ID: 915579911

View in Genome Browser
Species Human (GRCh38)
Location 1:156807376-156807398
Sequence CCTAGGAGGCAGAGGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1269
Summary {0: 1, 1: 0, 2: 5, 3: 99, 4: 1164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915579911_915579918 19 Left 915579911 1:156807376-156807398 CCCTCTACCCTCTGCCTCCTAGG 0: 1
1: 0
2: 5
3: 99
4: 1164
Right 915579918 1:156807418-156807440 CATCTGATCTGAACAGACTTTGG 0: 1
1: 0
2: 1
3: 5
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915579911 Original CRISPR CCTAGGAGGCAGAGGGTAGA GGG (reversed) Intronic
900298078 1:1962398-1962420 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
900310818 1:2032428-2032450 CCCAGGAAGCAGAGGGTAGGAGG - Intergenic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900652407 1:3736350-3736372 CCTCCGAGGCACAGGGCAGAGGG - Intergenic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
900822402 1:4899665-4899687 CCTGGGAGGCAGAGTGAGGAGGG - Intergenic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
901029214 1:6297112-6297134 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
901042996 1:6376818-6376840 CCTGGGAGGCAGAGCGAACATGG + Intronic
901115508 1:6840716-6840738 CCTGGGATGCAGAAGATAGATGG + Intronic
901133521 1:6978018-6978040 ACGTGGAGGTAGAGGGTAGAAGG + Intronic
901167497 1:7230627-7230649 CCAAGGAGGTGGAGGGTGGAGGG + Intronic
901254165 1:7806684-7806706 CTTAGGAGGCTGAGGCAAGAGGG + Intronic
901351054 1:8597194-8597216 CTTAGGAGGCTGAGGCCAGAGGG - Intronic
901367746 1:8767888-8767910 CCTAGGAGGCGGAGGTTGCAGGG + Intronic
901459652 1:9383996-9384018 CCTGGGAGGCAGAGGCTGAAAGG - Intergenic
901486028 1:9562438-9562460 CCCAGGAGGCAGAGGTTGTATGG + Intronic
901520875 1:9783915-9783937 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
901694605 1:10997498-10997520 CCTAGGAGGGGGAGGGGAGAGGG + Intergenic
901735194 1:11307985-11308007 GACAGGAGGCAGAGGGAAGAGGG - Intergenic
901756493 1:11444552-11444574 CCAAGGAGGCAGAGAGAGGAAGG - Intergenic
902241635 1:15094087-15094109 CCCGGGAGGCAGAGGGTGGTGGG - Intronic
902645968 1:17798135-17798157 CCTAGAAGGCAGAGGTCATATGG + Intronic
902669785 1:17965055-17965077 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
902891075 1:19444080-19444102 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
903013114 1:20344125-20344147 ACTCGGAGGCAGGGGGAAGAGGG - Intronic
903221291 1:21870964-21870986 CCCAGAAGGGAGAGGGGAGAAGG + Intronic
903397730 1:23014916-23014938 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
903501249 1:23801057-23801079 CCGAGGGGGCAGGGGGCAGAGGG + Intergenic
903602402 1:24552233-24552255 CTAAGTAGGCAGAGAGTAGAGGG - Intergenic
903620146 1:24692199-24692221 CCCGGGAGGCAGAGGTTACAAGG + Intergenic
903749601 1:25612814-25612836 CCTGGGAGGTAGAGGCTACAGGG - Intergenic
903789562 1:25883309-25883331 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
903939187 1:26917180-26917202 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
904403185 1:30270173-30270195 CCAAGGAGGAAGAGGGTGGAAGG + Intergenic
904492967 1:30871634-30871656 CCTGCCAGGCAGAGGGCAGAGGG + Intronic
904496542 1:30890229-30890251 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
904525869 1:31133422-31133444 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
904584738 1:31573962-31573984 ACTAGGAGGCAAAGGGTCAAAGG + Intergenic
904585158 1:31576085-31576107 CCTAGGGGGCACAGTGGAGAGGG + Intergenic
904624474 1:31794235-31794257 CCTGGGAGGCAGAAGACAGAGGG + Exonic
904690119 1:32287525-32287547 CCCAGGAGGCAGAGGCTGCAGGG - Intergenic
904724185 1:32534478-32534500 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
904864827 1:33570241-33570263 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
905007458 1:34721333-34721355 GCTGGAAGGCAGAGGCTAGAGGG - Intronic
905045145 1:34991692-34991714 CCCAGGAGGCAGAGGTTATAGGG + Intronic
905046528 1:35007727-35007749 CCCAGGAGGCAGAGGCTACAGGG + Intronic
905557436 1:38898226-38898248 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
905577886 1:39060469-39060491 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
905991963 1:42345594-42345616 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
906438342 1:45816751-45816773 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
906871412 1:49485780-49485802 CTCAGGAGACAGAGGATAGAAGG + Intronic
906982139 1:50642914-50642936 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
907451440 1:54548110-54548132 CCTAGGAGAAGGGGGGTAGAGGG + Intronic
907462120 1:54611322-54611344 CCCAGGAGGCGGAGGTTACAGGG + Intronic
907569386 1:55468801-55468823 CCTAGGGGGTAGAGAGAAGAAGG + Intergenic
907716997 1:56935194-56935216 CCTAGGAGGGAGACTGTAAATGG - Intronic
908204549 1:61832170-61832192 ACTTGGGGGTAGAGGGTAGAAGG + Intronic
908263978 1:62360737-62360759 CCTAGGAGGCAGAGTTTGCAGGG + Intergenic
908304653 1:62799952-62799974 CCATGGAGGCAGAGAGTGGAAGG - Intronic
908733084 1:67247378-67247400 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
908746521 1:67381908-67381930 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
908748107 1:67395190-67395212 CCTGGGAGGCGGAGGTTACAGGG + Intronic
910568508 1:88674581-88674603 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
910572794 1:88724645-88724667 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
910925823 1:92397312-92397334 CCCAGGAGGCAGAGGTTGTAGGG + Exonic
911615302 1:100004407-100004429 CTTGGGAGGCTGAGGGAAGATGG - Intronic
911623579 1:100094788-100094810 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
912220767 1:107672191-107672213 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
912424868 1:109578392-109578414 CCCAGGAGGCGGAGGTTACAAGG + Intronic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
912818921 1:112851257-112851279 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
912904385 1:113688418-113688440 CCTAGGAGGCGGAGGTTGCAGGG + Intergenic
912908143 1:113729232-113729254 TCAAGGAGACAGAGAGTAGAAGG + Intronic
912965865 1:114236882-114236904 CCTGGGAGGCAGAGGTTGAAGGG + Intergenic
913285628 1:117224059-117224081 CCTGGGAGGCAGAGGTTGTAGGG + Intergenic
914390554 1:147218309-147218331 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
914726756 1:150334435-150334457 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
914893330 1:151648128-151648150 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
915012249 1:152698406-152698428 CCTGGGAGCCAGAGGGCACAGGG + Intronic
915119930 1:153623459-153623481 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
915183139 1:154080607-154080629 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
915335398 1:155138038-155138060 ACCAGGAGGCAGAGGTGAGAAGG - Exonic
915372525 1:155363349-155363371 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
915480756 1:156183207-156183229 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
915579911 1:156807376-156807398 CCTAGGAGGCAGAGGGTAGAGGG - Intronic
915617896 1:157055287-157055309 CCTAGGAGGCAGCGGTTGCAGGG - Intergenic
916158081 1:161878187-161878209 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
916830123 1:168482275-168482297 CATGGCAGGCTGAGGGTAGATGG + Intergenic
917513590 1:175688565-175688587 CCCAGGAAGCAGAGGGCAGTGGG + Intronic
917881669 1:179343298-179343320 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
918082139 1:181215903-181215925 CCAAGGAGGCAGAGGTTGCAGGG - Intergenic
918292248 1:183120059-183120081 CCTCGGAGGCTGAGGGCAGGAGG + Intronic
919153075 1:193724769-193724791 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
919364464 1:196639494-196639516 CCCAGGAGGCAGAGGTTCCAGGG + Intergenic
919775943 1:201194101-201194123 CCCAGGAGGAAGAAGGTGGAAGG + Intronic
920320456 1:205117883-205117905 CCTGTGAGGCAGAGGTTGGAGGG - Intronic
920384801 1:205563573-205563595 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
920401370 1:205678918-205678940 CCCAGGAGGCCCAGGCTAGACGG - Intronic
920492022 1:206423848-206423870 CCTAGGAGGTGGAGGTTACAGGG - Intronic
920667963 1:207980191-207980213 CCTTGGAGGCAGAGGTTGCAGGG - Intergenic
920993352 1:210961762-210961784 CCTGGGAGGCAGAGGTTACAGGG + Intronic
921567305 1:216735900-216735922 CCTAGGAAGCAGAGGTTGCAGGG + Intronic
921649832 1:217664363-217664385 CCTGGGAGGCAGAGGTTGTAGGG - Intronic
922204187 1:223432244-223432266 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
922239249 1:223744783-223744805 CCTGGGAGGCAGAGGTTGGGAGG + Intronic
922297650 1:224265426-224265448 CCCAGGAGGCAGAGGTTGCAAGG + Intronic
922449207 1:225723112-225723134 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
922449918 1:225728730-225728752 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
922512669 1:226182536-226182558 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
923302247 1:232652039-232652061 CCCAGGAGGCAGAGGTTGCATGG + Intergenic
923659673 1:235947159-235947181 CCTGGGAGGCTGAGGTGAGAGGG + Intergenic
923677230 1:236090477-236090499 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
923695412 1:236245095-236245117 CTTGGGAGGCTGAGGATAGAAGG - Intronic
923855800 1:237844096-237844118 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
924051517 1:240084290-240084312 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
924294917 1:242576986-242577008 CTTAGGAGGCAGTGTGCAGAGGG + Intergenic
924870574 1:248039494-248039516 CCCAGGAGGCAGAGGTTATGGGG - Intronic
1062772505 10:114029-114051 CCTGGGAGGCAGAGGTTGCAAGG + Intergenic
1062836971 10:641945-641967 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1063097313 10:2919741-2919763 CCTAAGGGGCAGAGAGCAGAGGG - Intergenic
1063165678 10:3459696-3459718 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1063576992 10:7271210-7271232 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1063667909 10:8076348-8076370 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1063996729 10:11626699-11626721 CCTGGGAGGCAGAGGTTTCAGGG + Intergenic
1064143733 10:12810961-12810983 CCCAGGGGGCTGAGGGGAGAGGG + Intronic
1064435999 10:15311675-15311697 CCTGGGAGGCATAGAGTAGGAGG + Intronic
1064764498 10:18657687-18657709 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1064906623 10:20353505-20353527 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1065048072 10:21761981-21762003 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1065387253 10:25146112-25146134 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1065476134 10:26139814-26139836 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1065551397 10:26871573-26871595 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1065574527 10:27104322-27104344 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1065579535 10:27156573-27156595 CCCAGGAGGCAGAGGCTGCAGGG - Intronic
1065850586 10:29784226-29784248 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1066084374 10:31962243-31962265 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1066167839 10:32807804-32807826 CCCAGGAGGCAGAGGAAAAAAGG - Intronic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066558296 10:36639989-36640011 CCAAGGAGGCTGAGGTGAGAGGG - Intergenic
1066656111 10:37701201-37701223 CCTGTGAGGCAGAGGGTGGGGGG - Intergenic
1066994856 10:42554189-42554211 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1067003168 10:42636742-42636764 CCCAGGAGGCAGAGGTTGCAAGG + Intronic
1067097574 10:43312544-43312566 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1067395754 10:45915398-45915420 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1067523642 10:47026010-47026032 GCAGGGAGGCAGAGGGCAGATGG - Intergenic
1067864075 10:49884521-49884543 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1068009168 10:51426203-51426225 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1068095953 10:52491613-52491635 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1068196626 10:53725999-53726021 AATGGGAGGCAGAGAGTAGAGGG + Intergenic
1068427921 10:56891740-56891762 CCTGGGAGGCAGAGGTTGGGAGG - Intergenic
