ID: 915583442

View in Genome Browser
Species Human (GRCh38)
Location 1:156830046-156830068
Sequence GAGAGCAATGCTTAGACAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915583442_915583448 14 Left 915583442 1:156830046-156830068 CCCGCTGTCTAAGCATTGCTCTC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 915583448 1:156830083-156830105 GTCTCAGCACAGCCCGTCTGTGG 0: 1
1: 0
2: 1
3: 13
4: 135
915583442_915583451 29 Left 915583442 1:156830046-156830068 CCCGCTGTCTAAGCATTGCTCTC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 915583451 1:156830098-156830120 GTCTGTGGCTCCGCTCTGCAAGG 0: 1
1: 0
2: 2
3: 22
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915583442 Original CRISPR GAGAGCAATGCTTAGACAGC GGG (reversed) Intronic
905096702 1:35478218-35478240 GAGAGTAATGGTTAGATAGATGG + Intronic
908807074 1:67943032-67943054 GTGATCAATGCCTAGACAGGAGG + Intergenic
914386467 1:147173810-147173832 AGAAGCAATGCTTTGACAGCTGG + Intergenic
915583442 1:156830046-156830068 GAGAGCAATGCTTAGACAGCGGG - Intronic
915642336 1:157238356-157238378 GCGTGTAATGCTTAGACAACAGG + Intergenic
916189282 1:162163376-162163398 AAGAGCAGTGCCCAGACAGCAGG + Intronic
923361173 1:233212640-233212662 GAGGGCAGTGCTGAGACAGTAGG - Intronic
924651136 1:245928373-245928395 GAAAGAAATACTTAGACAGCTGG + Intronic
924818807 1:247467545-247467567 GAGAGAGATTCTTAGACAGATGG + Intergenic
1063056001 10:2504999-2505021 GAGAGAAATGGACAGACAGCTGG - Intergenic
1070528521 10:77316031-77316053 AAGAGCAATGCTTAGAAACCTGG + Intronic
1071166646 10:82815709-82815731 GTGAGCAATACTTAGGCAGAAGG - Intronic
1071424256 10:85532506-85532528 GAGAGGAAGGCATAGACAGCAGG - Intergenic
1072682407 10:97516833-97516855 GAGAGCAACGCCTTGACAGCTGG + Intronic
1077822618 11:5764250-5764272 GAGAGCAATGCTTTGGCATAAGG - Intronic
1078294358 11:10052036-10052058 GAGGAAAATGTTTAGACAGCTGG + Intronic
1085812444 11:79696402-79696424 GAGATCAAAGTTTAGAAAGCAGG - Intergenic
1085812627 11:79698574-79698596 GAGATCAAAGTTTAGAAAGCAGG - Intergenic
1087132221 11:94678195-94678217 GAGAGCAAAGCTGAAACAGTGGG + Intergenic
1088581477 11:111320842-111320864 CAGAGCTAGGCATAGACAGCTGG + Intergenic
1091385751 12:93495-93517 GAGAGCAAGGCAGAGACAGAGGG + Intronic
1094078965 12:26511780-26511802 GAGGCCAACGCATAGACAGCTGG + Intronic
1098789813 12:74807226-74807248 TAGACCTATTCTTAGACAGCTGG + Intergenic
1099135791 12:78898677-78898699 GAGAGCAGTGCAAAGCCAGCTGG - Intronic
1106654804 13:31731937-31731959 GACAGCAATGTCTAGCCAGCAGG - Intergenic
1106665845 13:31849475-31849497 GAGTGAAATACTTAGACAGGAGG - Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1108526923 13:51293363-51293385 GAGAGCAAAGCAGAGGCAGCGGG - Intergenic
1110338042 13:74354868-74354890 GAGAGCAAATCTTTTACAGCAGG + Intergenic
1112545359 13:100363335-100363357 GAGAGAGATGTTTAGACAGATGG - Intronic
1113342301 13:109438559-109438581 GAGAACACTCCTTAGACAGAGGG - Intergenic
