ID: 915579502

View in Genome Browser
Species Human (GRCh38)
Location 1:156805002-156805024
Sequence ACCACAGGAGTCCCCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 355}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915579496_915579502 22 Left 915579496 1:156804957-156804979 CCTCTTGTAGGAATGAGTGTGAA 0: 1
1: 0
2: 1
3: 12
4: 159
Right 915579502 1:156805002-156805024 ACCACAGGAGTCCCCAGGCCTGG 0: 1
1: 0
2: 2
3: 31
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915579502 Original CRISPR ACCACAGGAGTCCCCAGGCC TGG Intergenic
900146487 1:1161031-1161053 ACCACCGAAGCCCCCAGACCGGG + Intergenic
900254590 1:1691454-1691476 ACCACAGGAATCTCAACGCCGGG + Intronic
900263342 1:1744729-1744751 ACCACAGGAATCTCAACGCCGGG + Intronic
900310225 1:2029898-2029920 ACCACAGGTGTTCCCATGCGGGG - Intronic
900325422 1:2106425-2106447 TCCACACGTGTCGCCAGGCCAGG + Intronic
900325435 1:2106483-2106505 TCCACACGTGTCACCAGGCCAGG + Intronic
900325448 1:2106541-2106563 TCCACACGTGTCACCAGGCCAGG + Intronic
900325461 1:2106599-2106621 TCCACACGTGTCACCAGGCCAGG + Intronic
900325501 1:2106773-2106795 TCCACACGTGTCACCAGGCCAGG + Intronic
900325515 1:2106832-2106854 TCCACACGTGTCACCAGGCCAGG + Intronic
900325523 1:2106874-2106896 TCCACACGTGTCACCAGGCCAGG + Intronic
900428246 1:2590209-2590231 CCCACAGTGGTCCCCAGGTCTGG - Exonic
900490115 1:2943866-2943888 CCCACAGCAGTCCCCAGCACGGG - Intergenic
900625542 1:3606960-3606982 TGCACAGCAGGCCCCAGGCCTGG - Intronic
900673343 1:3869382-3869404 ACCACACCAGCCCCCAGGCTGGG - Intronic
900789036 1:4667140-4667162 CCCAGAGGACTCCCCAGGCGGGG + Intronic
900854326 1:5168589-5168611 ACCATTGCAGTCTCCAGGCCTGG + Intergenic
901424781 1:9175114-9175136 ACCAGATGAGACCCCAGCCCTGG + Intergenic
902937099 1:19772419-19772441 CCTACAGGAGTCCCCAGGGGAGG + Intronic
903971119 1:27119406-27119428 CCCAGAGCAGTCCTCAGGCCTGG - Intronic
904120435 1:28194307-28194329 TCCTCAGGAGTCCCCAGCCTGGG + Intergenic
904212847 1:28897256-28897278 ACCTCAGGAATCACCAGGCCTGG + Intronic
904578536 1:31522578-31522600 ACCACAGCAGTCCCCACAGCTGG - Intergenic
904720382 1:32503289-32503311 ACCACATGAGGCCCCAGACACGG + Intronic
905801140 1:40843728-40843750 ACCACCCCAGTTCCCAGGCCTGG - Intergenic
906997341 1:50810904-50810926 ACCACAGGTGCCACCATGCCAGG - Intronic
907228735 1:52975153-52975175 ACTACAGGAGCCACCATGCCCGG + Intronic
907268637 1:53277493-53277515 TCCACCTGAGTCCCCTGGCCTGG + Intronic
907305541 1:53511007-53511029 ACCACAGGATGCTGCAGGCCAGG + Intronic
908973420 1:69865839-69865861 ACCTCAGGAGTGACCTGGCCAGG + Intronic
912658327 1:111507399-111507421 ACCCAAGTAGGCCCCAGGCCAGG - Intronic
913255105 1:116945679-116945701 ACCACAGGAGCATCCAGTCCTGG + Intronic
914827093 1:151144384-151144406 CCCACAGGAGTCACCAACCCAGG - Exonic
914863457 1:151405777-151405799 ACCACCTGACTCCCCATGCCCGG - Exonic
915289378 1:154872761-154872783 AGCATAGGAATACCCAGGCCTGG - Intergenic
915316524 1:155031854-155031876 ACCACAGGCCTCTCCAGCCCTGG - Intronic
915579502 1:156805002-156805024 ACCACAGGAGTCCCCAGGCCTGG + Intergenic
916785737 1:168085834-168085856 CCCAAGGTAGTCCCCAGGCCTGG - Intronic
917447656 1:175120190-175120212 ACCACTGTGTTCCCCAGGCCTGG - Intronic
919423361 1:197399713-197399735 ATCAGAGGAGACCCCAGCCCTGG - Intronic
919822976 1:201484513-201484535 ACTAAAGGGCTCCCCAGGCCTGG - Exonic
919839744 1:201600155-201600177 ACCAGAGGGGTCCCCAAGGCTGG + Intergenic
920300160 1:204983612-204983634 CCAACAGGAGGCCCCAGGGCAGG - Intronic
