ID: 915579011

View in Genome Browser
Species Human (GRCh38)
Location 1:156802227-156802249
Sequence TTGAGTGAACTGAAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915579011_915579018 30 Left 915579011 1:156802227-156802249 CCCACCTCCTTCAGTTCACTCAA 0: 1
1: 0
2: 0
3: 15
4: 202
Right 915579018 1:156802280-156802302 CTTTTTAGTCCTACCAAAGATGG 0: 1
1: 0
2: 0
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915579011 Original CRISPR TTGAGTGAACTGAAGGAGGT GGG (reversed) Intergenic
900624769 1:3603158-3603180 TGGAGGGACCTGAAGGAGTTTGG - Intronic
901895088 1:12304783-12304805 TTGAGGAAACTGAGGGGGGTGGG + Intronic
902576567 1:17381691-17381713 TTCACTGAACTGATCGAGGTAGG + Intronic
903963171 1:27070172-27070194 TTGGGTGAACTGAAGGCAGGTGG + Intergenic
904198105 1:28801172-28801194 TTCTGTAAACTGAAGGAGGGTGG + Intergenic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
907423035 1:54360159-54360181 TGGGTTGAACTGAAGGAGATAGG - Intronic
907556497 1:55348860-55348882 TGGAGTGATCTGGTGGAGGTTGG + Intergenic
908174612 1:61542228-61542250 TTCAGTGACCTGAATGAGATTGG - Intergenic
908493757 1:64673290-64673312 TGTAGTGAGCTGCAGGAGGTTGG - Intronic
910545755 1:88415683-88415705 TTGAGTGGCCAGAAGGTGGTGGG + Intergenic
911275973 1:95858840-95858862 TTGGGTGAAGTCAAGAAGGTGGG + Intergenic
911592484 1:99764080-99764102 TTGAGTGCATTCTAGGAGGTAGG + Intronic
914688486 1:150003980-150004002 TTGAGTGAAATAAAGAAGTTAGG - Intronic
915579011 1:156802227-156802249 TTGAGTGAACTGAAGGAGGTGGG - Intergenic
915748066 1:158180509-158180531 TTGAGAGAACTGGATTAGGTTGG - Intronic
915839415 1:159202741-159202763 TTACCTGAACTGAAGGGGGTGGG - Intronic
916057114 1:161075303-161075325 TTGAGGGAACTGGAGGTAGTGGG + Intronic
916250700 1:162735023-162735045 TGGACTCAACTGCAGGAGGTAGG + Intronic
917339877 1:173965046-173965068 TTGGGTCAACTTAATGAGGTGGG - Exonic
917796399 1:178535904-178535926 TGGAGTGAACTGATGGGTGTGGG + Intronic
919429384 1:197473921-197473943 TAGAGTGAACTGAATGAGTAGGG - Intronic
919599958 1:199610417-199610439 CTGAGTGAATAAAAGGAGGTAGG - Intergenic
920853638 1:209646386-209646408 ATGTGTGAAGTGAAGGAGCTGGG - Intronic
1063694773 10:8323493-8323515 TTGGGTGAAAGGAAGGAAGTAGG + Intergenic
1064454860 10:15477996-15478018 TTGAATGAACTGAAGGCTGTGGG + Intergenic
1065836952 10:29666986-29667008 TTGAAGGCTCTGAAGGAGGTAGG + Intronic
1066362487 10:34744899-34744921 TGCAGTGGACTGAAGGAAGTGGG + Intronic
1067190874 10:44067099-44067121 TTGAGTGAGAAGAAGGAGCTAGG + Intergenic
1068813676 10:61285582-61285604 TTGAATGAATTGAAGGAGGCAGG + Intergenic
1071182169 10:82998842-82998864 TTTAGTTAATTGAAGGGGGTGGG + Intergenic
