ID: 915577183

View in Genome Browser
Species Human (GRCh38)
Location 1:156787087-156787109
Sequence CCCTTGGATGCCTAAGCCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915577173_915577183 13 Left 915577173 1:156787051-156787073 CCTTGAATTCAAGATGGCAGCAG 0: 1
1: 0
2: 0
3: 14
4: 235
Right 915577183 1:156787087-156787109 CCCTTGGATGCCTAAGCCTGGGG 0: 1
1: 0
2: 0
3: 16
4: 170
915577167_915577183 23 Left 915577167 1:156787041-156787063 CCAATGCCCCCCTTGAATTCAAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 915577183 1:156787087-156787109 CCCTTGGATGCCTAAGCCTGGGG 0: 1
1: 0
2: 0
3: 16
4: 170
915577172_915577183 14 Left 915577172 1:156787050-156787072 CCCTTGAATTCAAGATGGCAGCA 0: 1
1: 1
2: 0
3: 25
4: 210
Right 915577183 1:156787087-156787109 CCCTTGGATGCCTAAGCCTGGGG 0: 1
1: 0
2: 0
3: 16
4: 170
915577170_915577183 16 Left 915577170 1:156787048-156787070 CCCCCTTGAATTCAAGATGGCAG 0: 1
1: 0
2: 1
3: 11
4: 112
Right 915577183 1:156787087-156787109 CCCTTGGATGCCTAAGCCTGGGG 0: 1
1: 0
2: 0
3: 16
4: 170
915577169_915577183 17 Left 915577169 1:156787047-156787069 CCCCCCTTGAATTCAAGATGGCA 0: 1
1: 0
2: 0
3: 15
4: 116
Right 915577183 1:156787087-156787109 CCCTTGGATGCCTAAGCCTGGGG 0: 1
1: 0
2: 0
3: 16
4: 170
915577171_915577183 15 Left 915577171 1:156787049-156787071 CCCCTTGAATTCAAGATGGCAGC 0: 1
1: 1
2: 1
3: 22
4: 153
Right 915577183 1:156787087-156787109 CCCTTGGATGCCTAAGCCTGGGG 0: 1
1: 0
2: 0
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915577183 Original CRISPR CCCTTGGATGCCTAAGCCTG GGG Exonic
900733339 1:4277778-4277800 CCCCAGGATGGCAAAGCCTGTGG - Intergenic
900755721 1:4433270-4433292 CCCATGGATGCCTCACCCTCAGG - Intergenic
902581695 1:17411785-17411807 CCCCTGGAGGCCTAAGTCAGTGG - Intronic
906347066 1:45022774-45022796 CCCTTGGATACCAAAATCTGAGG + Intronic
907066108 1:51484692-51484714 CCCATGGTTGCTTAAGTCTGAGG - Intronic
908755889 1:67468434-67468456 GCCCTGGCTTCCTAAGCCTGGGG + Intergenic
910308447 1:85794968-85794990 CCCATGGCTTCCTAAGCCTTTGG + Intronic
912258446 1:108085015-108085037 CCCTTTGATCCTTAACCCTGAGG - Intergenic
913215912 1:116620290-116620312 TCCTTGGAGGTCTAAGGCTGGGG - Intronic
915510277 1:156383158-156383180 CCCTTCTAGGCCTCAGCCTGAGG - Intronic
915577183 1:156787087-156787109 CCCTTGGATGCCTAAGCCTGGGG + Exonic
917464693 1:175265651-175265673 CCAATGGATGCCTAAAACTGTGG + Intergenic
917741243 1:177963971-177963993 GCCTCGGATGCCTAAGACTGAGG + Intronic
918022928 1:180712032-180712054 CCAGTGGATGCCTAAAACTGTGG + Intronic
918986394 1:191633378-191633400 CCTTTGGTTGCCTGAGCTTGTGG - Intergenic
919751310 1:201039897-201039919 CCCTGGGATGCCTGAACCTCGGG - Exonic
920086967 1:203424487-203424509 CCCTGGAAAGTCTAAGCCTGGGG - Intergenic
921102211 1:211938662-211938684 CCAGTGGATGCCTATGACTGAGG + Intergenic
922573569 1:226647465-226647487 CCTGGGGATGGCTAAGCCTGGGG + Intronic
924478785 1:244407433-244407455 CCAGTGGATGCCTAAAACTGTGG - Intergenic