1113819643 13:113204035-113204057 GAGAGCACGGCTTGGCCAGCAGG - Intronic
1114134906 14:19836249-19836271 GAGAGCTATGCTTAGTCTGATGG - Intergenic
1114672253 14:24417504-24417526 GAGAGCACTGCTGGGACAGGGGG - Exonic
1120219152 14:81713018-81713040 AAGAGCAAAGATTAGACAGAAGG - Intergenic
1125966501 15:43879601-43879623 GAAAGCAGTGATTAGTCAGCCGG + Intronic
1126373840 15:47974929-47974951 GAGAGCAAAGCAGAGAGAGCTGG + Intergenic
1134254729 16:12601651-12601673 GTGAGCAATGCTCAGGCAGAAGG + Intergenic
1136648156 16:31640787-31640809 GAGAGAACTGCTTAGATAGGAGG - Intergenic
1148653295 17:49265078-49265100 GAGAGCACTGCCTAGAAAACTGG - Intergenic
1148897102 17:50845375-50845397 GAGAGGAGTGCTCACACAGCCGG - Intergenic
1149307036 17:55357992-55358014 GAGAGCAATGAAGAGGCAGCTGG + Intergenic
1152043853 17:77923395-77923417 GAGCGCAGTGCTCAGAGAGCTGG + Intergenic
1159188444 18:65010086-65010108 GAGAACAGTGCTTAGCCAGTAGG - Intergenic
1161867450 19:6843629-6843651 GAGAGGAATGCTGAAACAGAGGG - Intronic
1161952638 19:7476455-7476477 GAGGGCACTGCTTAGTCTGCTGG - Intergenic
1166966619 19:46533047-46533069 GAGAGCCAGGCTTAGTCAGTGGG - Intronic
925222906 2:2156832-2156854 GAGAGCCCTGCTGAGACAGCAGG + Intronic
929892828 2:45933059-45933081 AAGAGCAATGCAAAGACATCAGG - Intronic
930464068 2:51722305-51722327 GAGAGCTATGTTTACACAGTAGG - Intergenic
932529231 2:72509136-72509158 GAGAGCAATCCTTCTTCAGCAGG + Intronic
936442319 2:112565523-112565545 GAGAGCATTACTGAGACAGCTGG - Intronic
939049332 2:137289122-137289144 GACAGCAATCCTTAGAAGGCAGG + Intronic
939865571 2:147468892-147468914 GAGTGCAATTGTAAGACAGCAGG + Intergenic
941601768 2:167551598-167551620 GAGGGCACTGCTTAGAGAGCAGG - Intergenic
943191339 2:184682237-184682259 GTCAGCAATGCTCAGACAGAAGG + Intronic
1168803700 20:660794-660816 GAGTGCACTGCTTACACAGGAGG + Intronic
1173395568 20:42676521-42676543 GAGAGCATTGTATATACAGCTGG - Intronic
1174751121 20:53112182-53112204 GAGAGCCCTGCTTAGGGAGCAGG + Intronic
1184508912 22:44920504-44920526 GAGGGCAACGCTGAGACAGGAGG + Intronic
955459572 3:59166318-59166340 GAGAGCACTGATTAGCCATCTGG + Intergenic
955599578 3:60630728-60630750 GAGAGGAAGGATTAGAAAGCTGG - Intronic
957482455 3:80816200-80816222 GAGAGAACTGCTTAGAGAGTTGG + Intergenic
960623770 3:119660681-119660703 CAGAGCCTTGCTGAGACAGCGGG - Intronic
962930288 3:140029672-140029694 ATGAGAAATGCTTATACAGCAGG + Intronic
962990794 3:140575330-140575352 CAGAGCAATGCTTTGGCATCTGG - Exonic
963125010 3:141807898-141807920 CAGAGCAACGCTTAGGAAGCAGG + Exonic
963602046 3:147387204-147387226 AAAAGCAATGCCTAGACATCAGG - Exonic
966646892 3:182256094-182256116 CAGAGCAATGATTACACTGCTGG - Intergenic
969836984 4:9850275-9850297 GGGAGAACTGCTTAGACAGGTGG + Intronic
971141260 4:23927662-23927684 AATAGGAATGCCTAGACAGCAGG - Intergenic
976481599 4:85553258-85553280 AAGAACAAAGCTTACACAGCAGG + Intronic
985695441 5:1337605-1337627 GAGGGCAGCGCTTAGAGAGCAGG - Intronic