1073518113 10:104097397-104097419 TGGAGTGGACAGAATGAGGTCGG - Intergenic
1078076231 11:8163771-8163793 TAGAGTGAACTGAAGCAATTTGG - Intronic
1079312327 11:19377872-19377894 TGGAGTAAGCTGAAGGAGATGGG + Intronic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1081981872 11:47271879-47271901 ATGAGCAAACTGCAGGAGGTGGG - Intronic
1084899618 11:72299871-72299893 TGGAGTGAAGTGACGGAGGAGGG + Intronic
1085207989 11:74748626-74748648 CTTACTGAACTGAAAGAGGTGGG - Intergenic
1085353722 11:75816844-75816866 TTGAGTGCAGTAAAGGAGGCGGG + Intronic
1085757820 11:79216212-79216234 TTGAGTGAACTGAAGCTTGCAGG + Intronic
1086093588 11:83028436-83028458 TTCAGAGAACTGAAGGATGCAGG + Intronic
1086837826 11:91647680-91647702 TTGAGTGATCAGAAGGAGCCAGG - Intergenic
1089593705 11:119561227-119561249 TTGAGTGTCCTGAGGTAGGTGGG - Intergenic
1091674705 12:2480588-2480610 TTGAGTGAAATGAAGGTATTGGG + Intronic
1092272115 12:7031429-7031451 TGGAGAGAACTGAAGCAGGAGGG + Intronic
1092966701 12:13650621-13650643 GTTACTGAACTGAATGAGGTGGG - Intronic
1096668415 12:53182173-53182195 TCCAGTCAAATGAAGGAGGTAGG + Intronic
1097373691 12:58815611-58815633 TTGAGAGAACTGAGGGAGATGGG + Intergenic
1098457169 12:70687661-70687683 TTGGGTGACCTAAAGGAAGTAGG + Intronic
1099448455 12:82779291-82779313 TGGAGAGAACTGAAGGATTTAGG + Intronic
1099858294 12:88198232-88198254 TTCAGTGAGATGGAGGAGGTGGG + Exonic
1100147930 12:91699983-91700005 TACTTTGAACTGAAGGAGGTTGG - Intergenic
1100242544 12:92724302-92724324 TGGAGGGAACTGAATTAGGTGGG - Intronic
1102244171 12:111344607-111344629 TGGAGGGAGCTGAGGGAGGTGGG + Intronic
1102692203 12:114770180-114770202 TTGAGTCAACTGATGGAGACTGG + Intergenic
1104275943 12:127328011-127328033 TTGAGTGACCAAAAGAAGGTGGG - Intergenic
1109169553 13:59078328-59078350 TTGAGTGAAGAGAAGTAGTTGGG - Intergenic
1112372665 13:98808034-98808056 TTGAGTGAAATGAAAGATTTTGG + Intronic
1112906853 13:104433185-104433207 TTGAAGGAAATGGAGGAGGTAGG - Intergenic
1114553724 14:23549633-23549655 TAGAATGAACTGAAGGATGGGGG + Intronic
1115959151 14:38815527-38815549 TTGAGTGACCTGGATGAGATTGG + Intergenic
1116261944 14:42641072-42641094 TTTAGTAAACTGAAGGCAGTTGG + Intergenic
1117573326 14:57071879-57071901 TTGAGTTAACTCAAGCAGATTGG + Intergenic
1117826597 14:59710612-59710634 CTGAGTGCACCAAAGGAGGTGGG + Intronic
1118329657 14:64805489-64805511 TAGTGTTAAGTGAAGGAGGTGGG - Intronic
1119428362 14:74550414-74550436 ATTAGGGAACTGGAGGAGGTGGG - Intronic
1121708902 14:96022256-96022278 CTGGTTTAACTGAAGGAGGTGGG - Intergenic
1122378463 14:101285260-101285282 CTGAGGCAACTGAAGGTGGTTGG - Intergenic
