ID: 915569626

View in Genome Browser
Species Human (GRCh38)
Location 1:156737460-156737482
Sequence CTGTCTAAAGACACTGCAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915569626_915569632 24 Left 915569626 1:156737460-156737482 CCTCCTGCAGTGTCTTTAGACAG 0: 1
1: 0
2: 2
3: 9
4: 143
Right 915569632 1:156737507-156737529 TCTTCCACTGATGTGTCTTTGGG 0: 1
1: 0
2: 4
3: 68
4: 761
915569626_915569631 23 Left 915569626 1:156737460-156737482 CCTCCTGCAGTGTCTTTAGACAG 0: 1
1: 0
2: 2
3: 9
4: 143
Right 915569631 1:156737506-156737528 ATCTTCCACTGATGTGTCTTTGG 0: 1
1: 0
2: 1
3: 42
4: 1231
915569626_915569633 25 Left 915569626 1:156737460-156737482 CCTCCTGCAGTGTCTTTAGACAG 0: 1
1: 0
2: 2
3: 9
4: 143
Right 915569633 1:156737508-156737530 CTTCCACTGATGTGTCTTTGGGG 0: 1
1: 0
2: 4
3: 21
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915569626 Original CRISPR CTGTCTAAAGACACTGCAGG AGG (reversed) Exonic
901049461 1:6419141-6419163 CTGTCGCAAGGCACTGCGGGCGG + Exonic
903493475 1:23747191-23747213 CTGTCTAATGACATCACAGGAGG + Intronic
904040201 1:27579921-27579943 CTGTCTAGAACCACAGCAGGAGG - Intronic
904443078 1:30544712-30544734 CTCTGGAAAGACACTGCAGGAGG + Intergenic
909048328 1:70737359-70737381 GTTCCTAATGACACTGCAGGAGG + Intergenic
909518792 1:76543216-76543238 CTGTCTAAAAACAAGGCAGTCGG - Intronic
910026688 1:82663208-82663230 CAGGCTAAATACAGTGCAGGTGG - Intergenic
910547402 1:88433423-88433445 CTTTCCAAAGACACTGCCTGTGG - Intergenic
911634706 1:100221438-100221460 ATGTGTAAAAACACTGAAGGAGG - Intronic
913079942 1:115374317-115374339 AGGTCAAAAGACACTGCAGCAGG - Intergenic
913125964 1:115790553-115790575 CTGACTCAAGACACATCAGGAGG + Intergenic
913601958 1:120429525-120429547 CTGTCTAGAGACATGGCGGGAGG + Intergenic
913739193 1:121821459-121821481 CTGTTTGTAGACTCTGCAGGTGG + Intergenic
913744962 1:121892537-121892559 CTGTTTGTAGACTCTGCAGGTGG - Intergenic
913760684 1:122129566-122129588 CTGTTTGTAGACTCTGCAGGTGG + Intergenic
913767103 1:122204078-122204100 CTGTTTGTAGACTCTGCAGGTGG + Intergenic
913768714 1:122222753-122222775 CTGTTTGTAGACTCTGCAGGTGG + Intergenic
913930275 1:124951820-124951842 CTTTCTGAAGAAACTGCAAGTGG - Intergenic
914085086 1:144447078-144447100 CTGTCTAGAGACAAGGCGGGAGG - Intronic
914363140 1:146953167-146953189 CTGTCTAGAGACAAGGCGGGAGG + Intronic
914488539 1:148133975-148133997 CTGTCTAGAGACAAGGCGGGAGG - Intronic
914588902 1:149089056-149089078 CTGTCTAGAGACAAGGCGGGAGG - Intronic
915569626 1:156737460-156737482 CTGTCTAAAGACACTGCAGGAGG - Exonic
915644953 1:157263793-157263815 CTTACTAAAGGCTCTGCAGGTGG + Intergenic
916036945 1:160930772-160930794 CTGTCCAAAGACTCTGCAGGAGG + Intergenic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
924447886 1:244150637-244150659 CTCTTTAAAAACACGGCAGGCGG + Intergenic
1064126630 10:12667117-12667139 CTGCCTGAAGACACTTCAGTGGG + Intronic
1064645615 10:17455719-17455741 CAGTGTAAAGACACAGCACGAGG + Intergenic