1062909737 10:1204995-1205017 GCTTGGGATGCCTCAGCCTGAGG + Intronic
1064053072 10:12074880-12074902 CCCTTAGAGGCCGAAGCCAGTGG + Intronic
1064262855 10:13799779-13799801 TCCTTGATTGCCTAAGTCTGGGG + Intronic
1066281870 10:33925476-33925498 CCCTGGGATGCCAAGGCCGGCGG - Intergenic
1067508208 10:46874236-46874258 CCCTGGGATGTCTGAGCCAGAGG - Intergenic
1069590080 10:69636018-69636040 CACTTGGATGCCTGAACCTGAGG + Intergenic
1069773041 10:70911431-70911453 CCCCCAGATGACTAAGCCTGAGG + Intergenic
1070678645 10:78433444-78433466 CCCTTGTATGGATAGGCCTGGGG - Intergenic
1070780642 10:79135701-79135723 CCCTTGGACCCCAAAGCCTTGGG - Intronic
1073607856 10:104914326-104914348 GCCTTGGGTGCCTAAGGATGGGG + Intronic
1073766088 10:106684465-106684487 CCCTTGGGAGCCCAATCCTGAGG + Intronic
1074958326 10:118414700-118414722 TGCCTGGATGCTTAAGCCTGTGG + Intergenic
1074973300 10:118560800-118560822 CCCTGGGATGACTAAGGCAGAGG - Intergenic
1076410260 10:130244304-130244326 GCCTTGGATCCCCAGGCCTGGGG + Intergenic
1077608351 11:3627336-3627358 CCCTGGGAATCCTCAGCCTGAGG + Intergenic
1078519027 11:12048697-12048719 CCCTTGAATACCAAAGTCTGCGG - Intergenic
1080137741 11:28876641-28876663 CCCTTGGATACCAAAATCTGGGG - Intergenic
1081757053 11:45552253-45552275 CCCTGGGATGCCTCAGGCGGAGG - Intergenic
1083959491 11:66006719-66006741 CCCTTCTATGGCAAAGCCTGTGG - Intergenic
1085219007 11:74857012-74857034 CCCAGGGCTGCCTAAGACTGGGG + Intronic
1087104040 11:94393092-94393114 CGCATGCATGCCTGAGCCTGAGG - Intronic
1087885350 11:103474809-103474831 CCAATGGATGCCTGAGACTGCGG - Intronic
1088477729 11:110260697-110260719 CCCTTGGATACCAAAAACTGTGG + Intronic
1089966220 11:122656430-122656452 CCGTGGGATGCCTAAAGCTGGGG + Intronic
1093999304 12:25677272-25677294 CCCTAGGAGGCCTTTGCCTGTGG - Intergenic
1096464836 12:51842550-51842572 CCCTTGGATGCTTAAGAATCTGG - Intergenic
1097553390 12:61104679-61104701 CCCTTTGCTGCCTAAGGCTGGGG + Intergenic
1102396682 12:112591928-112591950 CCCTTGGATACCAAAACCTGTGG + Intronic
1102629158 12:114261834-114261856 CCATTGGATGCCTGAAACTGTGG + Intergenic
1107232113 13:38122316-38122338 CCAATGGATACCTAAGTCTGTGG + Intergenic
1108112459 13:47090322-47090344 CCAGTGGATGCCTAAAACTGAGG + Intergenic
1109457496 13:62611571-62611593 ACCTGGGATGCTTGAGCCTGAGG - Intergenic
1111219512 13:85185515-85185537 ACCTTGGAGGCCTAAGCAGGAGG + Intergenic
1112557363 13:100480930-100480952 CCAGGGGATGCCTAAGACTGCGG + Intronic
1113352549 13:109543463-109543485 CCCTTGGATACCAAAATCTGAGG + Intergenic
1114582244 14:23772724-23772746 TCCTTGGATGCTGCAGCCTGAGG - Intergenic
1120097503 14:80404732-80404754 CCCCTGGAAACCTAAGACTGTGG + Intergenic
1121373659 14:93384729-93384751 GCCTTGGTTGCCTGTGCCTGTGG + Intronic
1122699623 14:103579190-103579212 CCAGTGAATGCCTAAGACTGAGG + Intronic
1125910775 15:43436724-43436746 CACTTGGAGGCCAAAGCATGAGG - Intronic
1126626843 15:50693515-50693537 CCCTTGAATCCCAGAGCCTGAGG + Intergenic