920850286 1:209623791-209623813 ACCACGGCAGTGCCCATGCCCGG + Intronic
921784398 1:219211309-219211331 ACCAGCTAAGTCCCCAGGCCTGG + Intronic
922469327 1:225866251-225866273 ATCAGAGGAGGACCCAGGCCTGG + Intronic
922473607 1:225891035-225891057 GCCACATGGGCCCCCAGGCCTGG - Intronic
922586704 1:226738765-226738787 GCTCCAGGAGTCCCCAGGCTGGG - Intronic
922765211 1:228152848-228152870 ACCACAGGAGGCCACCAGCCAGG - Intronic
922886408 1:229024198-229024220 ATGTGAGGAGTCCCCAGGCCTGG - Intergenic
923211638 1:231808818-231808840 ACCAGGGGATGCCCCAGGCCAGG - Intronic
923279651 1:232430859-232430881 ACCACAGGGGTCCCCAGGTGGGG + Intronic
1063419040 10:5896408-5896430 ACCCCAGGGGTCCCCATTCCAGG - Intronic
1063591612 10:7400736-7400758 AGCAGAGGAGGCCCCAAGCCAGG - Intronic
1063612754 10:7576743-7576765 GTCACAGGAAGCCCCAGGCCTGG - Exonic
1065880632 10:30034670-30034692 CACACAGGAGTCCCCAGGGGAGG - Intronic
1065917258 10:30364481-30364503 CCCCCAGGAGTACCCAGGCTTGG - Intronic
1066480638 10:35792395-35792417 ATCGTAGGTGTCCCCAGGCCTGG - Intergenic
1067569565 10:47361433-47361455 GCCAGAGTAGCCCCCAGGCCGGG - Intergenic
1068588315 10:58826329-58826351 ACCACATGAGTTCCCAGACACGG + Intronic
1068602519 10:58970414-58970436 ACAGCAGGAGTCCCCACCCCTGG - Intergenic
1069486461 10:68827192-68827214 GCGCCAGGAGTCCCCAGGGCGGG - Intergenic
1069692677 10:70364135-70364157 CCCTCAGGACTCGCCAGGCCAGG + Intronic
1069899848 10:71701132-71701154 ACCTCAGGAGCCTCCAGGCTGGG + Intronic
1069957924 10:72062968-72062990 ACGACAAGGGCCCCCAGGCCTGG + Intronic
1073682127 10:105716148-105716170 TCCACTGGAGTCCCCAGCACAGG - Intergenic
1074581447 10:114723202-114723224 AGCACAGGAGTACCCAGGAGAGG + Intergenic
1074780997 10:116802262-116802284 TGCACAGGAGTCCACGGGCCTGG - Intergenic
1074901880 10:117824117-117824139 AGCACAGGGGTCCCCATCCCAGG + Intergenic
1075008122 10:118844870-118844892 ACAACAGGCTTACCCAGGCCTGG - Intergenic
1076293435 10:129365531-129365553 GCCGCAGGGGTCCCGAGGCCTGG - Intergenic
1076618610 10:131772577-131772599 TCCCCAGGAGCCCCCACGCCTGG + Intergenic
1076849621 10:133086559-133086581 GCCCCAGACGTCCCCAGGCCGGG - Intronic
1077221681 11:1420751-1420773 ACCAGAGGAGTCCCCCAGGCAGG - Intronic
1077269348 11:1667763-1667785 ACCACAGGGGCCAGCAGGCCTGG - Intergenic
1077296040 11:1826710-1826732 ACCCCAGGAATCCCCAGGACAGG + Intergenic
1078465978 11:11550634-11550656 ACCACAGGAGTCCCATGCCATGG + Intronic
1080666589 11:34341749-34341771 AACTCATGAGTTCCCAGGCCAGG + Intronic
1082687804 11:56260841-56260863 AGCACAGGAATGCCCAGGTCTGG + Intergenic
1082790306 11:57342434-57342456 ACAACATGAGTCACCATGCCTGG + Intronic
1082997067 11:59263087-59263109 ACCACAGCAGCCCCCTGGCAGGG - Intergenic
1083296988 11:61720246-61720268 ACCTGGTGAGTCCCCAGGCCCGG + Exonic
1083306816 11:61765793-61765815 ACCACAGCAGACCCCAGGTCCGG - Intronic
1083390697 11:62347786-62347808 ACTACAGGAGCCACCATGCCCGG - Intronic
1083419542 11:62545441-62545463 CCCCCAGCAGTGCCCAGGCCGGG - Intronic
1083687352 11:64384573-64384595 AAGACAGCAGTCACCAGGCCAGG + Intergenic
1084360248 11:68664534-68664556 ATCATAGGAGTGACCAGGCCGGG - Intergenic
1084410825 11:69005121-69005143 ACCCCTGGAGTCCCCAGCCCAGG + Exonic
1084523024 11:69675971-69675993 GCCTCAGGAGGCTCCAGGCCAGG + Intergenic
1084525448 11:69694983-69695005 ACCACAAGAGTCCTAATGCCGGG + Intergenic
1084573144 11:69971723-69971745 GCCACAGGCCTCCCCGGGCCTGG - Intergenic
