ID: 915578464

View in Genome Browser
Species Human (GRCh38)
Location 1:156797517-156797539
Sequence CATTGAGACTGAAGTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915578464_915578466 -2 Left 915578464 1:156797517-156797539 CCTGCTCTACTTCAGTCTCAATG 0: 1
1: 0
2: 1
3: 10
4: 150
Right 915578466 1:156797538-156797560 TGCAGATAAGATTCAGGTGCAGG 0: 1
1: 0
2: 2
3: 7
4: 178
915578464_915578465 -8 Left 915578464 1:156797517-156797539 CCTGCTCTACTTCAGTCTCAATG 0: 1
1: 0
2: 1
3: 10
4: 150
Right 915578465 1:156797532-156797554 TCTCAATGCAGATAAGATTCAGG 0: 1
1: 0
2: 0
3: 13
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915578464 Original CRISPR CATTGAGACTGAAGTAGAGC AGG (reversed) Intronic
908272233 1:62433218-62433240 CCTTTAGACTGAAGTACAGTTGG + Intergenic
909044779 1:70696689-70696711 CATTGAAACTGAAATAGAGCAGG - Intergenic
909992548 1:82240453-82240475 CATGGAGAGTGAAGAAAAGCAGG - Intergenic
910290509 1:85596056-85596078 CATAGAGACTGATGGAGAACAGG + Intergenic
915578464 1:156797517-156797539 CATTGAGACTGAAGTAGAGCAGG - Intronic
915630631 1:157151649-157151671 CGGTGAGACTGAGGCAGAGCTGG + Intergenic
917021402 1:170592298-170592320 CATTGTGACTGAACTAGAGAGGG + Intergenic
917112593 1:171565150-171565172 CAGTGAGGCTGAAGCATAGCAGG - Intronic
919358250 1:196554901-196554923 AATTGATACTGAAGTAGCACTGG + Intronic
919550965 1:198987062-198987084 CATTGAGGATGCAGAAGAGCAGG + Intergenic
919846750 1:201647688-201647710 CTCAGAGACTGAAGTAGGGCGGG + Intronic
922071554 1:222199462-222199484 CATTAAGACTGGAGTAGCACTGG - Intergenic
922324655 1:224516943-224516965 CACTGAAACAGAAGCAGAGCTGG - Intronic
1067934312 10:50595821-50595843 CAATGAGACTGAGGCAGAGTGGG + Intronic
1068356636 10:55918393-55918415 AATGGAGACCGAAGAAGAGCAGG + Intergenic
1070484827 10:76920246-76920268 AATTGAGAATGAAGAAGAGAGGG + Intronic
1073876797 10:107933339-107933361 CAATGAGGCTTTAGTAGAGCTGG + Intergenic
1074245234 10:111684029-111684051 TATTGAGAGTTAAGTAAAGCAGG - Intergenic
1075253422 10:120903807-120903829 AACTGACACTTAAGTAGAGCCGG - Intronic
1076242979 10:128923912-128923934 CATGGAGACAGAAGAAGAGAAGG - Intergenic
1076932932 10:133545901-133545923 CATGGAGACTGAGGAAAAGCAGG + Intronic
1077633049 11:3824056-3824078 CATTGAGGCCGAAGTTGAGGCGG - Exonic
1079466278 11:20734174-20734196 CATGGTGACTAAAGTAGAGAAGG + Intronic
1084071942 11:66742541-66742563 CATTGAGAATGAAGATGAGTTGG - Intergenic
1084626966 11:70315224-70315246 CACTGTGACTGAAGTAGCACTGG - Intronic
1085852386 11:80137209-80137231 CATTGAGAATGAAAGAAAGCTGG - Intergenic
1086021936 11:82240318-82240340 CATGGAGAGTGAAGAAAAGCAGG - Intergenic
1087480509 11:98693967-98693989 CATTGAGACTTGAGAGGAGCCGG + Intergenic
1087606368 11:100383506-100383528 CATGGAGAATGAAGAAAAGCAGG + Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1087843249 11:102941928-102941950 AATTGAGACTGGAGTAAAGGTGG + Intergenic
1094637194 12:32238106-32238128 CTTTAAGACTTCAGTAGAGCAGG + Intronic