1068593205 10:58872051-58872073 GCTAGGAGGTAGGAGGTAGAGGG - Intergenic
1068871313 10:61948440-61948462 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1068888099 10:62118134-62118156 CCTGGGAGGCAGAGGTTTCAGGG + Intergenic
1069071272 10:63992572-63992594 CCATGGAGGCAGATGGTTGAGGG + Intergenic
1069477816 10:68751101-68751123 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1069521550 10:69124963-69124985 CCTATGAGGCAGAGGAGGGAGGG + Intronic
1070004454 10:72409613-72409635 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1070055130 10:72927213-72927235 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1070302377 10:75213152-75213174 CCCAGGAGGCAGAGGCTGCAGGG - Intronic
1070310974 10:75273595-75273617 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1070461408 10:76674102-76674124 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1071123977 10:82313259-82313281 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1071488993 10:86123251-86123273 CCTAGGGAACAGAGGGCAGAGGG + Intronic
1071606728 10:86998822-86998844 CCTGCGAGGCAGAGGGTGCAGGG + Intergenic
1072125196 10:92439384-92439406 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1072262326 10:93691281-93691303 CTTGGGAGGCTGAGGTTAGAAGG - Intronic
1072305903 10:94106982-94107004 CCAAGGAAGCAGAGGGGAGAGGG - Intronic
1072634082 10:97166010-97166032 CCAAGGAGACAGATGGCAGAGGG - Intronic
1073615753 10:104993053-104993075 CCTAGAAGTCACAGGGGAGAGGG + Intronic
1073739156 10:106386300-106386322 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1073849976 10:107603429-107603451 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1074053452 10:109900546-109900568 CCTTGCAGGCAGGTGGTAGAGGG - Intronic
1074370978 10:112900646-112900668 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1074519552 10:114206687-114206709 CCAGGGAGGCAGAGGTTACAGGG - Intronic
1074519790 10:114208847-114208869 CCTAGGAGGCGGAGGTTGCAGGG - Intronic
1074578208 10:114690755-114690777 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1075033619 10:119043833-119043855 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1075287151 10:121196652-121196674 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1075687061 10:124371555-124371577 CCCAGGAAGCACAGGGAAGATGG + Intergenic
1075767708 10:124907473-124907495 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1076106457 10:127827407-127827429 CCAGAGAGGCTGAGGGTAGAGGG + Intergenic
1076226783 10:128783215-128783237 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1076284680 10:129282000-129282022 CATAGGAGGGAGAGGGTAGAGGG - Intergenic
1076292234 10:129354690-129354712 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1076987053 11:245486-245508 TTTAGGAGGCAGAAGGAAGATGG - Intronic
1077066891 11:645085-645107 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1077581058 11:3417605-3417627 CCCAGGAGGCAGAGGTTTCAGGG + Intergenic
1077609899 11:3637594-3637616 CCTAGGAGGGTGAGGGTGGGGGG + Intergenic
1077669987 11:4148333-4148355 CCTGGGAGGCTGAGGCAAGAGGG - Intergenic
1078072143 11:8121638-8121660 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1078201093 11:9183973-9183995 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1078280341 11:9894606-9894628 CCCAGGAGGCAGAGGCTGTAGGG + Intronic
1078541559 11:12217508-12217530 TCTGTGAGGCAGAGGGAAGAAGG - Intronic
1078704293 11:13724472-13724494 CCTAGGAGGCAGAGGTTGCAGGG + Intronic
1079201909 11:18383802-18383824 CCCAGGAGTCAGAGACTAGAGGG + Intergenic
1079427140 11:20354396-20354418 GAAAGGAGGAAGAGGGTAGATGG - Intergenic
1080269122 11:30432091-30432113 CCCAGGAGGCAGAGGTTTCAAGG + Intronic
1080678814 11:34453937-34453959 CCTTTGGGGCAGAGGGTACAAGG + Intronic
1081242817 11:40727965-40727987 CCCAGGAGGCAGAGGTTTCAGGG + Intronic
1081499421 11:43651654-43651676 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1081538727 11:44014751-44014773 CCTAGGAGTAGGAGGGGAGAAGG + Intergenic
1081947435 11:47009719-47009741 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1081976738 11:47240082-47240104 CCTAGGAGGTGGAGGGAAGGGGG + Exonic
1082030306 11:47598840-47598862 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1082116073 11:48329567-48329589 ACTAGAAGGTAGAGGGTGGAAGG + Intergenic
1083648032 11:64184409-64184431 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1083673894 11:64314979-64315001 CCTAGGGGGCAGCGGGGAGCGGG - Exonic
1083811608 11:65109677-65109699 CCAAGGAGGCAGAGGACAGAGGG - Intronic
1084059833 11:66664224-66664246 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1084222138 11:67688866-67688888 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1084237984 11:67800439-67800461 CCCAGGAGGCAGAGGTTTCAGGG + Intergenic
1084394147 11:68897894-68897916 CCTGGGAGACAGAAGCTAGAGGG - Intronic
1084810668 11:71609102-71609124 CCTAAGAGCCAGGGGGGAGAGGG + Intergenic
1084834423 11:71792395-71792417 CCCAGGAGGCAGAGGTTTCAGGG - Intronic
1084838269 11:71822273-71822295 CCCAGGAGGCAGAGATTACAGGG + Intergenic
1084868155 11:72076707-72076729 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1084946829 11:72642889-72642911 CCTAGGAGGCAGGGGGAAGTCGG + Intronic
1084954193 11:72682915-72682937 GCTGGGGGGCAGAGGGGAGAGGG - Intergenic
1085359350 11:75872462-75872484 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1085403375 11:76247592-76247614 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1085422119 11:76371886-76371908 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1085465748 11:76722189-76722211 GCCAGGAGGCAGAGGGGTGAGGG - Intergenic
1085616345 11:78002282-78002304 CCTAGGAGGCAGAGGTTACAGGG - Intergenic
1085707734 11:78801695-78801717 CCTAGGAGGCAGCAGGCAGCAGG + Intronic
1085741410 11:79080910-79080932 ACTAGGAAGCAGAGGGAAGAGGG + Intronic
1085958878 11:81435774-81435796 CCTAGGAAGCAGAGGTTGCAGGG - Intergenic
1086044392 11:82516187-82516209 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1086303021 11:85450049-85450071 CCCAGGAGGCAGAGGTTGCATGG + Intronic
1086476296 11:87178499-87178521 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1086694834 11:89830721-89830743 GGTAGAAGGCAGAGGGTATAGGG + Intergenic
1086711314 11:90013776-90013798 GGTAGAAGGCAGAGGGTATAGGG - Intergenic
1086723396 11:90149508-90149530 CCTCGGAGGCAGAGGTTGCAGGG - Intronic
1087028216 11:93673567-93673589 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1087177878 11:95111661-95111683 CATAGGAGGCAGAGCTTAGACGG + Intronic
1087533758 11:99416738-99416760 GCAAGGAGGCAGAGGCTGGAGGG + Intronic
1087940156 11:104087099-104087121 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1088303565 11:108384695-108384717 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1088886330 11:114010385-114010407 CCCAGGAGGCTGAGGCTACAGGG - Intergenic
1088935057 11:114391094-114391116 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1089223759 11:116897805-116897827 CCTGGGAGGCAGAGATTACAGGG + Intronic
1089381599 11:118036675-118036697 CCATGGGGGCAGAGGGTAGCAGG + Intergenic
1089431986 11:118432903-118432925 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1089482917 11:118821520-118821542 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1089494810 11:118902639-118902661 TCCAGGAGGCAGAGGGTTGTTGG + Exonic
1089504920 11:118956599-118956621 CCTAGGAGGCAGAGAGGTGTGGG + Intronic
1089740753 11:120580642-120580664 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1089877488 11:121739566-121739588 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1090288970 11:125525182-125525204 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1090439080 11:126711484-126711506 CCCAGGAGGCAGAGGTTGCATGG + Intronic
1090675064 11:128984297-128984319 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1090816506 11:130301586-130301608 CCTAGGAGGCAGAGACTTCAGGG + Intronic
1091306525 11:134539802-134539824 CCTAGGAGGGTGAGAGTGGAAGG + Intergenic
1092132436 12:6121853-6121875 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1092998247 12:13971481-13971503 CAGAGGAGGAAGAGGGTAGGAGG - Intronic
1093107327 12:15104360-15104382 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1093166212 12:15806812-15806834 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1093180955 12:15966386-15966408 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1093443027 12:19222012-19222034 CTCAGGAGGCTGAGGTTAGAAGG + Intronic
1093498182 12:19780631-19780653 CCTAGGATGCAGTGTGAAGAAGG - Intergenic
1093534553 12:20208169-20208191 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1093791329 12:23253936-23253958 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1094110796 12:26860155-26860177 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1094186578 12:27649624-27649646 CCCAGGAGGCGGAGGTTACAGGG - Intronic
1094598057 12:31883556-31883578 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1095237312 12:39812903-39812925 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1095417275 12:41990579-41990601 CCTGGGAGGCTGAGGCCAGAGGG - Intergenic
1095691673 12:45096282-45096304 CCTGGGAGGCGGAGGCAAGATGG + Intergenic
1095982990 12:47983304-47983326 CCTAGGAGGCAAGGGCAAGAGGG - Intronic
1096987070 12:55766876-55766898 ACTAGGAGGCAGAGACTAGGCGG - Intronic
1097005873 12:55917342-55917364 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1097078120 12:56410173-56410195 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1097348706 12:58523987-58524009 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1097689856 12:62724526-62724548 CCTCAGAGGGAGAGGGTAGGTGG - Intronic
1097776985 12:63658416-63658438 CCCAGGAGGCAGAGGCTACAGGG + Intronic
1097834713 12:64261627-64261649 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1098773675 12:74586511-74586533 CCTATGAAACAGAGAGTAGAGGG - Intergenic
1098904889 12:76151664-76151686 CCTGGGAGGCAGAGGGAGGTTGG + Intergenic
1098966626 12:76797185-76797207 CCTGGGAGGCAGAGGTTGTAGGG + Intronic
1098996733 12:77129127-77129149 CCTAGAAGGCAGAAGACAGAAGG - Intergenic
1099248950 12:80228364-80228386 CCTAGGAGGCAGAGGTTTCAGGG + Intronic
1099252442 12:80272811-80272833 CATAGGAGGCAGAGACAAGAAGG + Intronic
1099293741 12:80804400-80804422 CCATGGAGATAGAGGGTAGAAGG - Intronic
1099694868 12:86005580-86005602 CCTAGCAGGCCCAGGGAAGATGG + Intronic
1100305839 12:93349516-93349538 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1100600892 12:96110644-96110666 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1100769135 12:97901983-97902005 CCCAGGAGGCAGAGCTTACAGGG - Intergenic
1101119699 12:101565907-101565929 CCTGGGAGGCGGAGGCTACAGGG + Intergenic
1101195786 12:102380737-102380759 CCTAGGAGGCAGAGTGTGCAGGG + Intergenic
1101263348 12:103058029-103058051 CAAGGGAGGCAGAGGTTAGAGGG - Intergenic
1101657620 12:106737010-106737032 TTTATCAGGCAGAGGGTAGAAGG - Intronic
1101856288 12:108446112-108446134 TCTGGGAGGCAGAGGTTACACGG - Intergenic
1101892047 12:108725909-108725931 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1101930055 12:109006517-109006539 GTCAGGAGGCAGAGGGTATAGGG + Intronic
1101972712 12:109327206-109327228 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1102243122 12:111337957-111337979 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1102500617 12:113349739-113349761 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1102904254 12:116662278-116662300 CCGAGGTGGCAGAGAGAAGAGGG - Intergenic
1102934716 12:116886746-116886768 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1103262815 12:119603193-119603215 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1103371070 12:120419889-120419911 CCTGGGAGGCAGAGGTTTCAGGG + Intergenic
1103449557 12:121018792-121018814 CCTCGGAGGCAGAGGTTGCAGGG + Intergenic
1103450626 12:121026104-121026126 CCTGGGAGGCAGAGGGGAGCCGG + Intronic
1103848520 12:123916114-123916136 CCTGGCAGGCTGAGGGAAGAGGG - Intronic
1103990859 12:124798333-124798355 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1104048558 12:125181334-125181356 CCAAGAAGGAAGAGGGAAGAGGG + Intergenic