1084936168 11:72587877-72587899 ACCCCAGCAGACCTCAGGCCCGG + Intronic
1085478041 11:76799894-76799916 ACTACAGGCGTCACCATGCCCGG - Intergenic
1086408013 11:86515884-86515906 AACACAGGAAGCCGCAGGCCAGG + Intronic
1087812363 11:102622360-102622382 CCCAGAGGAGTCCCAAGGACAGG - Intronic
1088820942 11:113457043-113457065 ACCATAGGAGCCACCAGGCTGGG + Intronic
1089122262 11:116145693-116145715 ACCACATCAGTACCCAGGTCTGG + Intergenic
1089272920 11:117314594-117314616 ACCACAGGGCTGCCCGGGCCCGG + Intronic
1089817944 11:121193311-121193333 ACAACAGAAAACCCCAGGCCAGG + Intergenic
1090388994 11:126375079-126375101 GCCAGAGGAGTCCGCAGCCCGGG + Intronic
1090392243 11:126396327-126396349 GCCAGAGGAGTCCGCAGCCCGGG + Intronic
1090473119 11:126997425-126997447 CCCGCCAGAGTCCCCAGGCCTGG - Intronic
1090834191 11:130441953-130441975 GTCAGAGGAGTCCCCAGGGCTGG + Intergenic
1090846398 11:130533322-130533344 TGCAAAGGAGGCCCCAGGCCAGG - Intergenic
1091178039 11:133579397-133579419 ACCTGAGGAGACCCCAGACCCGG + Intergenic
1093714089 12:22361888-22361910 AAGGCAGGAGTCCCCAGCCCCGG + Intronic
1095727573 12:45470078-45470100 ACCACAGATCTCCCCAGCCCCGG + Intergenic
1096687835 12:53300438-53300460 ACCAAAGGAGGTCCCAGGCCAGG - Intronic
1096693086 12:53333036-53333058 CCAACAGGAGACCCCAGCCCTGG + Intronic
1096981980 12:55733340-55733362 CACAAAGGAGTCTCCAGGCCAGG + Intergenic
1101229070 12:102721163-102721185 GCTACAGGAGTCTCCAGGTCTGG + Intergenic
1101507981 12:105364977-105364999 ACTACAGGCGTCACCATGCCTGG + Intronic
1102005277 12:109585792-109585814 ACCACGGGAGTCCAAAGCCCAGG + Intronic
1103440859 12:120961844-120961866 ACAACAGGAGTTTCCATGCCAGG + Intergenic
1103531983 12:121608789-121608811 ACCACAGGTGTCCTCAGGAGAGG + Intergenic
1103721442 12:122977691-122977713 CCCACAGGAGCCCCTAGCCCAGG - Intronic
1104765192 12:131325852-131325874 ACCCCAGGAGAGCCCAGGGCTGG - Intergenic
1104934213 12:132355902-132355924 ACCTCAGGAGTCCCTGGGCCTGG - Intergenic
1105702298 13:22942640-22942662 ACCAGAGGGTTCCCCAGGGCAGG - Intergenic
1105854917 13:24364424-24364446 ACCAGAGGGTTCCCCAGGGCAGG - Intergenic
1108431163 13:50355171-50355193 ACCACAGGGCTGCCCAGTCCTGG + Intronic
1108845137 13:54669289-54669311 AAGACAGGAGTCCCCAGCCCTGG + Intergenic
1109421192 13:62115136-62115158 GCCACAGGAGTCCCTACACCTGG - Intergenic
1111672393 13:91347857-91347879 ACGACCGGAGGCCCCAGGCCGGG - Intergenic
1113450848 13:110408224-110408246 GCCACAAGGGTCCCCAGGGCGGG + Intronic
1113599410 13:111558061-111558083 ACCCCTGGGGACCCCAGGCCTGG - Intergenic
1113683611 13:112262225-112262247 AAGACAGGAATCCCCAGTCCCGG - Intergenic
1113753215 13:112790743-112790765 ACCACAGGGGTCTACATGCCAGG - Intronic
1114992311 14:28301512-28301534 ACCTCAGTGGTCCCCAAGCCAGG + Intergenic
1117413027 14:55467968-55467990 ACCTCAGGGCTCCCCAAGCCAGG - Intergenic
1118056957 14:62088924-62088946 ACCACAGAAGTCCCTATGCATGG - Intronic
1118457529 14:65958444-65958466 ACCACAACTGTCCTCAGGCCTGG + Intronic
1119981959 14:79091715-79091737 ACCCCAGGAGACCCCAAGACAGG + Intronic
1120149766 14:81020270-81020292 AGAACAGGAGTCCCCAACCCTGG + Intronic
1120400260 14:84022530-84022552 ACCACAGGAAACCCCATTCCTGG - Intergenic
1120758752 14:88267775-88267797 ACCACTGGAGTTCTCATGCCTGG + Intronic
1121437867 14:93930800-93930822 ACTCCAGGATTCCCCTGGCCTGG + Intergenic
1121437874 14:93930813-93930835 TCCAGGGGACTCCCCAGGCCAGG - Intergenic
1122225823 14:100278706-100278728 ACCTCAGAACACCCCAGGCCAGG + Exonic