1095303568 12:40614638-40614660 CATGGAGAATGAAGAAAAGCAGG - Intergenic
1095894530 12:47267126-47267148 TACTGACACTGAAGTACAGCAGG + Intergenic
1099575554 12:84375830-84375852 CATTGAAATTGAAATAGACCAGG + Intergenic
1101303410 12:103504111-103504133 CTATGAGCCTGAAGTAGCGCAGG - Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1105727763 13:23182735-23182757 CAGTCATACTGAAGTCGAGCAGG - Intronic
1107845020 13:44503413-44503435 CATTGAGACTAAAGTTGACATGG + Intronic
1108026677 13:46185178-46185200 CATTAAGACTGAAAGAGAGGAGG - Intronic
1113478057 13:110599452-110599474 CATGGAGACTGAAGCTGAGGGGG + Intergenic
1119762170 14:77159236-77159258 CATTCAGAAGGAATTAGAGCAGG - Intronic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1124708758 15:31987292-31987314 CATAGAGAGTGCAGTAGAACAGG - Intergenic
1125888098 15:43244065-43244087 CATTGAGACTGAGGTGTGGCTGG - Intronic
1128092447 15:64928140-64928162 CAGTGAGACACAGGTAGAGCTGG + Intronic
1131500115 15:92954868-92954890 CATTCATACTGAAGTATAACTGG - Intronic
1133687807 16:8182827-8182849 CAGTGAGTCTGAAGTGAAGCGGG + Intergenic
1133974350 16:10589928-10589950 CATTGAGAATGACGATGAGCTGG + Intergenic
1139185509 16:64801517-64801539 CATTGAGAATGAAGTTCACCAGG + Intergenic
1139274442 16:65714443-65714465 CACTGAGACTGAAGTTAAGCTGG + Intergenic
1142481091 17:218678-218700 CATTGAGACTGGTATAGAGAAGG - Intronic
1147666494 17:42152024-42152046 CATTTAGAAAGTAGTAGAGCTGG - Intronic
1148961204 17:51394442-51394464 CATTGAGACTGATTTAAAGTAGG + Intergenic
1151354876 17:73552441-73552463 CATTGAAACTGGAGTGGCGCAGG + Intronic
1151512065 17:74566768-74566790 CATTGACATTGAATTAGAGAAGG + Intergenic
1151716916 17:75835681-75835703 CCTTGAGGCTGATGTAGAGCTGG + Exonic
1152091819 17:78251406-78251428 CACTGAGACAGAAGGAGGGCAGG + Intergenic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1153714695 18:7835916-7835938 CATAGAAACTGAAAGAGAGCAGG - Intronic
1153914791 18:9735577-9735599 CATCCAGACTGAGGAAGAGCCGG - Intronic
1155576005 18:27247700-27247722 CATTGAGACATAAGAAGAGTAGG + Intergenic
1160238389 18:77104085-77104107 CAGTGAGACTGAAGAAGGGCTGG + Intronic
1162583177 19:11542868-11542890 CATTAAGATTGCAGTGGAGCCGG - Intronic
1167795176 19:51704164-51704186 CGTTAAGAAAGAAGTAGAGCCGG - Intergenic
1168411833 19:56145078-56145100 CAGTGAGACTTAAGTAAAACAGG + Intronic
925268451 2:2583840-2583862 CACTGATGCTGAAGTAGAGATGG + Intergenic
925935461 2:8754188-8754210 CATTCAGGCAGAAGCAGAGCTGG - Intronic
927099874 2:19779933-19779955 GACTGAGACTGAGGTGGAGCAGG + Intergenic
929941512 2:46337448-46337470 CCTAGAGACTGAAGTGGGGCGGG + Intronic
931560342 2:63554830-63554852 CATGGAGACTGAGGAAAAGCAGG + Intronic
935167311 2:100580726-100580748 CATTGCCACTGGAGTAGAGGGGG - Intergenic
935914503 2:107934985-107935007 CACTGAGCCTGAAGGAGAGAAGG + Intergenic
936847106 2:116850306-116850328 CAATTAGTCTGAAATAGAGCAGG + Intergenic
938783295 2:134604306-134604328 CATAGAGAATGGAATAGAGCAGG + Intronic
939023877 2:136989100-136989122 CATTGAGACTGAAGTCCCACAGG + Intronic