1127295963 15:57608721-57608743 CCTTTGAATGCCAAAGCCAGTGG + Intronic
1129269191 15:74410580-74410602 CCCTGGGCTGCAGAAGCCTGAGG + Exonic
1137444632 16:48524135-48524157 CCCTTGCAAGCCTTAGCATGGGG + Intergenic
1137946588 16:52738595-52738617 GCTTTGGTTGCCTGAGCCTGTGG - Intergenic
1141344852 16:83234951-83234973 CCTTGGGAGGCCTAAGCCAGAGG + Intronic
1142483132 17:230598-230620 CCCCTGTATGCCTGAGCCTGGGG - Intronic
1143171316 17:4932267-4932289 CCCATGGAGGACTAAGCCAGTGG - Intergenic
1143611972 17:8023404-8023426 CCCTTGGATACCAAAATCTGAGG - Intergenic
1143662130 17:8331844-8331866 CCCTTGATTGCCTAGTCCTGGGG + Intergenic
1144762925 17:17717515-17717537 CCCTCTGGTGCCTAACCCTGTGG + Intronic
1145905577 17:28514505-28514527 TCCTTGGGTGCCCAAGCCTCAGG + Intronic
1145956008 17:28855135-28855157 CCGTTGGAAGCCTAAGAGTGAGG - Exonic
1146936830 17:36817312-36817334 TCCTTGGAAGCCTGAACCTGGGG + Intergenic
1147158500 17:38557645-38557667 CCCCTCCATGCCTAAGCATGCGG + Intronic
1149426625 17:56560930-56560952 CCCTTGCATTCCTAATCTTGAGG - Intergenic
1149658189 17:58321065-58321087 CACTTGGATACATGAGCCTGGGG - Intronic
1149995050 17:61401879-61401901 GCAGTGGATGGCTAAGCCTGTGG + Exonic
1150232886 17:63567906-63567928 CCCTGGGATGCCAAGGCCAGAGG - Intronic
1157718397 18:49905208-49905230 CCCTGGGATCTCCAAGCCTGGGG - Intronic
1160846738 19:1169337-1169359 CCCACGGAGGCCTCAGCCTGGGG - Intronic
1163269195 19:16240178-16240200 CCCTTGGATACCAAAATCTGAGG - Intronic
1163778581 19:19233014-19233036 CCCTTGAATGCCGAAGGCGGAGG - Intronic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1165345158 19:35241998-35242020 ACCTTGGATGCCAAAGGCAGTGG + Intergenic
1166765509 19:45250673-45250695 CCCTCGGAGGCCTAAGGGTGGGG - Intronic
925399873 2:3564708-3564730 GCCATGGATGCCTGAGGCTGGGG + Intergenic
929040384 2:37738738-37738760 CCCTGGGATGCTTAAGGCGGAGG + Intergenic
929250246 2:39746224-39746246 ACCTTGGATGCCCAAGAATGAGG - Intronic
932385457 2:71328214-71328236 CCCTGGGATGACTAAGGCAGAGG + Intronic
933660722 2:84925423-84925445 CCCTCGGCTCCCTAAACCTGTGG - Intergenic
933670607 2:85003950-85003972 CCAGTGGATGCCTGAACCTGTGG + Intronic
935221697 2:101020931-101020953 CCCGTGGATGCCTGAAACTGTGG - Intronic
936510874 2:113145127-113145149 CCTTTGGTTGCCTATGCTTGTGG + Intergenic
938831819 2:135057602-135057624 CCTTTGAATTCCTAACCCTGAGG - Intronic
939710242 2:145508552-145508574 ACTTTGGTTGCCTAAGCTTGTGG + Intergenic
940916429 2:159261321-159261343 ACCTTGGATACCAAAACCTGTGG - Intronic
942351429 2:175057313-175057335 CCCTGGGATGACTAAGGCAGAGG - Intergenic
943358767 2:186893328-186893350 TCCTTGCATGCCTCAGCATGTGG + Intergenic
943596650 2:189865664-189865686 ACCTTGGATGACAAAGCCTGGGG + Intronic
946193039 2:218017408-218017430 CCTGTGGATGGATAAGCCTGGGG + Intergenic
1169501455 20:6164623-6164645 CCCTTGGCTGCCTGAGTCTCCGG + Intergenic
1170177580 20:13489427-13489449 CACTTGCATAGCTAAGCCTGAGG + Intronic