1122268044 14:100555840-100555862 GCCACGGGATTGCCCAGGCCTGG - Intronic
1122645120 14:103189120-103189142 CCCACAGAGCTCCCCAGGCCTGG + Intergenic
1122843806 14:104479714-104479736 ACCAGAGGGTTCCCCAGGGCAGG - Intronic
1122975873 14:105170503-105170525 CCCTCAGGAGCCCCCAGCCCGGG + Intergenic
1124373597 15:29116897-29116919 ATCATAAGTGTCCCCAGGCCTGG + Intronic
1124377258 15:29136080-29136102 AGCACTGGGTTCCCCAGGCCCGG + Intronic
1125754099 15:42050654-42050676 AACACATTAGTTCCCAGGCCAGG + Exonic
1125993154 15:44130066-44130088 ACCACAGGAATCACCAAGCAAGG - Intronic
1126104622 15:45139363-45139385 ACCACAGCAGTGTCCAGTCCAGG - Intronic
1126448996 15:48784898-48784920 ACCACGGGAGTCCTGAGTCCAGG + Intronic
1128424133 15:67521866-67521888 ACCAGAGTAGACCCCTGGCCTGG + Intronic
1129386183 15:75197322-75197344 ACCACAGGAGACTCCAAGCTAGG + Intronic
1129895849 15:79105315-79105337 ACCACAGCAGCCCCAAGGCAAGG - Intergenic
1130330587 15:82919066-82919088 GCCACAGGAGTCCCAGGGCTGGG + Intronic
1132050268 15:98601934-98601956 GCATCAGGAGTCCCCAAGCCTGG + Intergenic
1132585047 16:702449-702471 TCCTCAAGAGTCCTCAGGCCAGG - Intronic
1132667492 16:1088908-1088930 ACCACAGCAGCCCCGAAGCCAGG - Intergenic
1132713693 16:1280197-1280219 ACCAGGGTAGTCCCCATGCCTGG + Intergenic
1132926508 16:2432470-2432492 AACGCAGGAGTGTCCAGGCCAGG - Intronic
1133063537 16:3190325-3190347 ACCAGAGGAGGCCCCAGTCCTGG - Intergenic
1134771886 16:16816209-16816231 AACCCAGGAGTCCCAGGGCCCGG + Intergenic
1134811979 16:17175554-17175576 ACCACTGGAGCCCGCAGGCGTGG + Intronic
1136179121 16:28538856-28538878 CCCCCAGCAGCCCCCAGGCCCGG - Exonic
1138505454 16:57476075-57476097 ACCCCCGGTGTCCCCAGGCTGGG - Intronic
1139463519 16:67141630-67141652 ACCACAGCAGTCAGCATGCCTGG - Intronic
1139902384 16:70338416-70338438 ACCACAGGTGCCACCATGCCCGG + Intronic
1139959559 16:70709896-70709918 AGCCCAGGAGGCCCCAGGGCAGG - Intronic
1140862364 16:79029160-79029182 ACCTCTGGAGGCCCCAGGCTGGG + Intronic
1141648068 16:85378009-85378031 ACCACATGTGTTCCCAAGCCCGG - Intergenic
1141697249 16:85625922-85625944 GCCACAGGAGTCCCTACCCCAGG - Intronic
1141791576 16:86239696-86239718 AGGACAGCTGTCCCCAGGCCTGG - Intergenic
1142472043 17:170093-170115 ACCTCTCCAGTCCCCAGGCCTGG + Intronic
1143249762 17:5514564-5514586 GCCACAGGGGGCCCCAGTCCAGG - Intronic
1143633239 17:8150644-8150666 ACAAAATGATTCCCCAGGCCTGG + Exonic
1145197886 17:20911199-20911221 ACCACAGGTGCCACCATGCCTGG - Intergenic
1147721856 17:42544311-42544333 ATCACAGGATAACCCAGGCCTGG + Exonic
1148929882 17:51120076-51120098 ACCCCAGGTGTCCTCAGGCCAGG + Intronic
1152029387 17:77832291-77832313 AGCCCAGGGGTCCCCAGCCCCGG + Intergenic
1152303062 17:79506638-79506660 AGCACTCCAGTCCCCAGGCCTGG - Intronic
1152458481 17:80429407-80429429 ATCGCAGGAGGCCCCAGGCCTGG + Intronic
1153098478 18:1436783-1436805 ATCTCAGAAGTCCCCAGGGCTGG - Intergenic
1154193457 18:12249097-12249119 ACCACAGGGCTCACCAGCCCTGG + Intergenic
1155285262 18:24281797-24281819 ACAACAGGAGTCCCCAGACCCGG + Intronic
1155457768 18:26038633-26038655 ACCACAGCAGTACTCAGGCCAGG - Exonic
1160131204 18:76226347-76226369 ACCACAGGAGTCACCACTCCAGG + Intergenic
1160131323 18:76227317-76227339 ACCACAGGAGTCACCACTCCAGG + Intergenic
1160366383 18:78329484-78329506 AGCACAGGGGCCCCCAGCCCAGG - Intergenic