989706375 5:44336587-44336609 TAGAGCAATGCTTATACATTTGG + Intronic
991515552 5:67431197-67431219 TAGAGCAATGCTTAGAACACAGG - Intergenic
998244523 5:140486772-140486794 GAGACTAATGATTAGACAGTCGG - Intronic
1000364738 5:160480346-160480368 AAGTGTAATGCTTAGACAACAGG - Intergenic
1001704891 5:173734565-173734587 GAGAGCCATGCTTTTTCAGCTGG - Intergenic
1002581183 5:180210186-180210208 GAGAACAAAGCTTCCACAGCAGG + Intergenic
1007618916 6:43199656-43199678 GAGAGCAAGGCTCAGGCACCAGG + Intronic
1010505364 6:76651202-76651224 GACAGTAATGTTTATACAGCAGG - Intergenic
1011535839 6:88375100-88375122 GAAAGCAATACTTCAACAGCTGG + Intergenic
1014365023 6:120529076-120529098 CAGAGCAAGGTTTAGACACCAGG + Intergenic
1014376751 6:120685050-120685072 GAGAACAATGCATGGACAGTAGG - Intergenic
1016884314 6:148944965-148944987 TAGAGCAATGCTCAGAAAGATGG - Intronic
1020800953 7:12731457-12731479 GAGGGCAGTGCTGAGACACCAGG + Intergenic
1020980178 7:15057111-15057133 GAGAGAAATGTAAAGACAGCGGG - Intergenic
1021112249 7:16708803-16708825 GAGAGGAATGCTCAAACAGCAGG + Intergenic
1022703619 7:32783645-32783667 GAGATGAATGCCAAGACAGCTGG + Intergenic
1024201048 7:47106046-47106068 GTGAGCAGTGCTCACACAGCTGG + Intergenic
1025196267 7:56936675-56936697 CAGATCATGGCTTAGACAGCAGG - Intergenic
1025675680 7:63640257-63640279 CAGATCATGGCTTAGACAGCAGG + Intergenic
1029203611 7:98855352-98855374 GACAGCAATCCTTAGCCACCAGG - Intronic
1029290601 7:99499698-99499720 GAGAGCACTGCCCAGAGAGCGGG - Exonic
1030394776 7:108972206-108972228 CTGGGCATTGCTTAGACAGCTGG - Intergenic
1031754344 7:125618808-125618830 GCGAGCAATGCTGAGACAACTGG - Intergenic
1037113361 8:15193634-15193656 GAGAACAATGCTTAGAAATACGG - Intronic
1038533813 8:28339538-28339560 GGGAGCAAGGCTAAGACAGTTGG - Intronic
1039196995 8:35043710-35043732 TAGAGCAGTGCTAAGACAGGTGG + Intergenic
1040339874 8:46435093-46435115 GGGAGAAGTGCTTAGACTGCAGG - Intergenic
1040644629 8:49383921-49383943 GACAGGAATGCACAGACAGCAGG + Intergenic
1041219157 8:55631933-55631955 GTGAGAAAAGCTTAGACAGATGG - Intergenic
1042964206 8:74333528-74333550 AAGAGCAATGTTGAGACAGGAGG + Intronic
1044483763 8:92725017-92725039 GAGAAAAAAGCTTAGAAAGCAGG - Intergenic
1048207670 8:132428268-132428290 GAGAAGAATGCCTAGACAGCAGG - Intronic
1048415924 8:134227606-134227628 GAGAACAAGGCTTAGACAAGTGG - Intergenic
1049746220 8:144264431-144264453 GAGAGACCTGCATAGACAGCCGG + Exonic
1053433343 9:38058485-38058507 GAAAGCAGGGCTTTGACAGCAGG - Intronic
1056708909 9:88974749-88974771 GATGGCAATGCTCAGAGAGCTGG + Intergenic
1057189914 9:93081263-93081285 GAGAACAGCGCTTAGACACCGGG + Intronic
1060148592 9:121272050-121272072 GAGACCAGTGTTTAGGCAGCCGG + Intronic
1060211345 9:121712383-121712405 GGGAGCAATGCTTATGCAGCAGG + Intronic
1185946136 X:4378816-4378838 GAGAGCAAAGCTGAGGCTGCTGG - Intergenic
1195098743 X:101532531-101532553 GAGAGCAATGCTCAGAGCCCAGG + Intronic
1199713022 X:150485233-150485255 CAGAGCAATGCTTAGCCTTCAGG - Intronic