941486047 2:166084193-166084215 AATTGAGAATAAAGGAGAGCTGG - Intronic
942367546 2:175243615-175243637 CAGTGTGACTGAGGCAGAGCAGG - Intergenic
942886350 2:180928837-180928859 CAAATAGACTGAAGAAGAGCAGG - Intergenic
943718572 2:191179134-191179156 CAGGGAGCCTGAAGAAGAGCGGG + Intergenic
947467788 2:230369364-230369386 CACTGAGGCTGAAGTAGTGCTGG + Intronic
948466579 2:238154835-238154857 CACTGAGACTGAGGTAGACTAGG + Intergenic
1168926209 20:1581572-1581594 CCTAGAGACAGAAGTAGGGCAGG - Intronic
1168997464 20:2143997-2144019 CATTGAGACTTCAGAAGAGCAGG + Exonic
1169244833 20:4017005-4017027 CATGGAGACTGAGGAAGAGGGGG - Intergenic
1170125705 20:12961178-12961200 CTTTGAGATTAAAGTAGGGCTGG + Intergenic
1174288394 20:49488846-49488868 CAGTGTGGCTGAAATAGAGCAGG + Intergenic
955408675 3:58642111-58642133 CATTGAGGCTGGAGTGGAACAGG + Intronic
958075414 3:88670226-88670248 CATTGAGACTGAAGTCAGACAGG - Intergenic
961976173 3:131027146-131027168 CACTGAGACTGGAGTACATCCGG - Intronic
963479631 3:145854563-145854585 ACTTCAGACTGAAGTAGGGCTGG - Intergenic
965141875 3:164848589-164848611 CAGTGAGACTGGAGTAGTCCAGG - Intergenic
965168810 3:165233892-165233914 AGTTGAGAATGAAGTTGAGCCGG + Intergenic
972890356 4:43550360-43550382 TATTGAGAATGAAGGAGTGCTGG - Intergenic
974340176 4:60604202-60604224 CATGGAGAATGAAGAAAAGCAGG - Intergenic
976497290 4:85744983-85745005 CATTGAGACTGGATTAAAGAAGG - Intronic
977430011 4:96920069-96920091 TATTGATTCTGAAGTAGTGCTGG - Intergenic
977642392 4:99371632-99371654 CATTGAGACTGATGCTGAGGAGG + Intergenic
978321498 4:107500933-107500955 CCTTGAGACTCAAGAAGAGAGGG - Intergenic
978477496 4:109147518-109147540 CATTGAAAATGTATTAGAGCTGG + Intronic
979753138 4:124304166-124304188 AATTGAGAGTGAAGGAGAGATGG + Intergenic
980421631 4:132567652-132567674 CATTAACACTGAAGTGGAGCAGG - Intergenic
982267284 4:153549817-153549839 CATTCAGACAGAAATAGAGATGG - Intronic
984271808 4:177557321-177557343 TATTGATACGGAAGGAGAGCAGG + Intergenic
984747052 4:183231653-183231675 CATAGGGAATGAAGGAGAGCAGG + Intronic
987416198 5:17663999-17664021 CATGGAGAATGAAGAAAAGCAGG - Intergenic
988815757 5:34833195-34833217 CAATGAAACTGAAGTAGAGGTGG - Intergenic
991225315 5:64264022-64264044 TATGGAGACTGAAGTAAATCAGG - Intronic
995440532 5:112187028-112187050 CATCGAGATTAAAATAGAGCAGG - Intronic
995911361 5:117191532-117191554 TATGGAGACTGAAGTGGAGTTGG - Intergenic
1000452100 5:161402418-161402440 CTGTGAGACTGGAGTAGGGCGGG - Intronic
1001672237 5:173483426-173483448 CATTGAGACCGCACTACAGCAGG + Intergenic
1002967057 6:1977605-1977627 CATGGAGAATGAAGAAAAGCAGG + Intronic
1003492367 6:6634781-6634803 CATTGAAACAGAAATAGAGGAGG - Intronic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1005753403 6:28904180-28904202 AACTCAGACTGAAGTAGGGCCGG + Exonic
1007153072 6:39714227-39714249 AAATGACACTGAGGTAGAGCAGG + Intronic
1007519285 6:42439038-42439060 CTTAGAGACTGAAAAAGAGCAGG + Intronic
1008331594 6:50252074-50252096 CATAGAGACAGAAGTAGATTAGG + Intergenic