1174806962 20:53612644-53612666 CCACAGGATGCCAAAGCCTGAGG + Intergenic
1175253180 20:57622052-57622074 CCCTTGGCTGCCAAAAGCTGGGG - Intergenic
1175876854 20:62234345-62234367 CTCTGGGAAGCCTAAGGCTGGGG + Intronic
1175941328 20:62538825-62538847 CCTTTGGAAGCCAAAGCCTGCGG - Intergenic
1176119725 20:63448816-63448838 CCCCAGGATGCCCATGCCTGTGG - Intronic
1177890685 21:26800408-26800430 CCCTTGGATAGCTCACCCTGCGG + Intergenic
1179282076 21:39942314-39942336 CCCTTGGATGACTATGTCTTTGG + Intergenic
1181019605 22:20092410-20092432 CCCTTGGAAGCTGGAGCCTGGGG + Intronic
1182254527 22:29028884-29028906 CCCTTGGACTCCTCACCCTGTGG - Intronic
1182582656 22:31324154-31324176 CCCTTGGCAGCCTAAGCTTTGGG - Intergenic
1183282378 22:36938506-36938528 CCCTTGCCTGTCTAGGCCTGGGG - Exonic
1184863497 22:47190239-47190261 CCCTTGGGAGCCGGAGCCTGTGG + Intergenic
1203292653 22_KI270736v1_random:10280-10302 CCCTGGGATGCTTAAGGCAGAGG + Intergenic
950668502 3:14511506-14511528 ACCTTGGTGGCCTCAGCCTGGGG + Intronic
952218816 3:31304033-31304055 CCCTGGGATGGTCAAGCCTGTGG + Intergenic
954979810 3:54734955-54734977 ACCTTGCATCCCTAGGCCTGAGG - Intronic
955146611 3:56326207-56326229 GCCTTGCAAGCCAAAGCCTGAGG + Intronic
959804597 3:110535843-110535865 CCTTTGGTTGCCTACGCTTGTGG - Intergenic
959831454 3:110868003-110868025 TCCATTGATGCCTATGCCTGTGG + Intergenic
961660587 3:128466808-128466830 CCCATCCATGCCTCAGCCTGTGG - Exonic
961786411 3:129349775-129349797 CACGTGGATGCCGAGGCCTGAGG - Intergenic
962468526 3:135684002-135684024 GCTTTGGTTGCCTAAGCTTGTGG - Intergenic
963432882 3:145231921-145231943 CCAGTGGATGCCTAAAACTGTGG + Intergenic
964181602 3:153894233-153894255 GCCTGGGATGTCTAAGACTGAGG - Intergenic
964872751 3:161331144-161331166 CCCTATGGTGCCTAAGCATGAGG + Intergenic
965700525 3:171456169-171456191 GCCTTGAATGCCTTACCCTGTGG + Intronic
967204684 3:187108699-187108721 CCCTTGGATACCAAAATCTGTGG + Intergenic
968115901 3:196089451-196089473 TCCTTGGAATCCTAAGCCTCGGG + Intergenic
969140878 4:5070484-5070506 TCCTTGGATGCCTAATGCTTAGG + Intronic
974304154 4:60109948-60109970 CCCTTGGATACCAAAACCTGTGG - Intergenic
978698740 4:111616600-111616622 CCCTTCCATGACTCAGCCTGTGG - Intergenic
984453554 4:179935932-179935954 CCCGTGGATGCCAAAATCTGTGG + Intergenic
985646763 5:1088643-1088665 CCCTTGGAAGCCTCAGCCCCCGG + Intronic
991193693 5:63906381-63906403 CCCTTAGGTGCCAAAGCCTATGG + Intergenic
993571523 5:89545751-89545773 TTCATGGATGCCTTAGCCTGCGG + Intergenic
994119772 5:96100740-96100762 CCCTTAGATACCAAAGTCTGAGG + Intergenic
994578569 5:101611189-101611211 CCCTTGTTTGCCAAAGCATGTGG - Intergenic
995374089 5:111453888-111453910 CCCTGGGATGACTAAGGCAGAGG + Intronic
995573488 5:113505815-113505837 CCAGTGGATGCCTAAGACTGAGG - Intergenic
997189942 5:131922550-131922572 CCCTTGGATACCAAAATCTGTGG - Intronic
998781111 5:145657775-145657797 ACCTTGGATGCCTGTCCCTGAGG - Intronic
999450340 5:151673069-151673091 CCCTTGGCTGCCTGGGCCTGGGG - Intronic
