ID: 915586690

View in Genome Browser
Species Human (GRCh38)
Location 1:156847614-156847636
Sequence CGGGAAGTGCCTGCCTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915586690 Original CRISPR CGGGAAGTGCCTGCCTTTGT TGG Intronic
900227271 1:1539269-1539291 CGGGAAGGGCCTGCCTTGAGGGG - Intronic
902278171 1:15354523-15354545 TGGGAAGAGACTGCCTTTCTCGG - Intronic
902892847 1:19457045-19457067 CTGGAACTTCCTGCCTTTCTGGG - Intronic
903208699 1:21802717-21802739 CGGGGACAGCCTGCCTTTGCTGG - Intergenic
908761632 1:67518116-67518138 GGGGAATAGACTGCCTTTGTAGG + Intergenic
912924156 1:113898698-113898720 CAGGTAATGCCTGCCTTTTTAGG - Exonic
915125247 1:153659097-153659119 CGGTAACTGCCTGACCTTGTAGG + Intronic
915586690 1:156847614-156847636 CGGGAAGTGCCTGCCTTTGTTGG + Intronic
915641991 1:157234849-157234871 GGGGACCTGTCTGCCTTTGTAGG + Intergenic
1068142223 10:53023391-53023413 GGGGATGAGCCTGGCTTTGTAGG + Intergenic
1083521999 11:63322323-63322345 CGGGATGGGCTTTCCTTTGTAGG - Intronic
1083572414 11:63767854-63767876 GGAGGGGTGCCTGCCTTTGTGGG + Intronic
1084642220 11:70432778-70432800 GGGGTAGAGCCTGTCTTTGTTGG - Intronic
1084694220 11:70744248-70744270 CAGGAAGCTCCTGCCCTTGTGGG + Intronic
1084707683 11:70824784-70824806 CGGGAACTGCCTGTCATTGGAGG + Intronic
1087283867 11:96243360-96243382 CAGGAAGTGCCTGCCGTTTAAGG - Intronic
1095852926 12:46830729-46830751 CGGGAAGTGCCTGCCAGGATGGG + Intronic
1096939632 12:55328007-55328029 GGGGAATAGACTGCCTTTGTAGG + Intergenic
1097693785 12:62758381-62758403 AGGGAGGTCCCTGCCTGTGTGGG + Intronic
1101988060 12:109462656-109462678 TGGGAAGAGCCTGCCTCTCTTGG - Intronic
1103901232 12:124304500-124304522 CGGAAAGGGGCTGCCTTTGTCGG + Intronic
1104915671 12:132263158-132263180 CGGGAAGTGGCTGCCTGTGCGGG - Intronic
1105022178 12:132824160-132824182 CAGGACGTGCCTGTCTTTCTAGG + Intronic
1106576779 13:30982122-30982144 GGGGACTTGACTGCCTTTGTAGG + Intergenic
1108590263 13:51906704-51906726 CGGGGAGTGCCTGCCTGTGCTGG - Intergenic
1110053201 13:70931315-70931337 CGGGAACTGCCATCATTTGTTGG + Intergenic
1110220928 13:73072392-73072414 CTGGCAGTGCCAGCCTCTGTGGG - Intronic
1113259824 13:108549317-108549339 CTGGATGTGCCTGCATTTGTTGG - Intergenic
1113615367 13:111676634-111676656 CGAGAAGCCCCTGCCTTTCTTGG + Intergenic
1113620834 13:111761547-111761569 CGAGAAGCCCCTGCCTTTCTTGG + Intergenic
1113908256 13:113830290-113830312 GGGGAAGGGCCTGTCTTGGTGGG + Intronic
1118473672 14:66098131-66098153 AGGGAACTGACTGACTTTGTAGG - Intergenic
1119214338 14:72856921-72856943 CGGGAAGTGCCAGCCATCCTGGG + Intronic
1124252767 15:28117736-28117758 CAGGGAGTGACTGCCTGTGTTGG - Intronic