1124658050 15:31524554-31524576 TTGGGGGAACGGAAGGAGGGAGG - Intronic
1124826477 15:33101269-33101291 TTGAGTATACTGGAGGAGGTTGG + Intronic
1126683066 15:51222725-51222747 ATGAATGAACGGAAGGAGATAGG + Intronic
1127100025 15:55554522-55554544 TTGGCTGAACTGACAGAGGTAGG + Intronic
1128836049 15:70809948-70809970 TTGAGGGAACTGAAGCAGGCTGG + Intergenic
1129680088 15:77653868-77653890 TTCAGTGAACTGAAGGGAATGGG - Intronic
1131182999 15:90253266-90253288 ATGTGTGGCCTGAAGGAGGTGGG + Exonic
1131294897 15:91139187-91139209 TGGTGTGAAGGGAAGGAGGTTGG + Intronic
1132190489 15:99851874-99851896 TTGATTGAATTGAAGGATGCAGG - Intergenic
1132682773 16:1150171-1150193 TGGAGTGAACGGAAAGCGGTGGG + Intergenic
1138395812 16:56703835-56703857 TTGAGAGAAGTGAGGGAGGGAGG - Intronic
1138983265 16:62296237-62296259 CTGAGTGAATTGAGGGATGTGGG - Intergenic
1140799915 16:78476928-78476950 AAGAGGGAACTGAAGGAGGAAGG - Intronic
1143634989 17:8159453-8159475 TTGGGTGAACTGATTGAGGAAGG - Exonic
1144168458 17:12635128-12635150 TTGATTTAACTGTAGGAGGATGG - Intergenic
1147896193 17:43752930-43752952 TTGAGAGAAGTGCAGGAGGCTGG + Intergenic
1148216996 17:45838765-45838787 CTCAGTGAACTGAAGGGGCTTGG + Intergenic
1149237047 17:54604641-54604663 TTGATTTATCTGAAGTAGGTGGG + Intergenic
1159146571 18:64462189-64462211 ATGACTTCACTGAAGGAGGTGGG + Intergenic
1159742335 18:72187830-72187852 TGGAATGAACTGAAGGAATTAGG + Intergenic
1159871012 18:73759692-73759714 TTGTGTGAAAGGAAGGAGGCTGG + Intergenic
1163110776 19:15160003-15160025 TGCAGTGAAGTGAGGGAGGTGGG + Exonic
1164434174 19:28214761-28214783 TTGAGTGACCTTATGGAGGTAGG - Intergenic
1167418954 19:49391764-49391786 TTGAGTGAACGGACGGATGTAGG + Intronic
1167785201 19:51630276-51630298 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167787300 19:51646700-51646722 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
925686566 2:6479689-6479711 TTGCCTGAATTGAAGGATGTAGG - Intergenic
926298937 2:11588647-11588669 GTGAGGGCACTGAAGGAGATAGG - Intronic
929507562 2:42540110-42540132 TTGAGTCAGGTGAAGGAGGTGGG + Intronic
929591469 2:43150357-43150379 TTGAATGAAATGAAGTGGGTAGG + Intergenic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
937782382 2:125853898-125853920 TTGAGGGAACTAAAGAAAGTAGG - Intergenic
938218761 2:129546979-129547001 TTGAGTGAAGAGATGGGGGTGGG - Intergenic
939258618 2:139778054-139778076 TGGTGTGCAGTGAAGGAGGTGGG + Intergenic
939290843 2:140192965-140192987 TTCAGGGAACTGAAAGAGGTTGG - Intergenic
945440634 2:209874973-209874995 TTCAGTGACATGAAAGAGGTGGG - Intronic
945615994 2:212067772-212067794 TTCTGTCAACTGAAAGAGGTAGG - Intronic