1160696051 19:484982-485004 CCCACAGCAGCCCCCAGCCCAGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG + Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161295278 19:3516593-3516615 GCCCCGGGAGGCCCCAGGCCCGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161428884 19:4219326-4219348 ACCACAGGTGCCACCATGCCTGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1162027891 19:7904528-7904550 ACCTCAGGTGTCCCCGAGCCAGG - Intronic
1162027976 19:7904873-7904895 GCCCCAGGTGTCCCCAGGTCAGG - Intronic
1162263078 19:9548072-9548094 ACCACAGGGGGGCTCAGGCCTGG - Intergenic
1162872946 19:13599767-13599789 TCCACAGCACCCCCCAGGCCAGG - Intronic
1163497322 19:17654553-17654575 AACACAGCTGTCCCCAGCCCAGG + Intronic
1163859999 19:19737875-19737897 AGCCCAGGAGCCCCCAGGCTGGG - Intergenic
1164547830 19:29183853-29183875 ACCACTGGCATCCCCAGTCCCGG + Intergenic
1164719468 19:30421824-30421846 ACGAGAGCAGGCCCCAGGCCAGG + Intronic
1165116381 19:33531396-33531418 ATCCCATGAGTCCCCTGGCCAGG - Intergenic
1167331415 19:48858881-48858903 CCCCCAGGAGTCCCCAGCACTGG - Exonic
926428228 2:12759301-12759323 ACCTCAGGTGTCCCCATGCATGG + Intergenic
926719786 2:15951355-15951377 AGCACAAGAGTGCCCAGGGCAGG - Intergenic
927167283 2:20336653-20336675 ACCACAGGTGCCACCAGGCCTGG + Intronic
928415119 2:31085528-31085550 AGCACATCAGTGCCCAGGCCAGG - Intronic
929921207 2:46172768-46172790 ACCACAAGGGTCCCCAGCACAGG - Intronic
931602322 2:64017196-64017218 ACTACAGGCGCCCCCACGCCTGG - Intronic
932366233 2:71155212-71155234 ACCACAGGTGCCCCAAGGGCTGG + Intergenic
933862390 2:86482951-86482973 ACCATAGGAATCACCAAGCCTGG - Intronic
936294071 2:111251870-111251892 ACCACAGAAGTCATCTGGCCTGG - Intergenic
938679475 2:133674808-133674830 ATCACTGGTTTCCCCAGGCCGGG + Intergenic
939084820 2:137707257-137707279 ACCTCAGGGCTCCCCAGGTCAGG - Intergenic
939801985 2:146721401-146721423 ACCTCAGGTCTCCCCAAGCCAGG + Intergenic
940754155 2:157662332-157662354 ACCACAGCAGTACTCAGGCCAGG + Intergenic
942182210 2:173390665-173390687 ACCAGAGCAGTGCCCAGCCCGGG - Intergenic
945081007 2:206085875-206085897 AGCAGAGGCGGCCCCAGGCCCGG - Intronic
945222553 2:207499886-207499908 AAAACAGGAGTCCTCAGTCCTGG + Intergenic
946286813 2:218710333-218710355 ACAACGGGAGCCCCCACGCCTGG - Intergenic
946355496 2:219182041-219182063 ACCAGAGGAGACCCTAAGCCGGG + Exonic
946661611 2:222007104-222007126 ACCTCAGGATTCCCAAGGCTTGG - Intergenic
947528528 2:230894064-230894086 TCCCCAGGCCTCCCCAGGCCAGG + Intergenic
948728987 2:239951797-239951819 GCCAGAGGGGTTCCCAGGCCTGG + Intronic
948793635 2:240391505-240391527 AGGACAGGAGTCCTCAGTCCTGG - Intergenic
1169384433 20:5136166-5136188 ACCACAGGACTAGCCAGGCATGG - Intronic
1170463234 20:16598942-16598964 ACTAAAGGAGTCCCCAGGCCGGG + Intergenic
1170566595 20:17611350-17611372 GCCAGAGCAGTCCTCAGGCCCGG - Intergenic
1171091792 20:22292389-22292411 ACCAAAGCATTCCCCAGGCTAGG + Intergenic
1171971228 20:31566448-31566470 CCCACTGGTGTCCACAGGCCAGG - Intronic
1172353191 20:34260021-34260043 GCCCCAGGAGACCCCAGGCCTGG - Intronic
1175225656 20:57442425-57442447 ACCACAGACATCCCCAGGCCGGG - Intergenic
1175366894 20:58461769-58461791 ACAGCAGGAGACCCAAGGCCCGG - Intronic
1175403031 20:58711322-58711344 ACCACAGGAGGCCTCAGCACAGG + Intronic
1175408774 20:58752471-58752493 CCCACAGGGATACCCAGGCCTGG + Intergenic
1176074861 20:63243810-63243832 ACCCCTGGAGCCCCCAGGCTAGG + Intronic
1176257346 20:64159216-64159238 GCCACAGGAGACTCCAGGGCTGG - Intronic
1176380762 21:6111223-6111245 GCCACCGGAGCGCCCAGGCCAGG - Exonic
1176410288 21:6446125-6446147 GCCCCATGAGCCCCCAGGCCAGG + Intergenic