1124714840 15:32050687-32050709 GAGGAACTGCCTTCCTTTGTAGG + Intronic
1126746759 15:51833526-51833548 CAGGAAGTGATTGCCTTTGGAGG - Intronic
1131515795 15:93075740-93075762 CGGGTACTGGCTGCCTTTTTAGG + Intronic
1132275965 15:100564185-100564207 GGGGACGAGACTGCCTTTGTAGG + Intronic
1138760181 16:59534183-59534205 GGGGACCAGCCTGCCTTTGTAGG + Intergenic
1142094236 16:88231068-88231090 CGGGAAGGGCTTGCGTGTGTTGG - Intergenic
1144744354 17:17603772-17603794 CAGGAAGTGCCTGGCTTAGATGG + Intergenic
1144776386 17:17787112-17787134 CCAGGAGTGCCTGCCCTTGTAGG - Intronic
1146736745 17:35244494-35244516 GAGGCTGTGCCTGCCTTTGTGGG + Intronic
1146798760 17:35801802-35801824 CAGGAAGCGCCTGCCACTGTTGG + Intronic
1147293682 17:39463315-39463337 CTGGAAGTACCTACCTTTGGCGG - Intronic
1148557234 17:48585824-48585846 GGGAAAGTGCCAGCCTGTGTGGG - Intronic
1150839556 17:68595266-68595288 CAGGAAGTGCCTGTCTTTCTTGG + Intronic
1153180771 18:2430215-2430237 CAGCCAGTGCCTGCCTTTGAAGG + Intergenic
1153791921 18:8586600-8586622 CGGGAAGTGCCCACCTTCGTGGG + Intergenic
1155057106 18:22194535-22194557 AGTGAAGTGCCTGCTTTTGCAGG + Intronic
1155711865 18:28891027-28891049 CAGGAAGTGCCTCCCTTCCTTGG - Intergenic
1157568357 18:48695878-48695900 AGGGAACTTCCTGCCATTGTTGG + Intronic
1158524102 18:58197149-58197171 AGGGAAGTGCCTTCCTTTTTGGG + Intronic
1158745237 18:60192165-60192187 ACGGAAGTGCCTTCGTTTGTTGG + Intergenic
1160448169 18:78943202-78943224 CGGGAAATGCCTGGGTTTATAGG - Intergenic
1160744123 19:702688-702710 AGGCAAGTTCCTGCCCTTGTGGG + Intergenic
1165056662 19:33181516-33181538 AGGGCAGAGCCTGCATTTGTTGG + Intronic
1166978900 19:46621390-46621412 GGGGAGCTGCGTGCCTTTGTCGG - Exonic
926250343 2:11152279-11152301 TGGGACCTGTCTGCCTTTGTAGG - Intergenic
927143186 2:20143459-20143481 CTGGAAATGCCTGCCTTTTATGG + Intergenic
934887339 2:98036563-98036585 GGTGAAGAGCCTGCCTGTGTGGG - Intergenic
935448435 2:103181440-103181462 AGGGAAGAGCCTTCCTGTGTGGG - Intergenic
948587023 2:239026045-239026067 TGGGACGTGGCTGCCTCTGTGGG + Intergenic
948965509 2:241376558-241376580 CGGGACAAGCCTGCCTCTGTGGG - Intronic
1177250838 21:18588461-18588483 AGGGCAGTGCCTGCCTGTCTTGG - Intergenic
1178441854 21:32604814-32604836 CGGGAAGCGACTGCCTTTTCTGG + Intronic
1179407274 21:41136436-41136458 CGGGAAGTCCCTGCCCCTGCAGG + Intergenic
1180219784 21:46351207-46351229 CTGAAAGTGCCTGGCCTTGTGGG + Intronic
1184913240 22:47550036-47550058 GGCCAAGTGCCTGCCTCTGTAGG - Intergenic
949789986 3:7782255-7782277 GGGGACGTGTCTGCCTTTGCAGG - Intergenic
952278050 3:31896705-31896727 AGGGCAGTGCCTGCCTTAGAGGG + Intronic
953200964 3:40778208-40778230 CTGGAAGTTTCTGCCTTTGTTGG - Intergenic