1104748012 12:131221920-131221942 CCTCGCTGGCAGAGGGCAGAGGG + Intergenic
1105211483 13:18259567-18259589 CCAAGCAGGCAGAGGGCAGGTGG - Intergenic
1105400088 13:20084118-20084140 CTCAGGAGGCAGAGGGTGGGAGG - Intronic
1106040859 13:26091488-26091510 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1106222482 13:27758125-27758147 CCCAGGAAGCAGAGGTTACAGGG + Intergenic
1106291579 13:28368226-28368248 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1106525366 13:30535812-30535834 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1106564216 13:30871195-30871217 CCTAGGACGCAGAGGGATGGTGG + Intergenic
1107317615 13:39150659-39150681 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1107466908 13:40659237-40659259 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1107485838 13:40826873-40826895 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1107533907 13:41309918-41309940 CCTGGGAGGCGGAGGTTACAGGG + Intergenic
1107697853 13:43018261-43018283 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1107887198 13:44883387-44883409 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1107938912 13:45367222-45367244 CCTGGGAGGCAGAGGTTTCAGGG + Intergenic
1107939554 13:45371794-45371816 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1108355986 13:49629010-49629032 CCTAGGAGGCGGAGGTTGCAGGG + Intronic
1108376577 13:49819544-49819566 CCAAGGAGGTAGGGGGTTGAGGG + Intergenic
1108609630 13:52071400-52071422 GCTAAGAGGCAGGGGCTAGAGGG - Intronic
1109198626 13:59407002-59407024 ACTTGAGGGCAGAGGGTAGAAGG - Intergenic
1109798772 13:67347641-67347663 CCTAGGGGGCAAAGGAAAGAGGG - Intergenic
1109991967 13:70070090-70070112 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1110080465 13:71303661-71303683 CCCAGGAGGCAGAGGCTGCACGG + Intergenic
1110364003 13:74660742-74660764 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1110465166 13:75792074-75792096 CTTGGGAGGCTGAGGGCAGAAGG - Intronic
1110505847 13:76285164-76285186 CCTGGGAGGCAGAGGGGACGGGG - Intergenic
1111148308 13:84214730-84214752 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1111535736 13:89600179-89600201 CCTGGGAGGCAGAGGTTGTAGGG + Intergenic
1111653104 13:91117412-91117434 CCTAGGAGGAAGAGTGCTGAAGG - Intergenic
1112150978 13:96763413-96763435 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG + Intronic
1112746369 13:102531647-102531669 CCTGGGAGGCAGAGGTTGTAGGG + Intergenic
1112802195 13:103124745-103124767 GGTGGGAGGCAGTGGGTAGAAGG + Intergenic
1113018468 13:105855579-105855601 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1113019386 13:105866254-105866276 CCTGGGAGGCAGAGATTACAGGG + Intergenic
1113314273 13:109162005-109162027 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1113449124 13:110393801-110393823 TCTGGGAGGCAGAGGTTACAGGG + Intronic
1113723715 13:112581519-112581541 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1113837124 13:113335649-113335671 TCATGGAGGCAGAGAGTAGAAGG - Intronic
1113968026 13:114165663-114165685 CCTAAGAGGCAGAGTTTAGAAGG - Intergenic
1114161216 14:20169875-20169897 CTCAGGAGGCTGAGGCTAGAGGG - Intergenic
1114641093 14:24221671-24221693 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1115087576 14:29535793-29535815 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1115252468 14:31363870-31363892 CCCAGGAGGCTGAGGTTGGAGGG + Intronic
1115490368 14:33952492-33952514 CCTCAGAGGCAGAGAGGAGAGGG - Intronic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116456587 14:45126889-45126911 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1116589264 14:46750226-46750248 AGTAGGAGCCAGAGGGTAGGAGG + Intergenic
1116936681 14:50747706-50747728 CCTAGGCAACAGAGGGAAGAAGG + Intronic
1117381671 14:55170057-55170079 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1118528107 14:66668954-66668976 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1118725884 14:68628688-68628710 GCGTGGAGGCAGAGGGTAGGGGG + Intronic
1118827527 14:69397840-69397862 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1118839922 14:69502412-69502434 CTAAGCAGGCAGAGGGGAGAGGG - Intronic
1118903753 14:70008235-70008257 CCCAGGAGGCTGAGGTGAGAGGG - Intronic
1119195503 14:72714346-72714368 CCAAGGAAGCACAGGGAAGAGGG + Intronic
1119364966 14:74084116-74084138 CTTAGGAGTAAAAGGGTAGAGGG + Intronic
1119591631 14:75893740-75893762 CCTGGGAGGCATAGGTTACAGGG + Intronic
1119773805 14:77236524-77236546 CCCAGGAGACTGAGGGTAGGAGG + Intronic
1119837938 14:77767957-77767979 CCCAGGAGGCAGAGGTTGTAGGG - Intronic
1119926854 14:78502808-78502830 ATGAGGAGGCAGAGGGTAAATGG + Intronic
1120706507 14:87751482-87751504 CTTAGGAGGCAGTGGGAAGGGGG + Intergenic
1120799811 14:88675491-88675513 CCTAGGCTGCACAGAGTAGAGGG + Intronic
1120824134 14:88940002-88940024 ACTATTAGGCAGAGGGTAGAGGG - Intergenic
1121094081 14:91203750-91203772 ACTGGGAGGCAGAGGTTATAGGG - Intronic
1121141296 14:91544973-91544995 CCCAGGAGGCAGAGGGTGCAGGG - Intergenic
1121183218 14:91945153-91945175 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1121223078 14:92300968-92300990 CCTAGAAGGCACATTGTAGATGG + Intergenic
1121353146 14:93190473-93190495 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1121757404 14:96414580-96414602 CATAGGAGGCAGAGCTCAGAAGG + Intronic
1122492533 14:102128723-102128745 CCCAGGAGGCGGAGGTTACAGGG + Intronic
1122568947 14:102680727-102680749 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1122599925 14:102916133-102916155 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1122637215 14:103135792-103135814 CCTGGGCTGCAGAGGGCAGATGG - Exonic
1122650654 14:103224694-103224716 CCCAGGAGGCAGAAGATACAGGG + Intergenic
1122675267 14:103407634-103407656 CCCAGGAGGCGGAGGTTACAGGG - Intronic
1122710673 14:103655149-103655171 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1122983630 14:105202441-105202463 CCTAGGCTGGAGAGGGCAGAGGG + Intergenic
1124083264 15:26520443-26520465 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1124549480 15:30665325-30665347 CCCAGGAGGCAGAGGCTACTGGG + Intronic
1124676149 15:31687508-31687530 CGCAGGAGGCATATGGTAGAGGG - Intronic
1124930241 15:34112665-34112687 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1125447850 15:39776999-39777021 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1125783849 15:42297403-42297425 CTTGGGAGGCTGAGGCTAGAGGG - Intronic
1125925295 15:43558301-43558323 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1125927179 15:43572348-43572370 CCCAGGAGGCAGAGGTTGCAAGG + Intronic
1125940323 15:43671913-43671935 CCCAGGAGGCAGAGGTTGCAAGG + Intergenic
1126019584 15:44387097-44387119 CCCAGGAGGCAGAGGCTGCAGGG + Intronic
1126503416 15:49374617-49374639 CCTGGGAGGCGGAGCCTAGATGG - Intronic
1126621475 15:50644719-50644741 CCCAGGAGGCAGAGGTTCCAGGG + Intronic
1126751560 15:51882421-51882443 CCCAGGAGGCAGAGGTTGCATGG + Intronic
1127246149 15:57177343-57177365 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1127331579 15:57945002-57945024 CCCAGGAGGCAGAGGAGAAAAGG + Intergenic
1127436711 15:58964984-58965006 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1127569111 15:60223583-60223605 CCCAGAATGCAGAGGGTTGAGGG - Intergenic
1127672859 15:61212473-61212495 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1127692258 15:61408902-61408924 CTTAGGAGGCAGAGGATAGCAGG + Intergenic
1127731879 15:61809206-61809228 CCTAAGAGGTAAAGGTTAGAAGG + Intergenic
1127971783 15:63967613-63967635 CCCAGGAGGCAGAGGCTGCAGGG + Intronic
1128069524 15:64785910-64785932 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1128246437 15:66135820-66135842 CTTAGGAGGCAGAGGGGAACTGG - Intronic
1128626978 15:69218436-69218458 CCTGGGAGGCAGAGGTTTCAGGG + Intronic
1128627754 15:69228760-69228782 CCAAGGAGGCAGAGGTTGCAGGG - Intronic
1128953969 15:71919764-71919786 CCCAGGAGGCAGAGGTTGAAGGG + Intronic
1129132893 15:73516701-73516723 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1129430606 15:75498637-75498659 CCTGGGAGGCAGAGGTTACAGGG + Intronic
1129607919 15:77033777-77033799 CCTGGGAGGCAGAGGCTCGTGGG + Intronic
1129830872 15:78669158-78669180 CCTGGGAGGGAGAGGGGAGGAGG + Intronic
1130001471 15:80050971-80050993 CCTGGGAGGCTGAGGTTGGAGGG + Intergenic
1130165687 15:81455623-81455645 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1130222653 15:82033651-82033673 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1130348640 15:83070906-83070928 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1130399674 15:83537780-83537802 CCTAGAAGACAGAGAGCAGATGG - Intronic
1130412991 15:83662908-83662930 CCCAGAGGGCAGAGGGTTGAGGG - Intronic
1130701893 15:86191991-86192013 CTTAGGAGGCTGAGGTTGGAGGG + Intronic
1130913709 15:88288947-88288969 CCTAGGAGGAAGAGGGTATGGGG + Intergenic
1130920518 15:88340306-88340328 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1131126906 15:89866559-89866581 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1131243156 15:90765999-90766021 CTTAGGAAGCTGAGGGAAGAGGG + Intronic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1131892336 15:96985470-96985492 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1132049332 15:98593922-98593944 CTTGGGAGGCAGAGGGCAGAAGG - Intergenic
1132259274 15:100407945-100407967 CCTTGGAGGCAGAGGTTGCAGGG - Intronic
1132352197 15:101146872-101146894 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1132504226 16:298842-298864 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1132573325 16:653503-653525 CCTAGGAGGCAGAAGGGTGAGGG - Exonic
1133081540 16:3325055-3325077 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133190936 16:4133326-4133348 CCTGGGAGGCAGAGGTTACAGGG - Intergenic
1133349622 16:5092882-5092904 CCCAGGAGGCAGAGGTTTCAGGG + Intronic
1133549362 16:6839058-6839080 CCCAGGAGGCAGAGGTTACAGGG - Intronic
1133566744 16:7002634-7002656 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1133692786 16:8232724-8232746 GGTGGGTGGCAGAGGGTAGAGGG - Intergenic
1133792755 16:9021952-9021974 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133856686 16:9556306-9556328 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133899539 16:9960698-9960720 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1134054184 16:11158842-11158864 CCTGGGAGGCGGAGGTTACAGGG + Intronic
1134338152 16:13320213-13320235 CCCAGGAGGCAGAGGCTGCACGG + Intergenic
1134658452 16:15965670-15965692 CCCAGGAGGCAGAGGTCACAGGG - Intronic
1134694666 16:16214678-16214700 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1134752815 16:16639721-16639743 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1134977167 16:18579960-18579982 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1134993243 16:18719355-18719377 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1135032891 16:19052786-19052808 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1135035468 16:19073231-19073253 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1135107758 16:19665360-19665382 CCATGGAGACAGAGAGTAGAAGG - Intronic
1135289089 16:21219196-21219218 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1135577072 16:23594426-23594448 CCCAGGAGGCAGAGGTTTTAGGG - Intronic
1135989883 16:27211752-27211774 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1136050755 16:27648215-27648237 CCTAGGAGGTAGAGGTTGCAGGG + Intronic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1136251359 16:29007603-29007625 CCTGGGAGGCGGAGCCTAGATGG + Intergenic
1137257008 16:46784206-46784228 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1137356617 16:47772321-47772343 CATTTAAGGCAGAGGGTAGAGGG - Intergenic
1137505965 16:49053891-49053913 CCCAGGAGGCAGAGGTTCCAGGG + Intergenic
1137555828 16:49469763-49469785 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1138007692 16:53353623-53353645 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1138820863 16:60257802-60257824 CCCAGGAGGCAGAGGTTGCACGG - Intergenic