945911539 2:215655417-215655439 AAGATTGAACTGAAGGAGATTGG - Intergenic
946249864 2:218405520-218405542 TTGGGGGATCTGTAGGAGGTGGG + Exonic
946384292 2:219373021-219373043 TTTAGTGGAAGGAAGGAGGTTGG + Intergenic
947625640 2:231616511-231616533 TTGAGGGGACTGATGGAGGAGGG - Intergenic
1169091221 20:2862436-2862458 TTGAGTGGGCTGAGGGAGTTGGG + Intronic
1170619773 20:17985960-17985982 TTGAGTGAAAAGAATGAAGTCGG - Intronic
1170686736 20:18576155-18576177 CTGAGTGAAGTGCAGGAAGTTGG + Intronic
1172232829 20:33348469-33348491 GTGAGTGAACAAAAGGAGTTTGG - Intergenic
1173071847 20:39775706-39775728 TTGGAAGAACTGAATGAGGTAGG - Intergenic
1173289487 20:41701913-41701935 TTGTGTGAAAGGAAGGAGGGAGG + Intergenic
1173734080 20:45347529-45347551 TTGAGTGAGGTGAAGGGGGTAGG - Intronic
1174465144 20:50711569-50711591 TTGAGAGAAGTGAAGGAGTCAGG + Intergenic
1178556222 21:33592693-33592715 TTGTATGAACTGAATGAGGAGGG + Intronic
1178686282 21:34713130-34713152 TTGATTGAAAAGAAGGGGGTGGG + Intronic
1180119040 21:45734315-45734337 GTGAGTGGACTACAGGAGGTCGG - Intronic
1182305142 22:29362771-29362793 GTGAGTTAACTGGAGTAGGTGGG - Intronic
1182312452 22:29418925-29418947 GTGAGTTAACTGGAGTAGGTGGG - Intronic
1182687812 22:32134339-32134361 GTGAGTTAACTGGAGTAGGTGGG + Intergenic
1183882750 22:40849115-40849137 TTGAGTGAATAGATGAAGGTAGG - Intronic
1184026031 22:41857226-41857248 TTGAGTGAACTTAAGGCAGGAGG + Intronic
1184192564 22:42904671-42904693 AGGAGGGAACGGAAGGAGGTGGG - Intronic
1184810493 22:46828184-46828206 TTGAGAGAATGGATGGAGGTGGG + Intronic
1184987269 22:48144426-48144448 TGGAGGGACCTGCAGGAGGTGGG + Intergenic
1185077289 22:48690226-48690248 TTGTGTGAACACAAGGAGATGGG - Intronic
949407697 3:3732005-3732027 TTGAGTCATCTTAAGCAGGTAGG - Intronic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953346031 3:42176484-42176506 TTCAGCAAACTGAAGTAGGTGGG - Intronic
955129206 3:56147129-56147151 ATGAGTGAACTCAAGAAGTTTGG - Intronic
956043386 3:65170015-65170037 TTGAGAGAAATAAGGGAGGTGGG + Intergenic
956067952 3:65416997-65417019 TTGAGGGAAATGAAGGAAGGTGG + Intronic
957750522 3:84408786-84408808 TTGATTGTATTGAAGGATGTTGG - Intergenic
957805246 3:85139897-85139919 TGGAGTGAAGGGAAGGATGTAGG + Intronic
958014280 3:87920096-87920118 TACAGTGACCTGAATGAGGTTGG + Intergenic
959210184 3:103368988-103369010 CTGAGAGAAGTGAAGAAGGTGGG - Intergenic
959967300 3:112371481-112371503 TTCAGAGAACTGAAGAAGGAGGG + Intergenic
960183536 3:114611184-114611206 TTGGTTGAACTGAAGAAGGAAGG + Intronic
961056656 3:123794393-123794415 CTGAATGAAGGGAAGGAGGTAGG + Intronic
962221612 3:133569091-133569113 ATGTGTGAACTGAAGGATGAGGG - Intergenic