1066817505 10:39438501-39438523 CTTTTTGAAGAAACTGCAGGTGG - Intergenic
1067842490 10:49691991-49692013 TTGTCTGAAGACACTCCTGGAGG - Intronic
1068118799 10:52763256-52763278 CTGACCAAGGACACTGAAGGTGG + Intergenic
1068754031 10:60630689-60630711 CTGTTATAAGACACTGCAGTAGG + Intronic
1076199966 10:128550428-128550450 CTGTGTAAAGACGCTGAAAGGGG - Intergenic
1076476583 10:130757927-130757949 CTGTCAAGAAACACTGCTGGAGG + Intergenic
1077445453 11:2588553-2588575 CTGTGTGAAGACACTGGAGCTGG + Intronic
1079806713 11:24940046-24940068 CAGTCAAAAGACACTTAAGGTGG - Intronic
1079846810 11:25482480-25482502 CTGTGTGACGACACTGAAGGAGG + Intergenic
1080264781 11:30389215-30389237 CTGTCAAAAGGCTCTGCTGGAGG - Intronic
1080718146 11:34823937-34823959 CTGCCTATAAACACTGCAGAAGG + Intergenic
1082179182 11:49098195-49098217 CTGTCTAAAGGAACACCAGGCGG + Intergenic
1082321042 11:50812560-50812582 CTGTCTGAAGAAACTGCAAGTGG + Intergenic
1082426124 11:52596686-52596708 CTTTCTGAAGAAACTGCAAGTGG + Intergenic
1082524972 11:54025526-54025548 CTTTCTGAAGAAACTGCAAGTGG + Intergenic
1083126212 11:60568597-60568619 CTGATAAAAGCCACTGCAGGTGG - Intergenic
1084044558 11:66561247-66561269 CTGTGACCAGACACTGCAGGAGG + Exonic
1088053828 11:105551843-105551865 GATTCTAAAAACACTGCAGGTGG + Intergenic
1088902713 11:114130273-114130295 CTCTCCAAAGACAATGCAGCTGG - Intronic
1090490889 11:127159685-127159707 CTGTTTTAAGCCACTGCTGGAGG + Intergenic
1100772905 12:97943005-97943027 CTGGCTAAAGATGCTGCATGGGG - Intergenic
1101673863 12:106900041-106900063 CTGTCCAAAGAGTCTTCAGGAGG - Intergenic
1102441443 12:112966885-112966907 CTCTCGAAGGCCACTGCAGGAGG - Intronic
1103748569 12:123143156-123143178 CTGTCTAGAGAGACAGCAGAGGG + Intronic
1103945207 12:124522404-124522426 CCCTCCAAAGACTCTGCAGGGGG + Intronic
1107106231 13:36645690-36645712 GTGTCTAATGACACTGAAGGGGG - Intergenic
1107907119 13:45071535-45071557 CTGTGTAAGGACACAGCAAGAGG - Intergenic
1108413734 13:50176564-50176586 CTGTCTAAAGAAACTGAAACTGG - Intronic
1109331953 13:60941543-60941565 CTTCCTAAACACACTGCATGTGG + Intergenic
1111039341 13:82724719-82724741 CAGTCTGAAAACACTGCATGTGG - Intergenic
1115595377 14:34904031-34904053 ATTTCTAAAGAATCTGCAGGTGG - Intergenic
1118311792 14:64699178-64699200 CTGTTTACAGCCACTGCAGTGGG - Intergenic
1118812883 14:69288299-69288321 CTTTCTAAAGACGCAGCAGGGGG - Intronic
1119381292 14:74230504-74230526 ATGACTCAAGACACTGGAGGAGG + Intergenic
1120690228 14:87584642-87584664 GTCTCCAAAGACAATGCAGGTGG + Intergenic
1120724906 14:87927580-87927602 GGTTATAAAGACACTGCAGGAGG + Intronic
1120750057 14:88188887-88188909 CTTCCTACAGACACTGCTGGAGG + Intronic
1124828816 15:33127763-33127785 TTCTCTACAGACACTGCAAGTGG - Intronic
1133594505 16:7278318-7278340 CCATCTAGAGACACTGAAGGAGG - Intronic
1137785148 16:51132292-51132314 CAGTCTGAGGACATTGCAGGGGG - Intergenic
1139306212 16:65988386-65988408 TTATCTAAAGTCACTGGAGGAGG - Intergenic
1139472853 16:67187502-67187524 CTGTCTGAGGGCACTACAGGAGG - Exonic