1139098586 16:63736258-63736280 CCTACTAGGCAGAGAGTAGTAGG + Intergenic
1139190000 16:64851799-64851821 CCTAGGATGCAGTGGCTGGAAGG - Intergenic
1139765773 16:69228428-69228450 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1139966665 16:70749636-70749658 TCTAGGAGACTGAGGGAAGATGG - Intronic
1140388482 16:74563649-74563671 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1140520285 16:75575172-75575194 CTTAGGGGGCAGTGGGTAGAGGG - Intronic
1140755238 16:78060637-78060659 CCTGGGAGGCAGAGGTTGTATGG - Intronic
1141069603 16:80941885-80941907 CCTAGGAGGCAGAGGTTGCAGGG - Intergenic
1141078362 16:81029649-81029671 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1141394893 16:83695963-83695985 CCCAGGAGGCAGAGGTTGTAGGG - Intronic
1141586870 16:85039908-85039930 CCTGGGAGGCGGAGGGTGTAGGG - Intronic
1141592852 16:85080096-85080118 CCCAGAGGGCAGAGGGCAGAGGG + Intronic
1141642748 16:85350853-85350875 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1141718337 16:85740132-85740154 CCCAGGAGGCAGAGGTTGTAGGG + Intronic
1141921163 16:87136372-87136394 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1142096489 16:88242684-88242706 CCTAGGCAGCAGCGGGTTGAGGG + Intergenic
1142339260 16:89509862-89509884 CCCAGGAGGCAGAGGCTTCAGGG - Intronic
1142561115 17:809517-809539 CCTGGGAGGCAGAGAGGAGCGGG + Intronic
1142842389 17:2643633-2643655 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1142956096 17:3523640-3523662 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1142976941 17:3650876-3650898 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1143004822 17:3823233-3823255 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1143019246 17:3908125-3908147 CCCAGGAGGCAGAGCACAGAGGG + Intronic
1143033469 17:3981187-3981209 CCTGGGAGGCAGAGGTTTCAGGG + Intergenic
1143215191 17:5219550-5219572 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1143297064 17:5879161-5879183 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1143645648 17:8228417-8228439 CCTGGGAGGAAGAGGGATGAGGG - Intronic
1143899062 17:10159859-10159881 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1144237718 17:13278196-13278218 CTTAGGAGGCAGAGAGCATATGG + Intergenic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1145715888 17:27020728-27020750 CTCAGGAGGCTGAGGCTAGAGGG - Intergenic
1146200585 17:30854445-30854467 CCCAGGGGGCAGAGGTTACAGGG - Intronic
1147252912 17:39164440-39164462 ACTAGGAGCCAGAGGCAAGAAGG + Intronic
1147619638 17:41856942-41856964 TCTGGGAGGCAGAGGTTATAGGG + Intronic
1147658811 17:42106048-42106070 CTTGGGAGGCTGAGGGCAGAAGG + Intronic
1147681421 17:42249734-42249756 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1147681971 17:42255013-42255035 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1147878399 17:43637984-43638006 CCTAGGTGGCAAAGGGCAGTAGG + Intergenic
1148029869 17:44612111-44612133 CCTGGGAGGCGGAGGTTACAGGG + Intergenic
1148121690 17:45216420-45216442 GCTGGGAGGGAGAGGGTAAAAGG - Intergenic
1148128649 17:45249349-45249371 CCTGGAAGGCTGAGGGTAGAGGG + Intergenic
1148146204 17:45366681-45366703 CTCAGCAGGCAGAGGGGAGAGGG - Intergenic
1148533339 17:48416331-48416353 CCTGGGTGGAAAAGGGTAGAGGG + Intronic
1148596198 17:48857615-48857637 ACTAGGAGGCATAGGCCAGAAGG - Intronic
1148682149 17:49480458-49480480 GCTGGGAAGCAGAGGGGAGAAGG + Intergenic
1148749069 17:49934461-49934483 CCTAGGATGCAGTAGGTACATGG + Intergenic
1148933466 17:51145832-51145854 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1149602469 17:57902096-57902118 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1149659150 17:58325370-58325392 CCCAGGTGGGAGAGGGGAGAAGG - Intronic
1149702850 17:58669656-58669678 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1149801438 17:59571664-59571686 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1149934948 17:60795763-60795785 CCCAGGAGGCGGAGGCTACAGGG - Intronic
1150183004 17:63146855-63146877 CCTGGGAGGCAGGTGGTTGAGGG - Intronic
1150189247 17:63220217-63220239 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1150226707 17:63528353-63528375 CCCAGGCAGCAGATGGTAGATGG + Intronic
1150317694 17:64183500-64183522 CCTGGGAGGCAGAGGTTACAGGG - Intronic
1150356076 17:64485990-64486012 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1150363439 17:64559515-64559537 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1150377349 17:64692728-64692750 CCTAGGAGACAGAGGTTGCAGGG - Intergenic
1150672967 17:67218008-67218030 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1150791497 17:68203683-68203705 CCTGGGAGGCAGAGGTTTCAGGG - Intergenic
1150823974 17:68457881-68457903 GCTGGGAGGGAGAGGGAAGAAGG + Intergenic
1150919657 17:69469685-69469707 CCTGGGAAGCAGAGGTTACAGGG + Intronic
1151034738 17:70784955-70784977 CCAAGGAGGCCGAGGGTAGCGGG + Intergenic
1151432401 17:74072377-74072399 CCTCAGAGGCACAGGGGAGAAGG - Intergenic
1151636131 17:75349593-75349615 CCCAGGAGGCAGAGGGTGCGGGG - Intronic
1151738969 17:75966052-75966074 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1151852497 17:76699251-76699273 CTTAGGAGGCTGAGGGGGGAGGG - Intronic
1152492982 17:80650371-80650393 CCTACGAGGCAGAAGGGAGGAGG - Intronic
1152578055 17:81151554-81151576 CCTGGGAGGCTGGGGGCAGATGG - Intronic
1152705298 17:81840574-81840596 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1152815742 17:82406717-82406739 CTTGGGAGGCAGAGGGTGGGAGG - Intronic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1154124842 18:11681914-11681936 CCCAGGAGGCTGAGGCAAGAGGG + Intergenic
1154407671 18:14109029-14109051 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1154471769 18:14710090-14710112 CTTAGGAGGCTGAGGCAAGAGGG + Intergenic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1155040876 18:22064780-22064802 CCAAGGTGTCAGAGGGAAGAAGG + Intergenic
1155721601 18:29020143-29020165 CCTACGAGGAAGAAAGTAGAAGG - Intergenic
1156093013 18:33494268-33494290 CCCAGGAGGCAGAGGGGCGAAGG - Intergenic
1156534572 18:37850172-37850194 ACAAAGAGGGAGAGGGTAGAAGG - Intergenic
1156860783 18:41833849-41833871 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1156894384 18:42229003-42229025 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1157232223 18:45928118-45928140 CCTGGGAGGCAGAGGTTGTAGGG + Intronic
1158452758 18:57581521-57581543 CTTAGGAGGAGGAGGGCAGAAGG - Intronic
1158646609 18:59254260-59254282 CCCAGGAGGCAGAGGTTGCAAGG - Intergenic
1158708344 18:59814867-59814889 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1158843981 18:61420973-61420995 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1159209826 18:65304142-65304164 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1159266256 18:66083859-66083881 TCTGGGAGGCAGAGGTCAGAAGG - Intergenic
1159841691 18:73405880-73405902 CCCAGGAGGCAGAGGCTGCAGGG - Intergenic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1160622371 18:80180232-80180254 CCCAGGTGGCAGAGGGGACAAGG + Intronic
1160852944 19:1202550-1202572 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1161092271 19:2367468-2367490 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1161147111 19:2685547-2685569 CCCAGGAGGCAGAGGCTGCAGGG + Intronic
1161474115 19:4474864-4474886 CCAAGGATGCAGAGGGTGGGGGG - Intronic
1161548424 19:4896605-4896627 CCAAGGAGGAAGAGGGAAGGTGG - Intronic
1161571933 19:5035557-5035579 CCAAGGAGGCAGAGGGAGGGAGG - Intronic
1161607741 19:5224101-5224123 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1162000055 19:7738547-7738569 CCCAGGAGGCAGAGGCTGCAGGG + Intergenic
1162042175 19:7977675-7977697 CCTTGGTGGCAGAGTGGAGAAGG - Intronic
1162088952 19:8265406-8265428 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1162212176 19:9101023-9101045 CCTAGGAGGCTGAGGTAGGAGGG + Intergenic
1162374105 19:10294979-10295001 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1162654889 19:12121174-12121196 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1162896513 19:13767803-13767825 CCCAGGAGGCAGAGGTTGCAAGG - Intronic
1163046126 19:14643784-14643806 CCTGGGAGGCAGAGGTTTCAGGG - Intronic
1163277406 19:16294031-16294053 CTTAGGAGGCTGAGGGTGGGAGG - Intergenic
1163463256 19:17451923-17451945 CCTACGAGGCTGAGGGCACAGGG - Intronic
1163562004 19:18024928-18024950 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1163970262 19:20786835-20786857 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1164215482 19:23141317-23141339 CCCAGGAGGCAGAGGTTGTAGGG + Intronic
1164513529 19:28915831-28915853 CCAAGGAGGCTGAGGGGAGTGGG - Intergenic
1165201608 19:34149386-34149408 CCCAGGAGGCAGAGGTTGTAGGG + Intergenic
1165284483 19:34829981-34830003 CCCAGGAGGCAGAGGATGCAGGG + Intergenic
1165317265 19:35064422-35064444 CCTAGGAGGCAGAGTTTGCAGGG - Intronic
1165521505 19:36317858-36317880 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1165585432 19:36911285-36911307 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1165616326 19:37204820-37204842 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1165634217 19:37327065-37327087 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1165781882 19:38439580-38439602 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1166287317 19:41839214-41839236 CATACGAGGCAGAGTGGAGATGG + Exonic
1166973856 19:46591573-46591595 CCCTGGAGGCAGAGGTTACAGGG - Intronic
1167040508 19:47020509-47020531 CTAAGGAGGCAGGGGGCAGAGGG - Intronic
1167151000 19:47709602-47709624 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1167166474 19:47802980-47803002 CCTGGGGGGCAGAGGGGACAGGG + Exonic
1167167911 19:47811940-47811962 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1167172773 19:47844313-47844335 CCCAAGAGGCAGAGGCTGGAGGG - Intergenic
1167175369 19:47860780-47860802 CCTGGGGGGCAGAGGGGACAGGG - Intergenic
1167605078 19:50477325-50477347 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1167739673 19:51316939-51316961 CCTGGGAGGTAGGGGGTGGAGGG - Intronic
1168052642 19:53840880-53840902 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1168585885 19:57591478-57591500 GCAAGGTGGTAGAGGGTAGATGG - Exonic
925557584 2:5148311-5148333 CCCAGGAGGCAGGGGTTACAGGG + Intergenic
925752510 2:7102254-7102276 CCTGGGAGGCAGAGGTTGTAGGG - Intergenic
925915772 2:8604765-8604787 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
926091869 2:10056364-10056386 CCTGGGAGGCGGAGGGTGCAGGG + Intergenic
926163928 2:10506309-10506331 CCTGGGAGGCGGAGGTTACAGGG + Intergenic
926209297 2:10857303-10857325 CCCAGGAGGCAGAGGTTGTAGGG + Intergenic
926225127 2:10961729-10961751 CCTGGGAGGCGGAGGGGAGGCGG - Intergenic
926524494 2:13960236-13960258 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
926615185 2:14990346-14990368 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
926849361 2:17178087-17178109 CCTAGGGTGGAGAGGGTAGAAGG - Intergenic
926866387 2:17363640-17363662 GGTAGAAGGCAGAGGGCAGAGGG - Intergenic
926881039 2:17543496-17543518 CCTAGGAGCCAGAGGTGAGCTGG - Intronic
927719674 2:25374552-25374574 AGTAGGAAGCAGAGGGAAGACGG + Intergenic
927756025 2:25708533-25708555 CCTTGGGGGAAGAGGGTAGTAGG + Intergenic
927788111 2:25988142-25988164 CCCGGGAGGCAGAGGTTACATGG - Intergenic
927889710 2:26740735-26740757 CCTAGCAGGCTGAGGGTAAATGG + Intergenic
927903305 2:26839164-26839186 CCCAGGAGGCAGAGGTTTCAAGG - Intergenic
928575026 2:32646102-32646124 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
928944419 2:36760068-36760090 CCTGGGAGGCAGAGGTTGTAGGG - Intronic
928973258 2:37054558-37054580 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
929109419 2:38393925-38393947 CCTGGGAGGCTGAGGGTGGGTGG + Intergenic
929149849 2:38737766-38737788 CTTAGGAGGCTGAGGCTGGAGGG - Intronic
929181775 2:39048474-39048496 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
929275249 2:40018422-40018444 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
929460271 2:42098156-42098178 CCTGGGAGGCAGAGGTTACAGGG + Intergenic
929546851 2:42861525-42861547 CCCAGGAGGCCAAGGGTAGGAGG - Intergenic