962880658 3:139573528-139573550 CTGTGAGAACTGAAGGGGGTAGG - Intronic
963825390 3:149947698-149947720 TTGACAGAACTGAAGGAAGATGG - Intronic
963917831 3:150876138-150876160 ATGAGTGAACTTAAGGAGAAAGG - Intronic
965619357 3:170627021-170627043 AAGAGGGAACTGAGGGAGGTGGG - Intronic
965787525 3:172351790-172351812 TTGAGTGCTCTGAAGGAGGAGGG + Intronic
968073301 3:195801660-195801682 TTGAGCGAAGTGAGTGAGGTGGG - Intronic
968789577 4:2650331-2650353 TTGAGAGCACAGAAGGAGGGAGG + Intronic
970647732 4:18142058-18142080 TAGGGAGCACTGAAGGAGGTTGG + Intergenic
970874539 4:20854336-20854358 TGGAGTGACCTGAATGAGATTGG + Intronic
973969804 4:56201734-56201756 TTGAGTGCAATGAAGGATTTTGG + Intronic
976389580 4:84495506-84495528 TTGAGAGCAGTGAAGGAGGGTGG - Intronic
976401162 4:84608597-84608619 TTCAGTGAAATGAAGGAGTGAGG - Intronic
976993172 4:91395531-91395553 TGGTGTCAACTGAAGGATGTGGG + Intronic
979289006 4:118959232-118959254 GTCAGTGAAGTGAAAGAGGTGGG - Intronic
980071267 4:128244762-128244784 TTCAGTGAACTAAAGTAGGGGGG - Intergenic
981325168 4:143438152-143438174 TGGAGTCAACTGAAGCAGATGGG - Exonic
982121053 4:152144290-152144312 TACTTTGAACTGAAGGAGGTTGG + Intergenic
984196758 4:176666481-176666503 TTGAGTGGACTCATGGAGGTTGG - Intergenic
985541259 5:488738-488760 TTGGGTGAACGGAGGCAGGTGGG + Intronic
986486278 5:8241674-8241696 GAGAGTGAATTGCAGGAGGTGGG + Intergenic
988424382 5:31046497-31046519 TTGAATGAAATGAGGGAGCTTGG - Intergenic
991610094 5:68440896-68440918 TTGATTGAAAAAAAGGAGGTTGG + Intergenic
994631277 5:102291186-102291208 TTGTGTGAACTGTATGAGATAGG - Intronic
995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG + Intronic
998321064 5:141232142-141232164 TTTAATGTACTGAAGGAAGTTGG + Intergenic
998863117 5:146465255-146465277 CTGAGTGATCTCAAGGAGTTGGG + Intronic
999629866 5:153559867-153559889 AGGAGTGAACTCAAGGAAGTAGG - Intronic
1001019769 5:168173084-168173106 TCCAGGAAACTGAAGGAGGTGGG - Intronic
1001321576 5:170686835-170686857 TTGAGGGAAATAAAGGAGGATGG - Intronic
1004774656 6:18830077-18830099 TGCAGTGAAAGGAAGGAGGTGGG + Intergenic
1005097456 6:22132835-22132857 TGGAGAGAACAGCAGGAGGTGGG - Intergenic
1005850323 6:29815957-29815979 ATGAGAGAGCTGAAGGATGTGGG + Intergenic
1006143126 6:31942997-31943019 TGGAGAGAACTGAATGAGCTAGG + Exonic
1008376180 6:50794855-50794877 TTGAGCTACCTGAAGGAGGTGGG - Intergenic
1009439346 6:63657979-63658001 TTGAATGAACTGAAGGAAATAGG - Intronic
1010007908 6:71015490-71015512 TTAACTGAGCTGATGGAGGTAGG + Intergenic
1011489307 6:87874310-87874332 TACTTTGAACTGAAGGAGGTGGG - Intergenic
1012927835 6:105285393-105285415 TTGAATGAGCTGAAGGGGTTTGG - Intronic