953210222 3:40868938-40868960 CGGAATGTGGCTGCCTTTGAGGG + Intergenic
953549161 3:43887235-43887257 AGGTAAGTGCCAGCCATTGTGGG - Intergenic
954250403 3:49362937-49362959 TGTAAAGTGCCTGCCTTTGTGGG - Intronic
962970250 3:140394051-140394073 CGGGAAGTGCCTGTCTGGGCTGG + Intronic
963865273 3:150353980-150354002 GGGGCAGTGGCTGCCATTGTTGG + Intergenic
967984473 3:195084969-195084991 CTGGAAGTGGCTGCCTTGCTAGG - Intronic
969488789 4:7487001-7487023 CGGGAAGCGGCTGCATTTGCAGG + Intronic
971940049 4:33202257-33202279 AGGAAAGGGCCTGTCTTTGTTGG + Intergenic
982402366 4:154982541-154982563 CCAGAAGTGCCACCCTTTGTAGG - Intergenic
985231786 4:187826680-187826702 AGTGAAGTGTCTGCCTCTGTAGG + Intergenic
986765345 5:10920942-10920964 AGGGAGGTGCCTGGCTTTCTGGG + Intergenic
995200947 5:109424753-109424775 GGGGATGAGACTGCCTTTGTAGG + Intergenic
999438733 5:151584669-151584691 AGGATAGTACCTGCCTTTGTGGG - Intergenic
1001490437 5:172150968-172150990 CAGGACGTGCCTGCCCTTGGTGG - Intronic
1001512833 5:172335790-172335812 GGGGAAGTGTCTACCATTGTAGG + Exonic
1002044628 5:176535010-176535032 TGGGGAGTGGGTGCCTTTGTAGG - Intronic
1002535267 5:179872422-179872444 GAGGAAGTCCCTGCCTTTGGGGG + Intronic
1003330058 6:5122280-5122302 CTAGAAGTTCCTGACTTTGTGGG + Intronic
1003406872 6:5833469-5833491 AGAGAAGAGCCTGCCTTGGTTGG + Intergenic
1003514584 6:6807291-6807313 CAGGAAGGGCGTGCCTGTGTTGG + Intergenic
1005208346 6:23431138-23431160 TCTGAAGGGCCTGCCTTTGTGGG + Intergenic
1007858748 6:44885147-44885169 GGGGACCTGCCTGCCTCTGTAGG + Intronic
1012278965 6:97305885-97305907 CCAGATGTGCCTGCCTTTCTGGG + Intergenic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1015256675 6:131185361-131185383 CAGCATGTGCCTGCCTTTCTTGG - Intronic
1018727028 6:166620907-166620929 TGGGAAGTGCCTGACCTTGCCGG - Intronic
1024247006 7:47478087-47478109 TGGCAAATGCCTGCCTTTCTGGG - Intronic
1028781152 7:94737971-94737993 CAGAAAGTGCCTTCCTTTATGGG - Intergenic
1037405365 8:18536957-18536979 CAGAATTTGCCTGCCTTTGTTGG - Intronic
1038334062 8:26632247-26632269 CGGGCAGTGCCTGGCATTGTGGG + Intronic
1052864981 9:33459450-33459472 ATGGATGTGCCTGCCTTGGTGGG - Intergenic
1053468557 9:38328271-38328293 TGGCAAGTGCCACCCTTTGTTGG - Intergenic
1057213940 9:93218040-93218062 GGGGAAGGGCCTGCCTTCGAGGG + Intronic
1060294402 9:122333425-122333447 CTGGAAGTCCCTGCCCTTGAGGG - Intergenic
1186525721 X:10246468-10246490 CGGGTAGACCCTGGCTTTGTAGG + Intergenic
1189332177 X:40151120-40151142 GGGGAAGTGCCACCCTTAGTGGG - Intronic
1192522217 X:71812862-71812884 CGGGATGTGTCTGCATTTATTGG + Intergenic
1200228505 X:154432447-154432469 CGGGCAGTACCTGGCTGTGTAGG - Exonic