1003588477 6:7415998-7416020 CCAGTGGATGCTTAAGACTGTGG - Intronic
1003924607 6:10865331-10865353 CCTTTGGAGGCCTCCGCCTGCGG - Intronic
1004471007 6:15929086-15929108 CCCTTGGCTGCCTATAGCTGTGG + Intergenic
1005000462 6:21235052-21235074 CCTGTGGATGCCTGAGCTTGGGG + Intergenic
1007107642 6:39294683-39294705 CCCTTAGAGGCCTCAGCCAGTGG + Intergenic
1007192971 6:40035736-40035758 CCTTTGGGTGCCCAAGCCTGAGG - Intergenic
1008176417 6:48272909-48272931 TCCTGGTATGTCTAAGCCTGAGG - Intergenic
1009505386 6:64470654-64470676 GCCTTGGATGCCTTAGGATGTGG - Intronic
1012467176 6:99529161-99529183 CCCTTGGATACCAAAGTCTGTGG - Intergenic
1013805505 6:113992031-113992053 GCCATGGTTGCCTAACCCTGGGG - Intronic
1014186454 6:118439820-118439842 GCCTTGGATGCCTGTGTCTGTGG + Intergenic
1016039018 6:139412678-139412700 CCCATTGATGCCAAGGCCTGTGG + Intergenic
1016643026 6:146372491-146372513 GCTTTGGATGCCTATGCTTGTGG + Intronic
1017849560 6:158293288-158293310 CACTTGGAAGCCCAAGGCTGTGG - Intronic
1019610935 7:1936279-1936301 CCCTTTGAGGCCAAGGCCTGTGG - Intronic
1020232559 7:6331001-6331023 CTCCTGGATGAATAAGCCTGTGG - Exonic
1027049815 7:75014936-75014958 CCCTCGGAGCCCGAAGCCTGCGG + Intronic
1029383216 7:100226728-100226750 CCCTCGGAGTCCGAAGCCTGCGG - Intronic
1035272322 7:157727853-157727875 CCCTTGGACCCCTGAGTCTGTGG + Intronic
1037915985 8:22773754-22773776 CCCTTGGGAGCCTCAGCCGGGGG + Intronic
1039808469 8:41023799-41023821 TCCTTGGCTTCCGAAGCCTGTGG - Intergenic
1041005546 8:53494172-53494194 CCCTTGGAAAGCTAACCCTGTGG + Intergenic
1045863647 8:106840549-106840571 CCCTTGGATACCAAAATCTGTGG + Intergenic
1046343232 8:112886717-112886739 CCCTTGGATACCAAAATCTGAGG + Intronic
1050248612 9:3719127-3719149 GCTTTGGTTGCCTATGCCTGTGG - Intergenic
1051049413 9:12913756-12913778 CCCTTGAATGGCTAGTCCTGGGG - Intergenic
1053493241 9:38527231-38527253 CTCCTGGATGAATAAGCCTGCGG + Intergenic
1057673926 9:97121793-97121815 CTCCTGGATGAATAAGCCTGCGG + Intergenic
1057849130 9:98551048-98551070 CCTTTGGATGGCTTAGACTGTGG - Intronic
1058797286 9:108511054-108511076 GCCTAGGAAGCCTAAGCCTCTGG - Intergenic
1059135583 9:111803319-111803341 CCGCTGGATGCCTAAGCCTTGGG + Intergenic
1060904468 9:127292396-127292418 CCCTTGGCTGCCTGAGCTTGTGG - Intronic
1062274460 9:135724180-135724202 CCCCTGGAGGCCTGACCCTGAGG - Intronic
1062547081 9:137068746-137068768 GGTTTGGAGGCCTAAGCCTGTGG - Intronic
1185747211 X:2583304-2583326 CCCTGGGAAGCCGAAGCCTTGGG - Intergenic
1186085836 X:5989783-5989805 CCATTGGATGCCTCAAGCTGTGG + Intronic
1194115055 X:89886378-89886400 GCTTTGGTTGCCTATGCCTGTGG + Intergenic
1194673522 X:96765644-96765666 CCAGTGGATGCCTAAAACTGTGG - Intronic
1195796433 X:108653320-108653342 CCGTTGGATGCCTGAACCTGTGG + Intronic
1196050154 X:111296377-111296399 ACCTTGGATGCCTGAGACTAGGG - Exonic
1198929515 X:141838599-141838621 CCCTTGGTTGCAGTAGCCTGTGG + Intronic
1200467847 Y:3543469-3543491 GCTTTGGTTGCCTATGCCTGTGG + Intergenic