929548946 2:42876929-42876951 CCAAGGAGGCAGAGGTTGCAGGG - Intergenic
929592434 2:43155973-43155995 CTTAGGTGTCAGTGGGTAGAGGG - Intergenic
929602504 2:43213135-43213157 CCTATGAGGGAAGGGGTAGAGGG + Intergenic
929679146 2:43971022-43971044 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
929719277 2:44350996-44351018 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
929771558 2:44896611-44896633 CCCAGGAGGCAGAGAGCTGAGGG + Intergenic
930426762 2:51222664-51222686 CCCAGGAGGCAGAGGCTGCAGGG - Intergenic
930522239 2:52482034-52482056 CCATAGAGGCAGAGGGTAGAAGG + Intergenic
930646791 2:53918427-53918449 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
931216545 2:60250146-60250168 CCTGGGAGGCAGAGGCTTCAGGG + Intergenic
931233877 2:60397155-60397177 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
931258940 2:60599923-60599945 CCAAGGAGGCAGAGAGTACATGG + Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931352350 2:61503039-61503061 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
931354742 2:61526781-61526803 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
931574130 2:63702099-63702121 CCTAGGAGGCGGAGGTTGCAGGG - Intronic
931682921 2:64768013-64768035 CCTAGGAGGGAGAGGGGCGCGGG - Intergenic
931960679 2:67479030-67479052 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
932134024 2:69212912-69212934 CTTAGGAGGCTGAGGTGAGAGGG - Intronic
932150927 2:69371150-69371172 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
932181675 2:69652086-69652108 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
932549626 2:72754719-72754741 CTTAGGAGGCGGAGGCTAGAGGG - Intronic
933022042 2:77206252-77206274 CCCAGGACGCAGAGGTTACAGGG - Intronic
933022181 2:77207952-77207974 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
933181891 2:79236206-79236228 CCTAGGAGTTTGAGGGTACAGGG - Intronic
933483107 2:82882282-82882304 CCAAGGAAGCAGAGTGGAGAGGG - Intergenic
933812526 2:86041823-86041845 GCTAGGAGGCAGGGGCTAGGAGG + Intronic
934070720 2:88381632-88381654 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
934122549 2:88854149-88854171 CCAAGGAGGCAGAGACCAGAGGG - Intergenic
934711021 2:96514074-96514096 CCCAGGAGGCAGAGGCTACAGGG + Intergenic
934844851 2:97656190-97656212 CCCAGGGTGCCGAGGGTAGAGGG + Exonic
935035648 2:99369898-99369920 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
935055857 2:99566150-99566172 CATAGGAGGCAGAGGTTGCAGGG - Intronic
935293183 2:101626948-101626970 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
935443517 2:103131661-103131683 CCTAGGAGGTGGAGGCTGGAGGG + Intergenic
935730575 2:106062015-106062037 CCTTGGAGGCAGAGTCAAGATGG + Intergenic
936765948 2:115848661-115848683 CTGAGGAGGCAGAAGGCAGAAGG - Intergenic
937733440 2:125261369-125261391 CCTAGGAAACAGAGGAAAGAAGG - Intergenic
937806527 2:126151406-126151428 CCAAGGATGCACAGAGTAGAGGG + Intergenic
937958655 2:127438188-127438210 CCGGGGAGGCTGTGGGTAGAGGG + Intronic
938043885 2:128099217-128099239 TCCAGGAGGCAGAGGTTACAGGG - Intronic
938184780 2:129220767-129220789 CCTAGGATGCAGAAGTTTGAGGG + Intergenic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
938541978 2:132290661-132290683 CCCGGGAGGCAGAGGTTGGAGGG + Intergenic
938883643 2:135618942-135618964 CCCAGGAGGCAGAGGTTTCAGGG + Intronic
939089699 2:137765216-137765238 CCTAGGAGAAAGAAGGAAGATGG - Intergenic
940864194 2:158800913-158800935 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
941651962 2:168101660-168101682 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
941670759 2:168289743-168289765 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
941868210 2:170356436-170356458 CCCAGGAAGCAGAGGTTACAGGG - Intronic
942085198 2:172437106-172437128 CCTTGGAGGCAGATTGTATAGGG + Intronic
944125074 2:196283449-196283471 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
944176160 2:196831177-196831199 CCTAGGGGACAAAGGGAAGAGGG - Intergenic
944186676 2:196956627-196956649 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
944594610 2:201249764-201249786 TGTAGGAGGCAGAGGGTATATGG - Intronic
944743285 2:202633277-202633299 CCCGGGAGGCAGAGGTTGGAAGG - Intergenic
944975006 2:205040037-205040059 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
945234590 2:207622981-207623003 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
945261080 2:207843973-207843995 CCTGGGAGGCTGAGGCTGGAGGG + Intronic
946020671 2:216637771-216637793 CCTGTCAGGCAGAGGGAAGAGGG + Intronic
946699045 2:222392729-222392751 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
947686826 2:232094641-232094663 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
947936171 2:234005833-234005855 CCTAGGAGGCTGAGGTTGCAGGG + Intronic
948064006 2:235063078-235063100 CCCAGGAGGCAGAGGCTGCAGGG + Intergenic
948139822 2:235664285-235664307 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
948318921 2:237053500-237053522 CCTGGGATCCAGAGGGTGGATGG - Intergenic
948607853 2:239147221-239147243 CCTAGGGGGCAGAAGGCAGCCGG + Intronic
1168854912 20:1001844-1001866 CCCAGAAGGGAGAGGGTAGCAGG - Intronic
1169122343 20:3104730-3104752 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1169215000 20:3788059-3788081 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1169829285 20:9806038-9806060 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1169852618 20:10069091-10069113 CCAAGGAGATAGAGAGTAGAAGG + Intergenic
1170545988 20:17436258-17436280 TCCAGCAGGCAGAGGGCAGAGGG - Intronic
1170747683 20:19115320-19115342 AACAGGAGGCAGAAGGTAGAAGG - Intergenic
1171225350 20:23437977-23437999 CCTGGGAGGCTGAGGCTAGGAGG - Intergenic
1171359718 20:24578537-24578559 CCTAGCAGGCTGGGGTTAGAGGG + Intronic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1171984184 20:31648062-31648084 CCTAGGGGGCAGAGGTTGCAGGG - Intergenic
1172427539 20:34865258-34865280 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1172575616 20:36006102-36006124 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1172640624 20:36438296-36438318 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1172726902 20:37051255-37051277 CCCAGGAGGCAGAGGTTGCAAGG - Intronic
1173648399 20:44647968-44647990 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1173797916 20:45875575-45875597 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1173844402 20:46178843-46178865 CCTAAGAGGCTGAGCCTAGAGGG + Intronic
1174090724 20:48044823-48044845 CCCAGGAGGCAGAGGTTGTAGGG - Intergenic
1174623829 20:51898073-51898095 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1174630533 20:51953233-51953255 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1174791525 20:53482828-53482850 CCCAGGAGGCAGAGGTTGTAGGG + Intronic
1175028607 20:55929859-55929881 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1175786765 20:61716830-61716852 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1176003308 20:62844668-62844690 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1176166250 20:63675587-63675609 CCCAGGAGGCCGAGGCTACAGGG - Intronic
1176703124 21:10082573-10082595 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1176893468 21:14347325-14347347 CCTGGGAGGCAGAGGTTTGCAGG + Intergenic
1177236971 21:18404050-18404072 CATCTGAGTCAGAGGGTAGAAGG - Intronic
1177409104 21:20706905-20706927 CCCAGGAGGCAGAGGTTGCATGG + Intergenic
1177454323 21:21316617-21316639 CCTGGGAGGCAGAGGTTGTAGGG - Intronic
1177705183 21:24695159-24695181 CCTAGGAGGCAGAGGTTGCAGGG - Intergenic
1178238095 21:30867399-30867421 CCTCGGAAGCTGAGGGAAGAGGG + Intergenic
1178335544 21:31739436-31739458 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1178536431 21:33413906-33413928 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1179240805 21:39589528-39589550 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1179370784 21:40804487-40804509 GCTAGCAGGCAGAGGGTGGTAGG - Intronic
1179399343 21:41069715-41069737 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1179528223 21:41998265-41998287 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1179718118 21:43300482-43300504 CGTAGGAGGAAGCGGGGAGATGG - Intergenic
1180170451 21:46055546-46055568 CCTAGGGGGCAGGGGGTTCAAGG - Intergenic
1180764742 22:18339871-18339893 CCAAGCAGGCAGAGGGCAGGTGG + Intergenic
1180814287 22:18779813-18779835 CCAAGCAGGCAGAGGGCAGGTGG - Intergenic
1180899916 22:19363156-19363178 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1180994135 22:19956450-19956472 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1181010820 22:20039551-20039573 CCTGGGAGGCAGAGGTTACAGGG + Intronic
1181083401 22:20428378-20428400 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1181098263 22:20521170-20521192 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1181200473 22:21214148-21214170 CCAAGCAGGCAGAGGGCAGGTGG - Intronic
1181302779 22:21893248-21893270 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1181371683 22:22424083-22424105 CCTAGGAGGCTGAGGCAGGAGGG + Intergenic
1181492026 22:23266463-23266485 CCTGGGAGGCAGAGGTTGCAAGG - Intronic
1181836890 22:25617850-25617872 CCCAGGAGGCAGAGGTTGCATGG - Intronic
1181977848 22:26744094-26744116 CCCTGGAGGCAGAGGTTACAGGG - Intergenic
1182100365 22:27653531-27653553 CCATGGAGACAGAGAGTAGAAGG + Intergenic
1182238191 22:28893571-28893593 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1182372477 22:29821224-29821246 ATTAGCAGGCAGAGGGGAGAAGG - Intronic
1182515116 22:30853831-30853853 CCGAGGAGGCAGAGCTGAGATGG - Intronic
1182975946 22:34624214-34624236 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1183053526 22:35285616-35285638 CTTGGGAGGCAGAGGTGAGAGGG + Intronic
1183319438 22:37156106-37156128 CCTGGGAGGCGGAGTGGAGAGGG - Intronic
1183378718 22:37480081-37480103 TCTAGCAGGCAGTGGGCAGATGG - Intronic
1183854812 22:40624348-40624370 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1183887207 22:40894062-40894084 CCCAGGAGGCTGAGGGCAGGAGG + Intronic
1183995008 22:41626528-41626550 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1184005496 22:41705245-41705267 CCCAGGAGGCAGAGATTACAAGG - Intronic
1184119428 22:42440692-42440714 GCTAGGGGGCAGAGGAAAGAGGG + Intergenic
1184142627 22:42586998-42587020 CTCAGGAGGCTGAGGGGAGAGGG + Intronic
1184146921 22:42617197-42617219 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1184611236 22:45605074-45605096 CCCAGGAGGCAGAGGTTATATGG - Intergenic
1184701415 22:46176061-46176083 CCTAGGAGGCAGAGGTTGCAAGG + Intronic
1184735662 22:46396330-46396352 CCCAGGAGGCAGAGGTTGCAAGG + Intronic
1185190502 22:49433253-49433275 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190518 22:49433334-49433356 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190549 22:49433456-49433478 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185339292 22:50284393-50284415 CCAGGGAGGCAGAGGGCAGAGGG + Intronic
1185379520 22:50501928-50501950 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1203226365 22_KI270731v1_random:80776-80798 CCAAGCAGGCAGAGGGCAGGTGG + Intergenic
1203264386 22_KI270734v1_random:5500-5522 CCAAGCAGGCAGAGGGCAGGTGG - Intergenic
949211739 3:1511380-1511402 CGTGGGAGGCAGAGGCTGGATGG - Intergenic
949494895 3:4622188-4622210 CCCAGGAGGCAGAGGCTGCAGGG - Intronic
949624973 3:5855150-5855172 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
950240067 3:11361358-11361380 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
950511314 3:13429704-13429726 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
950633588 3:14299708-14299730 CCCAGCTGGCACAGGGTAGAAGG + Intergenic
951000710 3:17556088-17556110 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
951000943 3:17559214-17559236 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
951204977 3:19916437-19916459 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
951535677 3:23738376-23738398 CCTGGGAGGCAGAGGTTACAGGG + Intergenic
951887720 3:27540152-27540174 TTTAGGAGGCAGAGGCTGGAGGG + Intergenic