1176943301 21:14949990-14950012 ACCAAGGCAGTCCCAAGGCCTGG + Intergenic
1177993879 21:28072017-28072039 ACAACAGGGGTCTCCAGTCCTGG - Intergenic
1178880506 21:36446548-36446570 ACAACAGAAGTCTCCAGGCCAGG - Intergenic
1178906586 21:36642035-36642057 GCCCCAGGAGTCCACAGGCAGGG - Intergenic
1179685781 21:43054447-43054469 GCCCCATGAGCCCCCAGGCCAGG + Intronic
1179742710 21:43427017-43427039 GCCACCGGAGCGCCCAGGCCAGG + Exonic
1179841428 21:44077444-44077466 ACTACAGGCGCCACCAGGCCCGG - Intronic
1179884170 21:44306419-44306441 ATCTCAGGAGGCACCAGGCCAGG - Intronic
1179986923 21:44927366-44927388 ACCCCAGGGGTCTCCAGGGCTGG - Intronic
1179991842 21:44952446-44952468 GCCCCGGGAATCCCCAGGCCAGG - Intronic
1180125640 21:45788337-45788359 AGGACAGGCGGCCCCAGGCCGGG + Intronic
1181314321 22:21961858-21961880 GCCTCACAAGTCCCCAGGCCTGG - Intronic
1181604236 22:23970812-23970834 AGCCCAGGGGTCCCCAGGCTGGG - Intronic
1181989415 22:26825884-26825906 TCCACAAGACTCCCCAGCCCTGG + Intergenic
1182068415 22:27446174-27446196 TCCCCAGGAGGCTCCAGGCCAGG + Intergenic
1183744159 22:39683852-39683874 CCCACAGTAGCCCCCAGGCCTGG + Intronic
1183916809 22:41127517-41127539 GCAACTGGAGTCACCAGGCCTGG - Exonic
1183948452 22:41339760-41339782 AAAACAGGACTGCCCAGGCCTGG - Intronic
1184520595 22:44991664-44991686 ACCACAGGAGCCCCCCAGCTGGG - Intronic
1184531957 22:45061882-45061904 ACCACAGGATTCCCCAGCTCCGG - Intergenic
1184569048 22:45310482-45310504 TCCTCAGAAGCCCCCAGGCCCGG + Intronic
1184643611 22:45884784-45884806 ACCACTGCAGTCCCCAGGCTGGG - Intergenic
1184826084 22:46952234-46952256 TCCACAGGAATGCCAAGGCCAGG - Intronic
1184898076 22:47423984-47424006 AGCAGAGAAGTCTCCAGGCCTGG - Intergenic
1185028361 22:48428204-48428226 ATCACAGGACCCCACAGGCCTGG - Intergenic
1185222645 22:49636667-49636689 CCCATAGGAGTGCCCGGGCCTGG + Intronic
1185349894 22:50329448-50329470 ACCACAAGAATACCCAGGCACGG - Intergenic
950377192 3:12581452-12581474 CCCAGAGGAGTGACCAGGCCTGG + Intronic
950399590 3:12759945-12759967 ACCACGGGAGCCCCCAGCCTTGG + Intronic
950448203 3:13050274-13050296 AGCACAGCAGTGCACAGGCCAGG + Intronic
952777851 3:37063486-37063508 AACACAGCAGTCCCCTGCCCTGG - Intronic
953251255 3:41247280-41247302 CCCACTGAAGGCCCCAGGCCTGG - Intronic
954179385 3:48869672-48869694 ACTACAGGTGTCACCCGGCCTGG - Intronic
954280955 3:49577450-49577472 AGGCCAGGAGTTCCCAGGCCAGG + Intronic
954697588 3:52435866-52435888 GCCAGAGGAGCCCCCAGCCCGGG - Exonic
954699524 3:52443974-52443996 AACACAGGAACCCCCAGGCTGGG + Intronic
955771131 3:62385689-62385711 TCTCCAGGAGTCCACAGGCCAGG - Intergenic
956823785 3:72978201-72978223 ACCACAGGCGCCACCACGCCCGG - Intronic
956860087 3:73314365-73314387 ACCACAGCAGGCACCAGTCCAGG - Intergenic
958972039 3:100622155-100622177 AGTACAGGGGTCCCCAGCCCCGG - Intronic
960940066 3:122927750-122927772 ACCAGGGGAGTCCCCACCCCTGG + Intronic
968222156 3:196947449-196947471 TCCACTGGTGCCCCCAGGCCTGG + Exonic
968446514 4:655004-655026 ACCACAGGTGGGGCCAGGCCAGG - Intronic
968751847 4:2394143-2394165 ACCACAGGAGTCCTCAGTAGTGG - Intronic
969589930 4:8115979-8116001 ACCACAGAAGTCCCCACGGATGG + Intronic
971157355 4:24097317-24097339 AGCCAAGGAGTCCCCAGGCATGG + Intergenic
972482856 4:39514499-39514521 ACCACAGGAGCCATGAGGCCTGG + Intronic
976194793 4:82522190-82522212 ACCAGAGGACTCCCAAGGCAGGG - Intronic
979479576 4:121200546-121200568 ACCACAGGAGCCCACTGGTCAGG - Intronic
980608630 4:135126538-135126560 ACCACAGGCATCCCCATACCCGG - Intergenic