1140191696 16:72823036-72823058 CTGCTTAAAGTCACTGCAGGCGG - Intronic
1142977977 17:3656477-3656499 CAGACCAATGACACTGCAGGGGG - Exonic
1143033952 17:3983818-3983840 TGGTCTGAAGTCACTGCAGGAGG + Intergenic
1144626018 17:16844843-16844865 CTGTCTTAAGGGACAGCAGGAGG + Intergenic
1144880416 17:18427877-18427899 CTGTCTTAAGGGACAGCAGGAGG - Intergenic
1145151819 17:20516510-20516532 CTGTCTTAAGGGACAGCAGGAGG + Intergenic
1152479783 17:80542987-80543009 CTGTCTACAGCCACCGGAGGTGG + Intergenic
1156413241 18:36857300-36857322 CTGGCAAAAGAGACAGCAGGTGG - Intronic
1156652375 18:39239446-39239468 CCTTCAATAGACACTGCAGGGGG + Intergenic
1157647869 18:49295528-49295550 ATGTATGAGGACACTGCAGGAGG + Intronic
925727785 2:6890505-6890527 CTCTCTAAAGACCCTGCAGCTGG - Intronic
932169897 2:69544853-69544875 CTCTCCAGAAACACTGCAGGGGG + Intronic
933253084 2:80050431-80050453 CTTTGTAAATACACTGCAAGGGG - Intronic
937316172 2:120933352-120933374 CAGCCCAAAGACACTGCAGCAGG - Intronic
938840046 2:135151834-135151856 CTCTGCAAAGACACTGCAGCAGG - Intronic
943251491 2:185526116-185526138 CTGTCGAAAGACACCTCAGGTGG - Intergenic
944433793 2:199665250-199665272 GTGTCTAAAGACACTGGTGACGG - Intergenic
948830148 2:240594687-240594709 CTGTGTAGAGGCTCTGCAGGTGG - Exonic
1169517716 20:6335698-6335720 CTGTCTTCAGAAATTGCAGGAGG + Intergenic
1169960983 20:11159806-11159828 CTGTCTACAGAAACTGCTGTGGG + Intergenic
1172813589 20:37669234-37669256 CTTTCTAGGGACAGTGCAGGAGG + Intergenic
1173246290 20:41340107-41340129 CTGTCTGCAGGCACTGCGGGAGG - Intergenic
1173349087 20:42227967-42227989 CTTTCTAACCACACTGCAGTAGG + Intronic
1176963769 21:15189061-15189083 CTCACTAAAGACATTGAAGGTGG - Intergenic
1179552637 21:42153302-42153324 GTGTCCAAAGTCACTGCAGGCGG - Intergenic
1180526936 22:16276003-16276025 CTTTCTGAAGAAACTGCAAGTGG + Intergenic
949366569 3:3288055-3288077 CTGTGAAAGGGCACTGCAGGTGG - Intergenic
950163897 3:10779481-10779503 CTTTCTAAAGACAAAGTAGGTGG + Intergenic
951106135 3:18745428-18745450 ATGTCTAGAGAAACTGCAAGAGG - Intergenic
953634497 3:44651208-44651230 CTGTCTGAAGACCCTGCACTGGG - Exonic
954317673 3:49810133-49810155 CTATCTGAAGCCACTGCTGGAGG - Exonic
957177095 3:76825215-76825237 CTGTTTAATGACACTGAAGCTGG - Intronic
958266271 3:91441158-91441180 ATGTCTAAAGATACTACAGATGG + Intergenic
960869066 3:122231065-122231087 GTCTCTAAAGTGACTGCAGGTGG - Intronic
966223086 3:177569871-177569893 CTCTCTGAAGACTCTGGAGGAGG + Intergenic
966457695 3:180136275-180136297 CTGTCTACAGAGACTGGAGGTGG + Intergenic
967894738 3:194386643-194386665 CCCTCTAAAGGCTCTGCAGGAGG + Intergenic
972915829 4:43878474-43878496 CTTTGTAATGACAATGCAGGCGG + Intergenic
975578810 4:75888874-75888896 CTGTGTTAAGACAGTGTAGGCGG - Intronic
977547640 4:98403088-98403110 CTTTCTCACGACACTGCTGGAGG + Intronic
986632335 5:9785730-9785752 CCATCTAAAGACAGGGCAGGAGG + Intergenic
990260786 5:54020315-54020337 GTCTCTACTGACACTGCAGGGGG - Intronic
