCCACCAACAGGGTGAAGG - Intergenic
960818836 3:121705151-121705173 TGGCATCAGGAATAGGGTGAGGG + Intronic
960955653 3:123028491-123028513 TAACATCAGGAACAGTGGGAGGG + Intronic
961111075 3:124283408-124283430 TATTTTCAGGAACACAGTGAGGG - Intronic
962324775 3:134423848-134423870 TACCTGCAGGGACATGGGGATGG + Intergenic
964757263 3:160099575-160099597 TACCTCCTGGAACTGGATGAAGG - Intergenic
966780241 3:183578229-183578251 TTCCTTCAGGAACAGGCTCTGGG - Intergenic
973333667 4:48934632-48934654 TACCTTTAGGAGTGGGGTGAGGG - Intergenic
974640393 4:64623342-64623364 TACCCTGAGGCAGAGGGTGAGGG - Intergenic
974753932 4:66179251-66179273 TTCCTCCTTGAACAGGGTGAAGG - Intergenic
975182944 4:71368194-71368216 TATCTTCAGGAAGAAGTTGATGG + Intronic
977351949 4:95899436-95899458 TATTTTTAGGAAGAGGGTGATGG + Intergenic
986223728 5:5793764-5793786 GACCTTCAGGACCTTGGTGAAGG - Intergenic
986319264 5:6614649-6614671 CACGTTCAGGAAATGGGTGAGGG + Intronic
986702566 5:10425302-10425324 TCCCTTCAGGATCAGAGTGCAGG + Intronic
987921162 5:24283538-24283560 TACCTTCTGCTGCAGGGTGAAGG - Intergenic
992112587 5:73510044-73510066 TACCGTAAGGAACAGAATGAGGG + Intergenic
992483209 5:77171629-77171651 TCCCTTCAGGAAACAGGTGAGGG + Intergenic
992949464 5:81843671-81843693 CACCTTGAGGAAAAGTGTGAGGG + Intergenic
993952414 5:94193151-94193173 CACAGTCAGGAACAGGATGAAGG - Intronic
996838868 5:127824126-127824148 TATCTTCAAGGACAGGATGAAGG + Intergenic
997778908 5:136637506-136637528 AACCTTCAGGAACAGTATGTGGG + Intergenic
997892882 5:137690638-137690660 TGCCTTCAGAAACAGGCTGCAGG + Intronic
999477143 5:151910917-151910939 TACATTGAGGAACAGAGTCATGG - Intronic
1000718157 5:164672808-164672830 TAACTTCAGGTTCAGAGTGACGG + Intergenic
1001446709 5:171790839-171790861 GACCATCAGGAACTGGCTGAAGG + Exonic
1005321158 6:24655719-24655741 TACCTTCTGGAAGCAGGTGAGGG - Intronic
1005881593 6:30066706-30066728 CACCTACAGGCACAGGGCGAGGG + Intronic
1006155459 6:32010811-32010833 GACCGTCAGGAACTGGGGGAAGG + Intergenic
1006161765 6:32043545-32043567 GACCGTCAGGAACTGGGGGAAGG + Exonic
1010036264 6:71329068-71329090 AACATTAAGGAATAGGGTGATGG + Intergenic
1010090457 6:71974114-71974136 CACCTTAAGGAACAGGGAGGAGG + Intronic
1012319899 6:97830123-97830145 CACCTTCAGGCAAAGTGTGATGG - Intergenic
1015703360 6:136060236-136060258 TAAGGTCAGGAACAGGGTGAAGG - Intronic
1016713257 6:147197095-147197117 TAGAATCAGGAACAGTGTGATGG + Intergenic
1016740510 6:147523718-147523740 TTCCTTCAGGATCAGGTTAAGGG + Intronic
1018385641 6:163300480-163300502 TCCCTGCAGGAAGAGAGTGAGGG - Intronic
1019922956 7:4174477-4174499 TGCCCTCAGGAACAGGGAGCAGG + Intronic
1020630511 7:10633960-10633982 TACCTTCAGGAACTGGGGTGTGG - Intergenic
1028939199 7:96501814-96501836 TACATTCAGTACCTGGGTGATGG - Intronic
1034434010 7:151054509-151054531 CATCTTCAGGGGCAGGGTGAGGG + Intronic
1034953578 7:155317671-155317693 TACCTTCAGGCAGAGGGAGCAGG - Intergenic
1039775872 8:40736177-40736199 TAGCCTCAGGAACATGGAGAAGG + Intronic
1041632521 8:60104017-60104039 TAGATTCAGGCACAGGATGATGG - Intergenic
1043473533 8:80584135-80584157 TACCTGCAGTATCAGGATGAAGG + Intergenic
1044604600 8:94037641-94037663 AACTTTCTGGAACAGGTTGAAGG - Intergenic
1047662272 8:127050280-127050302 TTCCTTCAACAACTGGGTGAAGG + Intergenic
1047734099 8:127750681-127750703 GACCCCCAGGCACAGGGTGATGG - Intergenic
1048535454 8:135290321-135290343 TACCTTCATGTTTAGGGTGAAGG - Intergenic
1048735470 8:137495188-137495210 TACATTAAGGAATAGAGTGAGGG + Intergenic
1053183910 9:35998213-35998235 TACCTCTAGGACCGGGGTGAAGG - Intergenic
1056265620 9:84893925-84893947 TACATTCAGGAACAAAGAGAGGG + Intronic
1057472052 9:95366885-95366907 TGTCTTCAAGCACAGGGTGAAGG + Intergenic
1059534766 9:115070385-115070407 AAGCTTAAGGAACAGTGTGAAGG + Intronic
1059798787 9:117728731-117728753 TCCCTGCTGGAACAGGGTCATGG - Intergenic
1060045099 9:120333581-120333603 CACCTTCAGTAACAGAGAGAAGG + Intergenic
1062118411 9:134821363-134821385 TTCCTGCAGGGACAAGGTGAAGG + Intronic
1186666805 X:11725177-11725199 TTCCTTCAGGAATATTGTGAAGG + Intergenic
1186736197 X:12466960-12466982 TAAATTCAGGAACAGAGAGAAGG - Intronic
1197896212 X:131318245-131318267 TAGGATCAGGAACAGGGGGAAGG - Intronic
1198435065 X:136609213-136609235 AACCTTGAGGAAATGGGTGAGGG - Intergenic
1200214182 X:154360151-154360173 TACATCCAGGACCACGGTGATGG - Exonic