981581789 4:146256728-146256750 ACCATACGAGTAGCCAGGCCAGG - Intronic
984556442 4:181219496-181219518 ACTACAGGAGCCACCACGCCTGG - Intergenic
985564577 5:608946-608968 AAGACAGGAGTCCCCAGACCTGG - Intergenic
985722155 5:1495016-1495038 ACCACAGGAAGCCCGTGGCCTGG - Intronic
986158574 5:5201702-5201724 ACCCAAGAAGTCCCCAGGCTAGG + Intronic
987344636 5:16968219-16968241 ACTACAGGAGCCACCACGCCTGG - Intergenic
987441899 5:17967063-17967085 ACCTCAGGGCTCCCCAAGCCAGG - Intergenic
987675047 5:21063487-21063509 ACAACTGGAGTCCCCACCCCAGG - Intergenic
990370466 5:55113375-55113397 ACCTCTGGAGTCCTCAGCCCAGG - Exonic
992688927 5:79224358-79224380 ACCAGTTGAGTCACCAGGCCAGG + Intronic
995627806 5:114098330-114098352 ACCACAGGGGTCCCCACTGCTGG + Intergenic
995916097 5:117246644-117246666 AACACAGGAGGCTCCAGGCTGGG - Intergenic
997356512 5:133266195-133266217 CCCACAGGGGCCCCCACGCCTGG - Intronic
997608079 5:135191201-135191223 ACCCCCGCAGACCCCAGGCCAGG - Intronic
998205728 5:140155637-140155659 ATCACAGCATTCCCCAGGGCTGG + Intergenic
998583289 5:143402989-143403011 TCCGCAGGCGTCCCCTGGCCGGG - Intronic
999720824 5:154398189-154398211 ACCGCAGGAGTTCCCAGCACAGG - Intronic
1000244970 5:159441732-159441754 GACACAGAAGCCCCCAGGCCTGG + Intergenic
1000328334 5:160188591-160188613 AACGGAGGAGACCCCAGGCCCGG + Intronic
1000349904 5:160345074-160345096 TCCACAGCTGTCCTCAGGCCGGG - Intronic
1002533298 5:179862372-179862394 ACCGCAGGGGGCCCCAGGGCTGG - Exonic
1005812870 6:29530022-29530044 TGCATAGGAGACCCCAGGCCAGG + Intergenic
1007094377 6:39204399-39204421 ACTACTGGAGTCCCCCTGCCTGG + Intronic
1007170192 6:39857214-39857236 ACCAAGGGAGGTCCCAGGCCTGG + Intronic
1011752590 6:90468334-90468356 ACGACAGGGGTCCCCAACCCCGG + Intergenic
1011822552 6:91270956-91270978 ACCTCAGGGCCCCCCAGGCCAGG - Intergenic
1014790421 6:125666066-125666088 ACCAAATGTGTCCCCAGTCCAGG + Intergenic
1015906597 6:138123443-138123465 GACACAGGAGGCCCCTGGCCTGG - Intergenic
1017945373 6:159092607-159092629 ACCACAGGGGTCTCCAAGCCTGG - Intergenic
1018151597 6:160944951-160944973 GCCACAGGAGTCCACATGCAGGG + Intergenic
1018901093 6:168052128-168052150 ACCACAGGCGCCACCATGCCCGG + Intergenic
1018986221 6:168639054-168639076 ACCATAGGATTCCACAGGCTTGG + Intronic
1019322035 7:420200-420222 ACCCCTGGTGGCCCCAGGCCTGG + Intergenic
1019645442 7:2126413-2126435 ACCACTGGAGGCCCCCAGCCTGG + Intronic
1019689778 7:2404021-2404043 CCCCCAGGAGTCCCCCTGCCCGG + Intronic
1019703693 7:2487582-2487604 CCCACACCACTCCCCAGGCCTGG - Intergenic
1019706754 7:2500440-2500462 ACCACTGGAGTTCCCAGAGCGGG - Intergenic
1019708519 7:2507782-2507804 CCTAGAGGAGTCACCAGGCCTGG + Intergenic
1023818312 7:43966431-43966453 GCCACTGGACTCCCCAGGCTGGG + Intergenic
1024609768 7:51054569-51054591 CCCACAGCAGTCCCCAGTGCAGG - Intronic
1024728741 7:52231059-52231081 AATACAGGAGTCCCCAACCCTGG - Intergenic
1024927911 7:54637225-54637247 CCCACATGAGTCCCCAGCCCTGG + Intergenic
1025157986 7:56627476-56627498 ACCCCAGGAGTCTCCAATCCAGG + Intergenic
1025260610 7:57415180-57415202 TGCACAAGAGACCCCAGGCCAGG - Intergenic
1025607062 7:63047185-63047207 ACCCCAGGACTCTCTAGGCCTGG + Intergenic
1025757737 7:64360571-64360593 ACCCCAGGAGTCTCCAACCCAGG - Intergenic
1027895764 7:84042408-84042430 ACCACATGGATCCCAAGGCCTGG - Intronic
1029174670 7:98656101-98656123 AACCCAGGAGTGTCCAGGCCTGG - Intergenic
1029742942 7:102501263-102501285 GCCACTGGACTCCCCAGGCTGGG + Intronic