951957251 3:28271004-28271026 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
952049807 3:29370883-29370905 CCTACATGGCAGAGGCTAGAGGG + Intronic
952384170 3:32827337-32827359 CCCAGGAGGCAGAAGGTACAAGG - Intronic
952713740 3:36457251-36457273 CCAAGGAGTCAGAGGGTTGGTGG + Intronic
953411465 3:42692733-42692755 AGTAGGAGGGAGCGGGTAGAGGG - Exonic
953617563 3:44505068-44505090 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
953806809 3:46077571-46077593 CCTAGGAGGAGTAGGGGAGATGG - Intergenic
954022676 3:47756096-47756118 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
954545004 3:51426283-51426305 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
954888400 3:53898635-53898657 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
954961192 3:54566365-54566387 CCCAGGAGGCAGAGGATCAAAGG + Intronic
955028540 3:55193603-55193625 TCATGGAGACAGAGGGTAGAAGG - Intergenic
955117601 3:56021274-56021296 TCTAGGAGGCAGAAGGAAGAAGG + Intronic
955243416 3:57201727-57201749 CCTAAGAGGCACAAGGCAGAAGG + Intronic
955712631 3:61796205-61796227 CCCAGGAGGCTGATGGTAGGTGG + Intronic
956759183 3:72423143-72423165 CCTAGGAGGCGGAGGTTGCAGGG + Intronic
956808222 3:72838575-72838597 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
956859220 3:73305923-73305945 CCCAGGAGGCTGCGGGGAGAGGG + Intergenic
957053930 3:75430232-75430254 CCCAGGAGGCAGAGGTTTCAGGG + Intergenic
958437482 3:94114758-94114780 ACTAGAAGGGAGAGGGCAGAAGG - Intronic
959472441 3:106768409-106768431 CCTAGGAGGCAGAGGTTGCAGGG + Intergenic
959553490 3:107690980-107691002 CCTTGGAGCCAGGAGGTAGAGGG - Intronic
959639708 3:108618983-108619005 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
959905938 3:111711326-111711348 CCCAGGAGGCAGAGGTTTCAGGG + Intronic
959966386 3:112360250-112360272 CCTAGGAGGTGGAGGTTACAGGG + Intronic
960120946 3:113948139-113948161 CCAAAGAGGCGGAGGGGAGATGG - Exonic
960121884 3:113955466-113955488 CCTGGCATGCAGTGGGTAGAAGG + Intronic
960180425 3:114569280-114569302 CATAGGAGCCAGTGGATAGATGG + Intronic
960530830 3:118762457-118762479 CCTAGGTGGAAGACAGTAGAGGG + Intergenic
960630332 3:119724090-119724112 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
960638111 3:119803831-119803853 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
960794558 3:121471664-121471686 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
961300912 3:125921479-125921501 CCCAGGAGGCAGAGGTTTCAGGG - Intergenic
961387408 3:126530282-126530304 CCCAGGGGCCAGTGGGTAGAAGG - Intronic
961927668 3:130498511-130498533 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
962059800 3:131913693-131913715 CCAAGGAGGCATAAGGCAGAAGG - Intronic
962126493 3:132624760-132624782 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
962544884 3:136423937-136423959 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
963204753 3:142621370-142621392 CCTTGAACACAGAGGGTAGATGG - Intronic
963699186 3:148602393-148602415 CCTGGGAGGCTGAGGGTAGCAGG - Intergenic
963699341 3:148604602-148604624 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
963716254 3:148807680-148807702 CGGAGGAGGCAGAGGCTGGAAGG + Intronic
963899954 3:150724599-150724621 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
963961464 3:151313766-151313788 CCCAGGAGGCAGAGGTTACATGG + Intronic
964353115 3:155822506-155822528 CCCAGCAGGCAGAGGGTGCAGGG + Exonic
964376625 3:156054617-156054639 CCAAGGAGGCAGAGGTTGCAGGG - Intronic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
964976728 3:162630319-162630341 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
965151487 3:164982763-164982785 CATAGGAGGCTGAGGCTAGAGGG - Intronic
965688788 3:171333479-171333501 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
965758685 3:172052191-172052213 CGTGGGAGGCTGAGGGTGGAAGG - Intronic
965922027 3:173928745-173928767 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
965933767 3:174080312-174080334 CCAAGGAGGCATAGGGCAGAAGG + Intronic
966180132 3:177180810-177180832 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
966516159 3:180822903-180822925 CCTTGAAGGCAGAGGGTGGGAGG + Intronic
966637054 3:182147371-182147393 CCCAGGGGGCAGAGGTTACAGGG - Intergenic
966648379 3:182271616-182271638 CCAAGGAGGCAGACGGGACAGGG + Intergenic
966917116 3:184591084-184591106 CCTGGGAGGAAGTGGGGAGAGGG + Intronic
967631050 3:191743214-191743236 CCTAGGGGACAAAGGGAAGAGGG - Intergenic
967911626 3:194546905-194546927 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
968074324 3:195808289-195808311 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
968453050 4:684069-684091 CCCAGAAGGCAGAGGGCAGAGGG + Intronic
968465768 4:749891-749913 CCCAGGAGGCAGAGGGTACAGGG - Intronic
968693906 4:2011290-2011312 CCCAGGAGGCAGAGGTTGGAGGG + Intronic
968835408 4:2960328-2960350 TCTAGCAGGAAGGGGGTAGATGG + Intronic
968845568 4:3039620-3039642 CCTGGGAGGCGGAGGTTACAGGG + Intronic
968996731 4:3950539-3950561 CCCAGGAGGCAGAGGTTTCAGGG + Intergenic
969022579 4:4147899-4147921 CCTAAGAGCCAGGGGGGAGAGGG + Intergenic
969261150 4:6034723-6034745 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
969284437 4:6194097-6194119 CCAAGGAGACAGAGGGCAGATGG + Intronic
969757268 4:9158137-9158159 CCCAGGAGGCAGAGGTTTCAGGG - Intergenic
970547124 4:17140990-17141012 CCCAGGAGGCTGAGGCTGGAGGG + Intergenic
970590264 4:17554094-17554116 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
970662988 4:18306948-18306970 CTTAGGAGAGAGAGAGTAGATGG - Intergenic
971041323 4:22755472-22755494 TCAAAGAGGCAGAGAGTAGATGG - Intergenic
971156460 4:24088327-24088349 CCTGGGAGACAGAGGACAGAGGG + Intergenic
971330102 4:25674922-25674944 CATAGGAGGCAGTGAGGAGATGG - Intronic
971407802 4:26338649-26338671 CCTGGGAGGCAGAGGTTTCAGGG - Intronic
971563154 4:28107416-28107438 CCCAGGAGGCAGAGGTTGAAGGG - Intergenic
971915264 4:32862093-32862115 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
973160250 4:47007062-47007084 CCTAGGAGGCCGAGGCTGTAGGG + Intronic
973299307 4:48561906-48561928 CTCAGGAGGCTGAGGGTGGAGGG + Intronic
973320239 4:48802643-48802665 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
974090505 4:57305817-57305839 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
975125520 4:70778156-70778178 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
977049093 4:92104181-92104203 CTTAGGAGGCTGAGGTGAGAGGG - Intergenic
977172295 4:93778470-93778492 CCTAGGAGGCAAAGGTTCCAGGG - Intergenic
977319168 4:95489376-95489398 CCTGGGAGGCAGAGAGAAGTGGG + Intronic
977638721 4:99330972-99330994 CCCAGGAGGCAGAGGTTACAGGG - Intergenic
978474026 4:109105396-109105418 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
978504631 4:109443482-109443504 TCTGGGAGGCAGAGGTTGGAGGG - Intronic
978787904 4:112630440-112630462 CCTGGGAGGCAGAGGCTTCAGGG + Intronic
979145826 4:117246575-117246597 CAGAGGAGGCAGAGGGAACAGGG + Intergenic
979434251 4:120670493-120670515 CCTTGGAGGAAGTGGGAAGAAGG + Intergenic
979807522 4:124993068-124993090 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
980134381 4:128845846-128845868 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
980375326 4:131938940-131938962 CCTACACTGCAGAGGGTAGAGGG + Intergenic
980693160 4:136321403-136321425 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
980783170 4:137517624-137517646 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
981057536 4:140380271-140380293 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981272781 4:142864073-142864095 CATAAGAGACAGAAGGTAGAAGG - Intergenic
981312747 4:143312989-143313011 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
981974228 4:150704104-150704126 CCTTGGAGGCTGAGGTGAGAGGG + Intronic
982188202 4:152824235-152824257 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
982631647 4:157838014-157838036 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
982664938 4:158250615-158250637 GCAAGGGGTCAGAGGGTAGAGGG - Intronic
982687345 4:158506808-158506830 CCTGGGAGGCAGAGGTTGCAAGG + Intronic
982789884 4:159578756-159578778 CCCAGGAGGCAGAGGTTTCAGGG - Intergenic
983018677 4:162647252-162647274 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
984021000 4:174484704-174484726 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
984274352 4:177591649-177591671 CCTAGCAGGATGAGAGTAGATGG - Intergenic
985058352 4:186055474-186055496 GCTAGGAAGCAGAGGGTAGCAGG - Intergenic
985125989 4:186694884-186694906 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
985482360 5:122493-122515 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
985915708 5:2917552-2917574 CCAAGGAGGCGTAAGGTAGAAGG + Intergenic
986178584 5:5372867-5372889 CTGAGGAGGCAGAAGGCAGAAGG + Intergenic
986408689 5:7453526-7453548 CTTAGGAGGCAGAAGGCAGAAGG + Intronic
986691869 5:10319949-10319971 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
986699562 5:10392676-10392698 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
986710755 5:10486499-10486521 CCATGGAGGCAGAGGTTACAGGG + Intergenic
986742092 5:10713176-10713198 CCTAGGAAGCAAAGGTTACAGGG + Intronic
986850526 5:11807363-11807385 TCTGGGAGGCAGAAGGTAGTAGG - Intronic
987080525 5:14421526-14421548 CCCAGGAGGCAGAGGTTGTAGGG + Intronic
987169149 5:15235270-15235292 TCTTGGAGGCAGAGAGAAGATGG + Intergenic
987384806 5:17319083-17319105 CCCAGGAGGCAGAGGCTGCAGGG - Intergenic
987665998 5:20940800-20940822 CCCAGGAGGCAGAGGTTTCAGGG - Intergenic
988140822 5:27237512-27237534 CCCAGGAGGCAGAGGCTGCAGGG + Intergenic
988481512 5:31635356-31635378 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
988756688 5:34261371-34261393 CCCAGGAGGCAGAGGTTTCAGGG + Intergenic
988796084 5:34655141-34655163 CCTAGTAGGGAGAGGGAGGAAGG + Intergenic
988856803 5:35234965-35234987 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
988890469 5:35610871-35610893 CCTTGGAGGCAGAGGTTGCAGGG + Intergenic
989160786 5:38388682-38388704 CCTAGGAGGGAGAGGTTGCAGGG + Intronic
989476721 5:41882866-41882888 CCGAGGAGGCATAAGGCAGAAGG + Intergenic
990407530 5:55505979-55506001 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
990464314 5:56057652-56057674 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
990466314 5:56074866-56074888 CTTAGGAGGCTGAGGGAGGAGGG + Intergenic
990562467 5:56996734-56996756 CCTCGGAGGCAGAGGTTTCAGGG + Intergenic
991699635 5:69305287-69305309 CCCAGGAGGTAGAGGCTACAGGG - Intronic
991771095 5:70041996-70042018 CCCAGGAGGCAGAGGTTGCATGG - Exonic
991850387 5:70917413-70917435 CCCAGGAGGCAGAGGTTGCATGG - Exonic
991909522 5:71547870-71547892 CCCAGGAGGCAGAGGGGCGGAGG + Intronic
991930085 5:71745818-71745840 CCAAGGTGGCAGTGGGTAGGCGG - Intergenic
992240472 5:74764859-74764881 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
992258583 5:74947434-74947456 CGTAGGAGAGAGAGGGAAGAAGG - Intergenic
992703147 5:79361156-79361178 CCTAGCAGCCAGAGTGAAGAGGG + Intergenic
992911294 5:81398473-81398495 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
993310034 5:86318090-86318112 CCTGGGAGGCAGAGGATGCAGGG - Intergenic
993793157 5:92232753-92232775 CCCAGGAGGCAGAGGTTTCAGGG - Intergenic
995381136 5:111534646-111534668 ACTGGGAGGGAGAGAGTAGAAGG + Intergenic
996066402 5:119084194-119084216 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
996741753 5:126806028-126806050 CCCAGGAGGCAGAGGTTGAAAGG - Intronic
996816504 5:127579577-127579599 CCTGGGAGGCTGAGGTGAGAAGG + Intergenic
997116657 5:131132462-131132484 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
997243254 5:132324082-132324104 CTTAGGAGGCAGAGGTGGGAGGG + Intronic
997325855 5:133020366-133020388 CCTGGGAGGCAGAGGCTGCAAGG + Intronic
997514412 5:134476504-134476526 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
997535636 5:134618920-134618942 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
997555281 5:134792099-134792121 CCTGGGAGGCACAGGGTGTAGGG + Intronic
997954309 5:138266755-138266777 CCCAGGAGGCAGAGGTTGCAAGG - Intronic
997988763 5:138526535-138526557 CCTGGGGGGCAGGGGGTAGGCGG - Intronic
