ID: 915590919

View in Genome Browser
Species Human (GRCh38)
Location 1:156869812-156869834
Sequence GGTCAACGGCAGCTGACAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915590914_915590919 8 Left 915590914 1:156869781-156869803 CCACAGGTAACTCAGTCGGCCTT 0: 1
1: 0
2: 0
3: 5
4: 76
Right 915590919 1:156869812-156869834 GGTCAACGGCAGCTGACAATGGG 0: 1
1: 0
2: 0
3: 5
4: 45
915590912_915590919 21 Left 915590912 1:156869768-156869790 CCGATGAGAGTAGCCACAGGTAA 0: 1
1: 0
2: 2
3: 12
4: 150
Right 915590919 1:156869812-156869834 GGTCAACGGCAGCTGACAATGGG 0: 1
1: 0
2: 0
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915590919 Original CRISPR GGTCAACGGCAGCTGACAAT GGG Intronic
915590919 1:156869812-156869834 GGTCAACGGCAGCTGACAATGGG + Intronic
923848178 1:237761237-237761259 GGGGAAAGGCAGCTGGCAATGGG - Intronic
1063428685 10:5968962-5968984 GGTCCACGGCTGCTGGAAATGGG - Intronic
1067074072 10:43162985-43163007 GGTCAACGGAATCTTAAAATGGG - Intronic
1070267025 10:74913485-74913507 AGTCAACGGCAGCTCAAAAATGG - Intronic
1071230641 10:83580969-83580991 GGGCTACAGCAGCTGACAATGGG + Intergenic
1072900510 10:99402803-99402825 TTTAAACGACAGCTGACAATGGG + Intronic
1076995137 11:294070-294092 GGGCAAGGGCAGCTGACACCAGG - Intronic
1090961122 11:131557817-131557839 GGGCAATGTCAGCTTACAATTGG + Intronic
1092523898 12:9298000-9298022 GGTCCACTGCAGCTGACCAAGGG - Intergenic
1100133505 12:91525155-91525177 GGCAAATGGCAGCTGAAAATTGG + Intergenic
1108714518 13:53065614-53065636 GGGCAAAGGCAGTTGAAAATGGG + Intergenic
1112210426 13:97371710-97371732 GGACAATGGCAGCTGGCAAGTGG + Intronic
1119078284 14:71666991-71667013 GGTCAGCTGCAGTGGACAATAGG - Intronic
1121469187 14:94138803-94138825 GGCCAAAGGCAGCTGAGAAGTGG - Intergenic
1137346618 16:47667770-47667792 GGTCATCAGCACCTGACACTGGG + Intronic
1146447455 17:32943816-32943838 GGTCAGCGGCATCAGAGAATGGG - Exonic
1152668797 17:81588827-81588849 GTTCAACCACAGCTGACAAACGG + Intronic
1157803330 18:50638761-50638783 CGTCAACAGCAGCTGCTAATAGG - Intronic
1161438565 19:4278499-4278521 AGACAACGACAGCTGACAACAGG + Intergenic
1162494699 19:11017199-11017221 TGTCCACGGAAGCTGAGAATGGG - Intronic
1167478067 19:49712441-49712463 GGACAACGGGAGCAGACAAAAGG + Intronic
926801315 2:16663508-16663530 GGTCACTGACAGCTGACAGTGGG + Intronic
928290735 2:30035282-30035304 GATCAAGGGCAGCTGTGAATGGG + Intergenic
930653145 2:53982519-53982541 GGTAAACCCCAGCTGACATTTGG - Intronic
934145889 2:89093631-89093653 GCTCAATGGCTGCAGACAATGGG - Intergenic
934223369 2:90106937-90106959 GCTCAATGGCTGCAGACAATGGG + Intergenic
936085809 2:109468417-109468439 GGTCAATGACAGATCACAATGGG - Intronic
1172322790 20:34009814-34009836 GATAAACGGCAACTGACACTGGG - Intronic
1175388836 20:58613860-58613882 GGGCAACAGCAGCAGACAATGGG + Intergenic
1176167105 20:63680107-63680129 GCTCTACGGCAGCTGGCAAGTGG - Intronic
1182319197 22:29467380-29467402 GGGCAGCGGCCGCTGAGAATAGG - Intergenic
951389938 3:22090409-22090431 GGTCAAGGGCAGCAGTCACTTGG - Intronic
965660776 3:171039828-171039850 GATGAAAGGCAGCTGACACTTGG + Intergenic
966605398 3:181816318-181816340 TGTCAACTGCAGTTGACAAATGG + Intergenic
973781908 4:54295729-54295751 GTTCAACAGCAGCTGACATCAGG - Exonic
975003116 4:69250653-69250675 GGTCATGGGCAGCTGACCACAGG - Intergenic
990263573 5:54051573-54051595 GCTCAACGTCATCTGACATTAGG + Intronic
990442457 5:55860434-55860456 GATCAACGCCATCTGAAAATGGG - Intronic
991273714 5:64818149-64818171 GGTCAAAGGCAGATGTTAATTGG + Intronic
1004468843 6:15910171-15910193 GGTCAACATCAGCTGACTCTGGG + Intergenic
1007027339 6:38589796-38589818 GGTCAATGGTAGCTCACGATAGG - Intronic
1022995550 7:35751471-35751493 GGTCAAAGGCAGCAGTCAATAGG + Intergenic
1029163592 7:98570308-98570330 AGTCACAGGCAGCTGACAGTGGG + Intergenic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1038229048 8:25683843-25683865 GGCCAACTGTAGCTTACAATGGG + Intergenic
1048522739 8:135171592-135171614 CTTAAAAGGCAGCTGACAATAGG - Intergenic
1056686320 9:88765137-88765159 GGTTAACAGCAGCTGAGGATGGG + Intergenic
1188522253 X:31051761-31051783 GGTCAACCGCAGCTGATGATGGG - Intergenic
1190712023 X:53078271-53078293 GGTCCAAGGCTGCTGACAAGAGG + Exonic
1194631457 X:96290561-96290583 GGACAACTGCAGCTGCCAATAGG + Intergenic