1029760932 7:102600424-102600446 GCCACTGGACTCCCCAGGCTGGG + Intronic
1032059992 7:128716248-128716270 ACCAGAGGAGAGCCCAGGCAAGG - Intronic
1032391341 7:131556866-131556888 ACCGCAGGAGCCCCCCGCCCTGG - Intronic
1033363679 7:140655680-140655702 GTCACAGGTCTCCCCAGGCCCGG - Intronic
1034424501 7:151007458-151007480 ACCACAGGGGTGCCTAGCCCAGG + Intronic
1034528543 7:151681348-151681370 CCCACAGGAGTCACCAGCTCTGG - Intronic
1034552550 7:151830683-151830705 CCCGCAGGAGGCCTCAGGCCAGG - Intronic
1034756220 7:153622923-153622945 ATCAAAGGAGACCCCAGGCCTGG - Intergenic
1034818201 7:154192859-154192881 GCCAGAGAAGACCCCAGGCCAGG + Intronic
1035287416 7:157815178-157815200 CCCACAGCAGCACCCAGGCCAGG - Intronic
1035567266 8:649915-649937 AGCACACGCTTCCCCAGGCCCGG - Intronic
1038356229 8:26831869-26831891 AGCACAGGACTCCACAGGGCAGG - Intronic
1038367292 8:26948849-26948871 ACCACAGGAATCCACAGGGAGGG - Intergenic
1039745533 8:40422811-40422833 ACCACAGGGAGCCCCAGGCAGGG + Intergenic
1040290550 8:46121913-46121935 ATCACAGAAGCCCCCAGGGCTGG - Intergenic
1040580834 8:48697406-48697428 ACCCCAGGATACCTCAGGCCTGG + Intergenic
1042625193 8:70749352-70749374 ACCTCAGGGCTCCCCAAGCCAGG + Intronic
1043666914 8:82826011-82826033 ACATCAGGACTCCCCAGGCCAGG + Intergenic
1045023576 8:98064755-98064777 CCCACCCGAGTCCCCAGCCCGGG - Intronic
1046026808 8:108734246-108734268 ACCACTGGAGTCCACAGGCTGGG - Intronic
1047247540 8:123158416-123158438 TCCCCAGGGGTCCCCACGCCTGG - Intergenic
1048669053 8:136695901-136695923 ACAGCAGGGGACCCCAGGCCAGG - Intergenic
1049025777 8:139987907-139987929 GCCTCAGGAGACCCCTGGCCCGG - Intronic
1049254495 8:141606460-141606482 ACCCCTGGAGTCCACAGGGCAGG + Intergenic
1049527170 8:143133241-143133263 GCCACAGGGGTCCCCAGTGCTGG - Intergenic
1049601500 8:143509817-143509839 AGTACAGGAGCCCCCAGACCTGG + Intronic
1049676217 8:143890460-143890482 CCCACAGGAGGTTCCAGGCCTGG - Intergenic
1052339261 9:27349280-27349302 ACCACACAAGTCCCTAGGCTAGG + Intronic
1052881292 9:33602314-33602336 GCCACAGGGGTCCCCAGGGAGGG - Intergenic
1053279154 9:36806127-36806149 CCCACAGGAGGCCACAGGGCCGG + Intergenic
1053495026 9:38543528-38543550 GCCACAGGGGTCCCCAGGGAGGG + Intronic
1055987058 9:82063007-82063029 ACCAGAGGAGACACCGGGCCTGG + Intergenic
1057359504 9:94360318-94360340 ACAACAGGAGTCACCTGGACAGG + Intergenic
1057648259 9:96897274-96897296 ACAACAGGAGTCACCTGGACAGG - Intergenic
1057801946 9:98196148-98196170 TCCCCAGGAGGCCACAGGCCAGG + Intergenic
1060158079 9:121334173-121334195 CCCACATGTGTCCCAAGGCCAGG - Intergenic
1060739481 9:126088871-126088893 AGCACAGCAGTACACAGGCCAGG - Intergenic
1060829958 9:126707223-126707245 ACCAGAGGAGACCCCACACCAGG - Intergenic
1061191299 9:129084245-129084267 ACCTCTGGAGTCACCAGGCCGGG + Intronic
1061908035 9:133708744-133708766 ACCCCAGGACTCCCCAGCACTGG - Intronic
1062028082 9:134349735-134349757 TGCACAGGATTCCCCAGGGCTGG + Intronic
1062300331 9:135863825-135863847 ACCACAGCATGCGCCAGGCCAGG + Intronic
1062652268 9:137584060-137584082 ATCACAGGAGGCCACAGACCAGG + Intronic
1187141984 X:16602466-16602488 ACCTGATGAGTCCCCAGGTCAGG + Intronic
1187522920 X:20029224-20029246 ACCACAAGGGTCTCCAGGGCTGG + Intronic
1189341780 X:40210012-40210034 AACACAAAAGTGCCCAGGCCTGG + Intergenic
1189755601 X:44268504-44268526 GTCACAGGACACCCCAGGCCTGG - Intronic
1191864432 X:65692266-65692288 ACAATAGGAGGCCCCAGGCCAGG - Intronic
1200898770 Y:8406109-8406131 ACCCCAGGAGTCTCCAGTCTAGG + Intergenic