998080935 5:139274342-139274364 CCTAGGGAGAAGAGGGAAGAGGG - Intronic
998241646 5:140451614-140451636 CTTGGGAGGCTGAGGGCAGAGGG - Intronic
998243478 5:140473102-140473124 CCCAGGAGGCAGAGGCTGCAGGG - Intronic
998339062 5:141400149-141400171 CCTGGGGGTCAGAGGGTACAGGG - Exonic
999762873 5:154716193-154716215 CCCGGGAGGCAGAGGGTGCAGGG - Intronic
999940029 5:156532032-156532054 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1000317383 5:160105460-160105482 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1000487081 5:161860440-161860462 CCATGGAGACAGAGAGTAGAAGG + Intronic
1001069916 5:168576953-168576975 CCCAGGAGGCGGAGGTTACAGGG - Intronic
1001310355 5:170605848-170605870 CCCAGGGGGCAGAGGTTACAGGG - Intronic
1001465854 5:171965448-171965470 CCCAGGAGGCAGAGGTTACAGGG + Intronic
1001490275 5:172149969-172149991 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1001625153 5:173126214-173126236 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1001825818 5:174744132-174744154 CCTAGGAGGCTGAGGCAGGAGGG + Intergenic
1001958010 5:175861595-175861617 CCTAGAAGGGAGACGGCAGAGGG + Intronic
1002127947 5:177060730-177060752 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1002182306 5:177437028-177437050 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1003101219 6:3177828-3177850 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1003244171 6:4370183-4370205 CAGAGCAGGCAGAGGGGAGATGG + Intergenic
1003585624 6:7386660-7386682 CCTGGGAGGTAGAGGTTACAGGG - Intronic
1003673776 6:8183708-8183730 ACTTAGAGGCAGAGGGAAGATGG + Intergenic
1004142104 6:13027749-13027771 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1004227003 6:13794724-13794746 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1004522233 6:16372838-16372860 CCTGGGAGACAGAGGCTATAGGG + Intronic
1004547921 6:16616462-16616484 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1004664970 6:17741310-17741332 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1004929324 6:20446639-20446661 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1004966289 6:20855365-20855387 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1005224211 6:23622745-23622767 CCTAGGAGGCTGAGGTTGCAGGG + Intergenic
1005504873 6:26460832-26460854 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1005516612 6:26560360-26560382 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1005726734 6:28656607-28656629 CCTAAGAGAAAGATGGTAGATGG + Intergenic
1005942183 6:30568822-30568844 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1006516692 6:34549469-34549491 CCTGGGAGGCAAAGGGTTCAAGG - Intronic
1006540351 6:34735027-34735049 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1006612699 6:35304055-35304077 CCCGGGAGGCAGAGGTTACAGGG + Intronic
1006919792 6:37619871-37619893 GCTGGGAGGCAGTGGGTAGCGGG - Intergenic
1007339321 6:41180452-41180474 CCTGGGAGGCGGAGGTTACAGGG + Intergenic
1007599603 6:43073569-43073591 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1007934306 6:45719479-45719501 CCTGGGAGGTAGAGGAGAGATGG + Intergenic
1008606989 6:53150148-53150170 CTTAGGAGGCAGAGATGAGAAGG + Intergenic
1010022142 6:71173209-71173231 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1010201356 6:73284918-73284940 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1010231516 6:73539364-73539386 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1010255676 6:73754482-73754504 TGTAGGAGGCAGAGGGGAGATGG + Intronic
1010391208 6:75339870-75339892 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1011442068 6:87398004-87398026 CCAAGCAGGCATAGGGTAGCAGG + Exonic
1011722147 6:90168276-90168298 CCCAGGAGGCAGAGGATGCAGGG + Intronic
1012145894 6:95681101-95681123 CCCAGGAGGCAGAGGTTTCAGGG + Intergenic
1012512741 6:100023037-100023059 CCTGGGAGGCTGAGTGAAGAGGG + Intergenic
1012638090 6:101572922-101572944 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1012793145 6:103726087-103726109 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1013074520 6:106759491-106759513 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1013119808 6:107131411-107131433 CCCAGGAGGCGGAGGTTATAGGG - Intergenic
1013489712 6:110634290-110634312 CCTAGGAGGTAGAGGTTGCAGGG - Intronic
1013523747 6:110955831-110955853 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1013751161 6:113408159-113408181 CCTTGGAAGCATAGTGTAGAGGG + Intergenic
1014031033 6:116704648-116704670 CCCAGGAGGCAGAGGTTGCAAGG - Intronic
1014067468 6:117144325-117144347 CTCAGGAGGCTGAGGCTAGAGGG + Intergenic
1014081870 6:117296614-117296636 CCATGGAGACAGAGAGTAGAAGG + Intronic
1014109773 6:117607538-117607560 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1014112606 6:117636424-117636446 CTCAGGAGGCTGAGGGGAGAGGG - Intergenic
1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG + Intronic
1014879361 6:126703757-126703779 CCTAGGAGTCAGAGCTTAGTTGG - Intergenic
1015284109 6:131465336-131465358 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1015431191 6:133131851-133131873 ACTAGGAGGCCAAGGGCAGAAGG + Intergenic
1016056374 6:139581961-139581983 CCTAGGTGACAGAGTGAAGATGG - Intergenic
1016124824 6:140386849-140386871 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1016343533 6:143086800-143086822 CCTAGGAGGTATAGGTCAGAAGG + Intronic
1016380591 6:143474381-143474403 CCTCGGAGGCAGAGGTTTCAGGG + Intronic
1016466297 6:144328857-144328879 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1017103585 6:150867871-150867893 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1018087086 6:160312193-160312215 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1018476625 6:164148899-164148921 ACTAAAAGGAAGAGGGTAGAGGG + Intergenic
1018520052 6:164639121-164639143 CCTTGAGGGCAGAGGGTAGGAGG - Intergenic
1018701778 6:166432917-166432939 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1019503390 7:1376952-1376974 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1019558884 7:1646103-1646125 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1019672834 7:2291520-2291542 CCCAGGAGGCAGAGGCTGCAGGG + Intronic
1019693334 7:2430389-2430411 CCCAGGAGGCAGAGGTTGCAAGG - Intronic
1019935185 7:4250417-4250439 CCCAGGAGGCGGAGGTTAGAGGG - Intronic
1020166973 7:5814922-5814944 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1020176324 7:5885042-5885064 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020190871 7:5996477-5996499 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020214658 7:6180402-6180424 CCTATGAGACAGAGAGGAGAAGG + Intronic
1020321014 7:6938925-6938947 CCCAGGAGGCAGAGGTTTCAGGG + Intergenic
1020557048 7:9683102-9683124 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1020705949 7:11544264-11544286 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020750057 7:12129646-12129668 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1020907919 7:14088371-14088393 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1020953718 7:14712593-14712615 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1021645149 7:22782397-22782419 CCTGACAGGCAGAGTGTAGAAGG - Intergenic
1021679474 7:23115617-23115639 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1022227182 7:28375323-28375345 CCATGGAGACAGAGAGTAGAAGG + Intronic
1022236882 7:28470252-28470274 CCATGGAGATAGAGGGTAGAAGG - Intronic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022665215 7:32404459-32404481 CCCAGGAGGCAGAGGCAGGAGGG - Intergenic
1022699955 7:32750362-32750384 CCTGGGAGGCGGAGGCTACAGGG + Intergenic
1022736297 7:33079396-33079418 CCTAGGAGGCATAAAGCAGAAGG + Intergenic
1023246091 7:38205811-38205833 ATTAGAAGGCAGAGGGTAGAGGG - Intronic
1023494787 7:40783558-40783580 CATAAGAGTCAGAGGGGAGAAGG + Intronic
1023647165 7:42330092-42330114 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1023787480 7:43722473-43722495 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1023793204 7:43770131-43770153 CCTAGCTTGCAGAGGGCAGAAGG - Intronic
1024206946 7:47171476-47171498 CCTAGGAGGTAGAGGTTGCAGGG + Intergenic
1024374124 7:48618574-48618596 GCCAGGAGGCAGAGGGCAGCTGG + Intronic
1025217530 7:57071171-57071193 CCCAGGAGGCAGAGGTTGTAGGG - Intergenic
1025653821 7:63499294-63499316 CCCAGGAGGCAGAGGTTGTAGGG + Intergenic
1025946430 7:66108368-66108390 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1026217298 7:68361101-68361123 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1026286008 7:68963446-68963468 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1026418469 7:70207933-70207955 CCCAGGAGGCAGAGGTTGTAGGG + Intronic
1026530800 7:71195653-71195675 CTTAGGAGGCTGAGGAGAGAGGG - Intronic
1026811934 7:73474697-73474719 CCCAGGAGGCAGAGGTTTCAGGG + Intronic
1026980498 7:74523928-74523950 CCGAGGTGGGAGAGGGTGGAAGG + Intronic
1027166630 7:75839241-75839263 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1027202158 7:76070979-76071001 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1027390838 7:77702039-77702061 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1027560575 7:79724030-79724052 CGTGGGAGGCAGAGAGTATAAGG - Intergenic
1027993290 7:85392407-85392429 ACTAGGAGGCATAGGGCAGAAGG + Intergenic
1028094086 7:86739051-86739073 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1028905753 7:96152327-96152349 CCTAGGGAGCAGAGGGGAGAGGG + Intronic
1029364993 7:100111044-100111066 ACAAGGGGGCAGAGGGAAGAGGG - Intronic
1029395081 7:100302417-100302439 CCCAGGAGGCAGAGGTTGCAAGG - Intergenic
1029578232 7:101418379-101418401 CCTAAGAGACAGAAAGTAGATGG - Intronic
1029609319 7:101618277-101618299 CCAAGCAGGCAGGGGGTAGCAGG + Intronic
1029630148 7:101745161-101745183 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1029831866 7:103268809-103268831 CCCAGGAGGCAGAGGCTGCAGGG + Intergenic
1029874874 7:103739776-103739798 TCTAGGAGGCAAAGAGTAGAAGG + Intronic
1030653602 7:112142049-112142071 TCTAGGAGCCAGATGGGAGAGGG + Intronic
1031229607 7:119088544-119088566 CCTGGGAGGCAGAGGTTTCAGGG + Intergenic
1031389480 7:121195994-121196016 CCTAGAAGGCCGGGGGGAGATGG + Intronic
1031508659 7:122620980-122621002 CCCAGGAGGTTGAGGGTACATGG - Intronic
1031513673 7:122677335-122677357 GCCAGGAGACAGTGGGTAGAGGG + Intronic
1031622492 7:123951695-123951717 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1031936139 7:127737497-127737519 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG + Intergenic
1032077808 7:128844328-128844350 CATAGGGGGCAGAGGCCAGAGGG + Intronic
1032090239 7:128908051-128908073 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1032200418 7:129818647-129818669 CCTGGGAGGCAGAGGTTGCAAGG - Intergenic
1032339435 7:131057245-131057267 TCTAGGAGGCAGAGAGTCTAAGG - Intergenic
1032376745 7:131427627-131427649 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1032559460 7:132873487-132873509 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1032762148 7:134953398-134953420 CCTGGGAGGCAGAGGTTAGCTGG + Intronic
1032862536 7:135894102-135894124 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1033306402 7:140229112-140229134 CCTAGGAGGCGGAGGTTGCAGGG + Intergenic
1033638378 7:143234985-143235007 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1033707310 7:143902122-143902144 CCCAGGAGGCAAAGGGCAGCGGG + Exonic
1034540083 7:151752398-151752420 CTTAAGAGGCAGAGGGTGGGAGG + Intronic
1034630371 7:152525832-152525854 CCCAGGAGGCAGAGGTTGCAAGG + Intergenic
1034820066 7:154208832-154208854 TTTAGGAGGCAGAGTGTAGGAGG - Intronic
1034921398 7:155085497-155085519 GCTAGGAGGCCGAGGCTAGTAGG + Exonic
1035005993 7:155661481-155661503 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1035772259 8:2156968-2156990 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1035906201 8:3512682-3512704 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1036181949 8:6593428-6593450 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1037056852 8:14453025-14453047 CCCAGGAGGCAGAGGCTGCAGGG + Intronic
1037296125 8:17402439-17402461 ACATGGAGACAGAGGGTAGAAGG - Intronic