1008451747 6:51659758-51659780 CACTGACCCAGAAGTAGAGCAGG + Exonic
1008802911 6:55391796-55391818 GACTGGGAGTGAAGTAGAGCTGG + Intronic
1013738954 6:113260605-113260627 CATTGAGGCTCAGTTAGAGCTGG - Intergenic
1013742007 6:113298391-113298413 CTATGAGACTGAATTAGATCAGG - Intergenic
1014016965 6:116543186-116543208 AATTGAGACAGAAGAACAGCTGG + Intronic
1019677133 7:2320681-2320703 CATCCAGACTGGAGTGGAGCAGG - Intronic
1022226284 7:28367199-28367221 CATTGGGACTGATGAAGAGATGG - Intronic
1028978158 7:96937144-96937166 TATTGAACCTGAGGTAGAGCAGG - Intergenic
1031862104 7:126992643-126992665 CATATAAACTGAAGTAGAGAAGG - Intronic
1036772813 8:11590798-11590820 CATAGAGACGGAAGTAGAACGGG + Intergenic
1038968735 8:32607050-32607072 CATAGAGAGTAAAGGAGAGCAGG + Intronic
1039249301 8:35643878-35643900 CCCTGAGACTGATGAAGAGCAGG - Intronic
1039820405 8:41129563-41129585 CAGTGAGAATGAAGAAAAGCAGG + Intergenic
1041360844 8:57052411-57052433 CAGTGAGACAGAAGTAAAACAGG + Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1044113232 8:88302857-88302879 CATAGAGAATGAAGAAAAGCAGG + Intronic
1044447684 8:92297467-92297489 CACTGAGAATGAAGAAAAGCAGG - Intergenic
1045287826 8:100807219-100807241 CGGTGAGTCAGAAGTAGAGCAGG + Intergenic
1046411926 8:113856085-113856107 CATTAAGCCTGAAGTAGAAGAGG + Intergenic
1047355317 8:124115771-124115793 CAGTGAGACTTAAAGAGAGCAGG + Intronic
1048026272 8:130590060-130590082 CATTGAGACTGTAGAAGCACAGG - Intergenic
1049713518 8:144078451-144078473 CCCGGAGACAGAAGTAGAGCCGG + Intergenic
1050036794 9:1444909-1444931 CATTGAAACTGCAGTAGTTCAGG - Intergenic
1050817660 9:9835704-9835726 CCTTCAGAATGAAGTAGATCAGG - Intronic
1051410321 9:16782937-16782959 CATTTACTCTGAAGTAAAGCAGG + Intronic
1051603363 9:18896574-18896596 CATGGAGAATGAAGAAAAGCTGG + Intronic
1052125461 9:24769272-24769294 CAATGAGACTAGAGTAGACCTGG + Intergenic
1052176886 9:25473011-25473033 CATGGAGAATGAAGAAAAGCAGG - Intergenic
1057459707 9:95250116-95250138 CAGTGAGACTCAGGTGGAGCTGG + Intronic
1058874283 9:109229643-109229665 CATTGAGGCTAAAGTAAAACAGG - Intronic
1059093264 9:111384482-111384504 CATTGGGAATGGAGTGGAGCAGG - Intronic
1062138972 9:134945034-134945056 GATTGAGACTGAACTGGACCGGG + Intergenic
1186057853 X:5669488-5669510 ATTTGAGACTGAACTTGAGCTGG + Intergenic
1187040801 X:15593616-15593638 CGTGGAGATTGAAGAAGAGCTGG - Intronic
1189795186 X:44639304-44639326 CAGAGATACTGAAGAAGAGCTGG + Intergenic
1191025738 X:55911228-55911250 GATTGAGAAGGAAGAAGAGCAGG + Intergenic
1192650257 X:72939862-72939884 CATTAAGACTGAAATAAATCTGG + Intronic
1192897398 X:75458933-75458955 CATAGAGAATGAAGAAAAGCAGG + Intronic
1195132399 X:101866293-101866315 AATGGAAACTGAAATAGAGCAGG + Intergenic
1195342629 X:103919922-103919944 CATTGAGACTGCTGTTGAGATGG - Intronic
1195364162 X:104111655-104111677 CATTGAGACTGCTGTTGAGATGG + Intronic
1198514101 X:137387013-137387035 CTTTGAGAGTGAAGTACAGTGGG + Intergenic
1199308318 X:146293096-146293118 CATGGAGAGTGAAGAATAGCAGG - Intergenic