991263350 5:64690192-64690214 CTGTCTAGGGACAGGGCAGGTGG - Intergenic
993436496 5:87901959-87901981 CTGCCTGTAGACTCTGCAGGAGG + Intergenic
994881464 5:105502854-105502876 ATGTCTAAAGATCCTACAGGAGG - Intergenic
1003114007 6:3271365-3271387 ATGTGTAAAGACACAGCAAGGGG - Exonic
1007468851 6:42075000-42075022 CAGCCTCAAGACACTGCTGGAGG - Intronic
1008989005 6:57580818-57580840 ATGTCTAAAGATACTACAGATGG - Intronic
1009177548 6:60479056-60479078 ATGTCTAAAGATACTACAGATGG - Intergenic
1010001365 6:70953505-70953527 CTGTCCAAAAACAATGCTGGTGG + Intronic
1012548937 6:100450222-100450244 CTGGCTGTAAACACTGCAGGTGG + Intronic
1013585199 6:111572224-111572246 CTGTGTCAAGGGACTGCAGGGGG + Intronic
1018673826 6:166201973-166201995 GTGTCTAAAGACCCTGTGGGTGG + Intergenic
1022677380 7:32512538-32512560 CTGTCCAGAGACACAGGAGGAGG - Intronic
1023293105 7:38687650-38687672 CTGTCCAGAGACACAGGAGGAGG - Intergenic
1024039114 7:45535879-45535901 GTGTCTAAAGACACTTCATCTGG - Intergenic
1027779121 7:82501009-82501031 GTGTCAAGAGCCACTGCAGGTGG - Intergenic
1028944363 7:96559885-96559907 CTGTATAATGCCACTGCAGCAGG - Intronic
1034610533 7:152363940-152363962 CTGGCTAAAGACAATACAGTTGG - Intronic
1034878124 7:154743198-154743220 CTATCTAAAGGCCCAGCAGGTGG - Intronic
1035985985 8:4432635-4432657 CTGACTTAAGACCATGCAGGTGG + Intronic
1037520866 8:19679662-19679684 CTGTCTTGAGTCACAGCAGGTGG - Intronic
1042436955 8:68777093-68777115 CTGTCTAAATCCACTGCAGGTGG + Intronic
1045079772 8:98612914-98612936 CTGTCTACTGACACTGCTAGGGG - Intronic
1046760582 8:118016092-118016114 TTGTTTAAAGCCACTCCAGGCGG + Intronic
1049022815 8:139969439-139969461 CTGACAGAAGTCACTGCAGGAGG + Intronic
1049184615 8:141243192-141243214 GTGTCCCAAGACACTGCATGTGG + Intronic
1049476460 8:142799267-142799289 CTGGCTGAAGTCACTGCCGGTGG + Intergenic
1050179862 9:2909857-2909879 CTGTATAGAGACAGAGCAGGTGG + Intergenic
1052244207 9:26314012-26314034 TTGTCACAAGACACTGCGGGAGG + Intergenic
1056767313 9:89452812-89452834 CAGTCTAGAGACAGTGCAGCAGG - Intronic
1056817956 9:89815382-89815404 CTATGTAAAGCCACTGCAGCAGG + Intergenic
1056998282 9:91484123-91484145 CTCTGGAAACACACTGCAGGAGG + Intergenic
1057989790 9:99756696-99756718 TGGTCTAGATACACTGCAGGAGG + Intergenic
1060258334 9:122052364-122052386 CCATCCAAAGACACTGCAGTCGG - Intronic
1061265732 9:129503904-129503926 CGGTCTAAAGACACTACATTAGG - Intergenic
1061716622 9:132522290-132522312 TTGGCTGAAGACACTGCAGCCGG + Intronic
1186506813 X:10100359-10100381 ATGTCTGCAGACACTGCTGGAGG - Intronic
1187987022 X:24825071-24825093 GTGTGAAAAGACACTGCCGGAGG + Intronic
1196517595 X:116631391-116631413 CTTTCTAAATCCACTGCAGTTGG - Intergenic
1197281886 X:124546877-124546899 CTGTCAAATGACACCTCAGGAGG + Exonic
1198812628 X:140551045-140551067 CTCTCTAAAGCCTCTTCAGGTGG - Intergenic
1199587701 X:149433653-149433675 CTGTCACAGGAAACTGCAGGAGG - Intergenic
1201427666 Y:13871864-13871886 CTGTCTTAAGACTCAACAGGTGG + Intergenic