1037474837 8:19246775-19246797 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1037946316 8:22991705-22991727 CCAAGAAGGCAGAGGGTAAGGGG + Intronic
1038013192 8:23491140-23491162 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1038193221 8:25343072-25343094 CCTGGGAAGCAGAGGTTAGAGGG - Intronic
1038621554 8:29148127-29148149 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1038741956 8:30224176-30224198 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1039165893 8:34679729-34679751 TGTAGGAGGCATAGGGTACAGGG - Intergenic
1039347503 8:36723570-36723592 CCTGGGAGGCAGAGGATGCAGGG + Intergenic
1039364689 8:36917456-36917478 CCTAGGAGGCTGAGGTGAGAGGG - Intronic
1039495013 8:37974070-37974092 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1039495639 8:37978081-37978103 CCTAGGAGGCTGAGGCAGGAGGG - Intergenic
1039546091 8:38412595-38412617 CCTAGGAAGAAGAGGTTACAAGG + Exonic
1039569996 8:38579167-38579189 CCCAGGAGGCAGAGGTTGTAGGG - Intergenic
1039710033 8:40046440-40046462 CCCAGGAGGCAGAGGTTGCAAGG - Intergenic
1039789942 8:40867512-40867534 ACGAAGAGGCAGAGGGTGGAGGG - Intronic
1039798535 8:40935247-40935269 CCTAGTAGGCAGAGGGGCTACGG + Intergenic
1039824495 8:41161519-41161541 TCTAGGAGGTGGAGGGTGGACGG - Intergenic
1039959040 8:42230797-42230819 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1039965101 8:42278278-42278300 CCTGGGTGGCTGAGGGTGGACGG + Intronic
1040029389 8:42810479-42810501 CCTAGGAGGTAGAGGCTGCAGGG + Intergenic
1040349509 8:46550149-46550171 CCAAGGAGGCAGAGGTTGCAGGG + Intergenic
1040644017 8:49377314-49377336 CCCATGAGGCAGAGGTTACAGGG + Intergenic
1041153738 8:54962567-54962589 CCTGGGTGGCAGAGGTGAGATGG - Intergenic
1041238251 8:55826721-55826743 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1041266363 8:56069372-56069394 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1041517408 8:58715694-58715716 CCTTGGAGGTAGACTGTAGACGG + Intergenic
1041610123 8:59836461-59836483 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1042207427 8:66343363-66343385 CCCAGGAGGCAGAGGCTGCAGGG + Intergenic
1042855084 8:73258736-73258758 CTCAGGAGGCTGAGGGTAGAAGG - Intronic
1042883833 8:73525058-73525080 CCTAGGAGGTAGAAAGTAGGGGG - Intronic
1043199648 8:77350727-77350749 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1043263926 8:78238161-78238183 CCCAGGAGGCAGAAGTTACAGGG + Intergenic
1043452173 8:80378843-80378865 GTAAGGAGACAGAGGGTAGAAGG - Intergenic
1043557614 8:81450641-81450663 CCATGGAGACAGAGAGTAGAAGG - Intergenic
1043997049 8:86830691-86830713 CCTAGAAAGGAGAGGATAGATGG + Intergenic
1045264168 8:100604972-100604994 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1045341334 8:101257358-101257380 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1046114602 8:109769596-109769618 CCTAGGAGTCAGAGGTTAGAAGG - Intergenic
1046468924 8:114642794-114642816 CCTGCGAGGCAGAGGTTGGAGGG - Intergenic
1046720385 8:117612485-117612507 CCTGGGAGGCAGAGGTTGGGAGG - Intergenic
1047267376 8:123319052-123319074 CCTGGGAGGCTGAGGGCAGGAGG - Intergenic
1047322195 8:123796983-123797005 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1048365380 8:133733594-133733616 CCAAGGGTGCAGATGGTAGAAGG - Intergenic
1049235846 8:141511888-141511910 CCCCGGAGGCAGAGGTTGGAGGG + Intergenic
1049472311 8:142781969-142781991 CCCTGGAGGCACAGGGCAGAGGG + Intergenic
1049775732 8:144403626-144403648 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1050995924 9:12217651-12217673 CCCGGGAGGCAGAGGGTGCAGGG - Intergenic
1051247061 9:15122590-15122612 CCCAGGAGGCAGAGGCTGCAGGG + Intergenic
1052836997 9:33258218-33258240 CCTGGCAGGCAGAGGCTACAGGG + Intronic
1053221778 9:36318594-36318616 CCTGGGAGGCAGAGGTTACAGGG + Intergenic
1053640383 9:40069606-40069628 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1053765752 9:41395867-41395889 CCTACACTGCAGAGGGTAGAGGG - Intergenic
1054321078 9:63665602-63665624 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1054352828 9:64033014-64033036 CTTAGGAGGCTGAGGTGAGAGGG - Intergenic
1054544365 9:66307020-66307042 CCTACACTGCAGAGGGTAGAGGG - Intergenic
1055214733 9:73845376-73845398 CTCAGGAGGCTGAGGGAAGAAGG + Intergenic
1055243894 9:74217703-74217725 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1055283026 9:74696719-74696741 GCCAGGAGGCAGAGGGAACAAGG + Intergenic
1055395445 9:75869016-75869038 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1056013994 9:82362791-82362813 CCTAGGAGACACAGTGCAGATGG + Intergenic
1056018471 9:82417198-82417220 CTTAGGAGGCCTAGGGAAGAAGG - Intergenic
1056270862 9:84947029-84947051 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1056415336 9:86370133-86370155 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1056540136 9:87564014-87564036 CCAAGGAGGAAAAGGGGAGACGG - Intronic
1056628246 9:88271921-88271943 CTTGGGAGGCTGAGGGTAGGAGG + Intergenic
1056851431 9:90087885-90087907 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1057083589 9:92189743-92189765 CCTCGGAGGCAGAGGGCAGGGGG - Intergenic
1057214140 9:93218866-93218888 CTTCGGAGGCAGGGGGAAGAGGG - Intronic
1057219693 9:93249987-93250009 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1057326311 9:94067675-94067697 CTTGGGAGGCAGAGGTTACAGGG - Intronic
1057632452 9:96731536-96731558 CCTAGGAGGCAGAGGTTGCAGGG - Intergenic
1057939311 9:99266937-99266959 GCTAGGAGGCAGAGGAAAGAAGG - Intergenic
1058227884 9:102389099-102389121 CCCAGGAGGCAGAGGTTCCAGGG + Intergenic
1058257128 9:102780940-102780962 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1058440145 9:104999012-104999034 CCCAGGAGGCAGAGGCTGCAGGG + Intergenic
1058484196 9:105427009-105427031 CCTAGGAGGCGGAGGTTGGAGGG - Intronic
1058603202 9:106693420-106693442 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1058959341 9:109978158-109978180 CTGAGGTGGCAGAGGGGAGATGG + Intronic
1059083627 9:111276131-111276153 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1059109416 9:111541163-111541185 CCCAGGAGGCGGAGGTTACAGGG - Intronic
1059115034 9:111593759-111593781 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1059640083 9:116207944-116207966 ACTAGGAGACAGAGGGTATAAGG - Intronic
1059901439 9:118930739-118930761 CCTAGGAGGCAGAAGGCAGAAGG - Intergenic
1059931740 9:119267558-119267580 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1060076616 9:120596092-120596114 CCCAGGAGGCAGAGGTTGCAGGG + Intergenic
1060077111 9:120601764-120601786 CCTAGGGGATAGAGGGTAGAGGG + Exonic
1060111492 9:120909885-120909907 CCCTGGAGGCTGAGGGTACATGG + Intronic
1060275234 9:122177506-122177528 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1060297546 9:122353436-122353458 CCCAGGAGGCAGAGGTTGCAAGG - Intergenic
1060342963 9:122792976-122792998 CCTTGAAGGGAGAGTGTAGAGGG - Intergenic
1060396340 9:123319441-123319463 CCTCGGAGGGAGAGCATAGAGGG - Intergenic
1060515070 9:124260467-124260489 CCCAGGAGGCAGAGGGTGCAGGG - Intronic
1060691723 9:125667393-125667415 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1061240112 9:129365116-129365138 CCTATGAGGCAGAGCGGTGAAGG + Intergenic
1061351898 9:130072045-130072067 CCGAGGAGGCAGAGGCTGCAGGG - Intronic
1061391093 9:130317568-130317590 CCCAGGAGGCAGAGGTTGGAGGG - Intronic
1061392295 9:130324178-130324200 CCCAGGGGGCTGAGGGGAGACGG - Intronic
1061416014 9:130447202-130447224 CCTAGGAGCCAGGGAGTGGAAGG + Intronic
1061524427 9:131146852-131146874 CCTAGGAGGCAGAGATTGCAGGG + Intronic
1061558021 9:131383992-131384014 CCCAGGAGGCAGAGGGTCCAAGG - Intergenic
1061610547 9:131742553-131742575 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1061640248 9:131948409-131948431 CCCAGGAGGCAGAGGTTGCAGGG + Intronic
1061673748 9:132203800-132203822 CCTGGGAGTCAGAGGGAAGGGGG + Intronic
1061816422 9:133199943-133199965 CCAAGGAGGCTGGGGATAGAAGG + Intergenic
1061877492 9:133551903-133551925 CCTAGGAGGCGGAGGTTGCAGGG - Intronic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062356566 9:136167369-136167391 TCAAGAAGGCAGAGGGAAGATGG - Intergenic
1062400962 9:136372441-136372463 TCCAGGAGGCAGAGGCCAGAGGG - Intronic
1062451106 9:136616188-136616210 CCGAGTGGGCAGAGGGGAGACGG - Intergenic
1062496112 9:136832533-136832555 TCTGGGTGGCAGAGGGTACAGGG + Intronic
1062709488 9:137966612-137966634 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1202788153 9_KI270719v1_random:52679-52701 CCTACACTGCAGAGGGTAGAGGG + Intergenic
1185602775 X:1351702-1351724 CCCAGGAGGCAGAGGTTGCATGG - Intronic
1185894789 X:3848295-3848317 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1185899907 X:3886720-3886742 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1185905023 X:3925148-3925170 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1185972707 X:4682297-4682319 CCTGGGAGGCAGAGGCTGCACGG + Intergenic
1186033712 X:5397502-5397524 GCAAAGAGGCAGAGGCTAGAGGG + Intergenic
1187381614 X:18807103-18807125 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1187471081 X:19570283-19570305 TCTGTGAGGCAGAGGGTAGTGGG + Intronic
1187920049 X:24192785-24192807 CCTAGGAGGCTGAGGTGGGAGGG + Intronic
1188043569 X:25399289-25399311 ACTAGAAGGCAGAGGGAGGAAGG + Intergenic
1189402829 X:40688139-40688161 CCTAGGAGGCAGAGGTTGGGAGG + Intronic
1189451495 X:41136234-41136256 CCCAGGAGGCAGAGGCTCCAAGG - Intronic
1189484854 X:41422526-41422548 CCCAGGAGGCAGAGGTTGCAAGG - Intergenic
1189666342 X:43358885-43358907 CTTATGTGGCAGAAGGTAGAAGG + Intergenic
1189838245 X:45042250-45042272 CCGTGGAGGGAGAGGGGAGAGGG + Intronic
1189929398 X:45992147-45992169 CCATGGAGGTAGAGAGTAGAAGG - Intergenic
1190919104 X:54834001-54834023 CCCAGGAGGCAGAGGTTACAGGG - Intergenic
1191146422 X:57170585-57170607 CTCAGAAGGCAGAGTGTAGAAGG - Intergenic
1191861437 X:65668712-65668734 CCCAGGAGGGAGAGGGGAGGAGG + Intronic
1192119970 X:68446401-68446423 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1192176222 X:68887202-68887224 CCTAGGAGACAAAAGGGAGAGGG - Intergenic
1192410511 X:70929164-70929186 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1193699671 X:84745538-84745560 CCTGGGAGGCGGAGGCTACAGGG - Intergenic
1193947914 X:87762198-87762220 CCTAGGAGGCGGAGGTTGCAGGG - Intergenic
1194110797 X:89831840-89831862 CCTAGGAGACAGAGTGTTGAAGG + Intergenic
1194901715 X:99520238-99520260 CATAGGCAGCAGAGGGTAGCAGG - Intergenic
1195238379 X:102925400-102925422 CCATGGAGATAGAGGGTAGAAGG - Intergenic
1195250327 X:103038181-103038203 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1195278726 X:103309981-103310003 CCTAGGAGACAGAGAGAAAATGG + Exonic
1195527437 X:105908148-105908170 CCTAAGAAGCAGAGGGAACAAGG + Intronic
1196435210 X:115668009-115668031 CCTAGGAGGCACAGGTTGCAGGG - Intergenic
1196864705 X:120060341-120060363 GCTGGGAGCCAGAGGGGAGAGGG - Intergenic
1196878396 X:120175990-120176012 GCTGGGAGCCAGAGGGGAGAGGG + Intergenic
1197032423 X:121833539-121833561 CCATGGAGTGAGAGGGTAGAAGG + Intergenic
1197257467 X:124279135-124279157 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1197740888 X:129893087-129893109 CCCAGGAGGCAGAGGTTGCAGGG - Intergenic
1197755030 X:129987435-129987457 CCCAGGAAGCAGAGGTTAGCTGG + Intronic
1198045317 X:132896078-132896100 TCAAGGAGACAGAGAGTAGAAGG + Intronic
1198128702 X:133673015-133673037 CCCAGGAGGCAGAGGTTGCAGGG - Intronic
1198391363 X:136178518-136178540 CCCAGGAGGCAGAGGGTGCAGGG + Intronic
1198462359 X:136876197-136876219 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1199225573 X:145369227-145369249 CCTAGGAGGCAGAGGTTGCAGGG - Intergenic
1199338392 X:146646195-146646217 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1199764785 X:150933256-150933278 CCTAGGAGGCGGAGGCTGCAGGG + Intergenic
1199822195 X:151460762-151460784 CCTAGAGGGGAGAGGATAGAGGG - Intergenic
1200155244 X:153971612-153971634 CCTAGGAGGAAGAGAATAGGGGG - Exonic
1200411966 Y:2869737-2869759 CCTAAGAGACAGATGGAAGAAGG + Intronic
1200463458 Y:3486578-3486600 CCTAGGAGACAGAGTGTTGAAGG + Intergenic
1201422102 Y:13811058-13811080 CCTAGGAGCCAGAGGAGAGTGGG - Intergenic