1013841349 6:114398181-114398203 TTGAGTGGACTGAAGATGGTGGG - Intergenic
1014496540 6:122131051-122131073 TTGAGATATCTGAAGAAGGTGGG - Intergenic
1019163496 6:170084391-170084413 TTGAGTGATCTAACAGAGGTTGG + Intergenic
1022098201 7:27153864-27153886 TTGAGTTAACTGTAGTGGGTGGG - Exonic
1023502299 7:40863818-40863840 ATGAGTGATCTTTAGGAGGTAGG + Intergenic
1024962634 7:54993762-54993784 TGGAGTGATCTGAAGCAGGGTGG + Intergenic
1026841125 7:73670395-73670417 ATCAGTGAGCTGAAGGTGGTGGG + Intronic
1026930762 7:74221810-74221832 TTGGGTGGACAGAAGGAGGCTGG + Intronic
1027842884 7:83336781-83336803 TTGAATGAACTGAAGAAAGATGG - Intergenic
1028459274 7:91072336-91072358 TGGAGTGAACTTGAGGAGGCTGG - Intronic
1030596590 7:111547437-111547459 TTGAGTGAACTGCATGAATTTGG - Intronic
1032797952 7:135292505-135292527 TTGCATTAACTGAAGGAGATGGG + Intergenic
1033028205 7:137798296-137798318 TTGTGAGAACTGAAAGAGGAAGG + Intronic
1033046066 7:137963055-137963077 TTGAGTGAGATGAAGAAGGAGGG - Intronic
1035025726 7:155824167-155824189 TAGAGGGGCCTGAAGGAGGTCGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1036015665 8:4780864-4780886 TTCAGTGAACTGGATGAGATTGG - Intronic
1037489989 8:19389019-19389041 TTGAGTGCTCAGATGGAGGTGGG + Intronic
1038401174 8:27286059-27286081 TTTTGTGAACTGAAGGGGATGGG + Exonic
1042352731 8:67794161-67794183 TTGAATGACCTTGAGGAGGTGGG + Intergenic
1042990221 8:74631154-74631176 TAGAGTGGCCTGAATGAGGTGGG - Intronic
1045473693 8:102535772-102535794 TTGAATGAAGTGGAGGAGGCAGG + Intronic
1047054313 8:121147175-121147197 TTAGGTAAACTGAAGGAGGAAGG - Intergenic
1048053675 8:130843910-130843932 GAGAGTGACCTGAAGGAGTTGGG + Intronic
1049496841 8:142939556-142939578 TTGCGTGAAATGAAGGCGGAAGG - Intergenic
1052168533 9:25364286-25364308 TTCAGTGAACTGAATGGGGAAGG + Intergenic
1052186649 9:25604979-25605001 TTAAGAGAACTGAAGAAAGTGGG + Intergenic
1054903642 9:70395290-70395312 TTGAGTGAAAAGTATGAGGTAGG - Intronic
1060870421 9:127035364-127035386 TTGGATCAACTGAGGGAGGTAGG + Intronic
1203347548 Un_KI270442v1:45741-45763 TTGAATGAAGTGGAGGAGATTGG + Intergenic
1186692307 X:11991229-11991251 TTGTGTGAACACCAGGAGGTGGG + Intergenic
1195085511 X:101409687-101409709 TTGAGAGAACTGAAGGGTGGGGG - Intronic
1195462693 X:105145432-105145454 TTGAGTACACAGAAGGAGGCAGG + Intronic
1196367986 X:114944513-114944535 TTGAGAAAACTGAAGCAGGAAGG - Intergenic
1198542486 X:137654469-137654491 CTGAATGAAGTAAAGGAGGTGGG - Intergenic
1199803327 X:151272629-151272651 ATAAGTGGACTGAAGGAGATGGG - Intergenic
1201130423 Y:10947945-10947967 TAGAGTGGACTGAAGTAGATTGG - Intergenic