ID: 915590960

View in Genome Browser
Species Human (GRCh38)
Location 1:156869980-156870002
Sequence GGCCCCTGGAACCATGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915590951_915590960 17 Left 915590951 1:156869940-156869962 CCTTCACTTTGGTGGGAGAGTCC 0: 1
1: 0
2: 0
3: 8
4: 124
Right 915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG 0: 1
1: 0
2: 1
3: 12
4: 117
915590954_915590960 -4 Left 915590954 1:156869961-156869983 CCACCCCAGAATTGCTGGAGGCC 0: 1
1: 0
2: 1
3: 11
4: 165
Right 915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG 0: 1
1: 0
2: 1
3: 12
4: 117
915590956_915590960 -8 Left 915590956 1:156869965-156869987 CCCAGAATTGCTGGAGGCCCCTG 0: 1
1: 0
2: 1
3: 21
4: 183
Right 915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG 0: 1
1: 0
2: 1
3: 12
4: 117
915590957_915590960 -9 Left 915590957 1:156869966-156869988 CCAGAATTGCTGGAGGCCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG 0: 1
1: 0
2: 1
3: 12
4: 117
915590955_915590960 -7 Left 915590955 1:156869964-156869986 CCCCAGAATTGCTGGAGGCCCCT 0: 1
1: 0
2: 2
3: 27
4: 719
Right 915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG 0: 1
1: 0
2: 1
3: 12
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915590960 Original CRISPR GGCCCCTGGAACCATGTTGA GGG Intronic
902368875 1:15993391-15993413 GGCCACTGGAACCGAGTTGTTGG - Intergenic
902874407 1:19332146-19332168 GGTCCCTGGAGCCCTGTTGAAGG + Intergenic
905253308 1:36664170-36664192 GGGCCCTGGGACCATGGGGAGGG + Intergenic
907865734 1:58397516-58397538 GACTCCTGAAACCAGGTTGAAGG + Intronic
912412656 1:109489160-109489182 GGCCCCTGGAAACAGGCTCAGGG + Intronic
915590960 1:156869980-156870002 GGCCCCTGGAACCATGTTGAGGG + Intronic
916414331 1:164578581-164578603 GGCCCCTGGAAGCTCCTTGAGGG - Intronic
917099504 1:171431211-171431233 GGCCCCTGGCAGCATCTTGGGGG + Intergenic
918090752 1:181292164-181292186 GGCACCTGGAGCCATGATCAAGG + Intergenic
920712889 1:208311817-208311839 GGTCTCTGGAGCCATGGTGAGGG + Intergenic
920826771 1:209430183-209430205 GACCCATGTAACCATGGTGAAGG + Intergenic
920919762 1:210288790-210288812 GGCACCAGGCACCATGTTAAAGG - Intergenic
924707137 1:246510331-246510353 GGCCGCTGGAACCAGGCTGGTGG + Intergenic
1064336548 10:14448423-14448445 GGCCCATGGTGCCATGTTGCAGG + Intronic
1069219015 10:65859628-65859650 GACCCCTGGAGCCATCTAGAAGG + Intergenic
1072686928 10:97543031-97543053 GGCTCCAGGAACCATGTTTTTGG + Intronic
1072902998 10:99426174-99426196 GGCCCCTGGGACCATGTCAGGGG + Intronic
1075633303 10:124014260-124014282 GCACCCGAGAACCATGTTGAGGG - Intronic
1076584700 10:131537697-131537719 GGCCCCTTGCACACTGTTGATGG - Intergenic
1076606586 10:131693529-131693551 GGCTCCTGGGTCCATTTTGATGG - Intergenic
1076673912 10:132137844-132137866 GGCCCCTGGACGCATTTAGAAGG + Intronic
1077353628 11:2104720-2104742 GGCCACTGGAACCGTGAGGAAGG - Intergenic
1080920296 11:36702013-36702035 GGCCCCAGCAAACATGTTGCTGG - Intergenic
1084958668 11:72704593-72704615 GGCCCCTGGGACCAGGTGCAAGG - Intronic
1085295894 11:75431451-75431473 GGCCGCTGGACCCAGGTGGAGGG + Intergenic
1085516892 11:77116719-77116741 GGCCCCTGGAGGCAGGCTGAGGG - Intronic
1089003599 11:115072380-115072402 GGTCTCTGGAGCCATGTGGATGG - Intergenic
1091968365 12:4764495-4764517 GGGCCCTGGCACCATGTGGAAGG + Intronic
1098734640 12:74083852-74083874 GACCCCTGGTACACTGTTGATGG - Intergenic
1103049730 12:117768630-117768652 GGCTCCTGGAAGCATCTGGATGG + Intronic
1103329625 12:120145019-120145041 GGCCCTTGGGGCCATGGTGAAGG - Exonic
1103887569 12:124214363-124214385 GGAGCCTGGAACCATTTTCAGGG - Intronic
1104492133 12:129203487-129203509 GGTCCCAGGAAGCATGTGGAGGG + Intronic
1105307800 13:19181357-19181379 AGCCCCAGGAGCCTTGTTGATGG - Intronic
1106128447 13:26920377-26920399 GGCCCCTGGAGCCATCTGGGTGG + Intergenic
1108461417 13:50671131-50671153 GGCAACAGGAACAATGTTGAAGG - Intronic
1108893552 13:55294470-55294492 GGCCTCTGGGTCCATGATGAGGG - Intergenic
1111681135 13:91443122-91443144 GGCCACTGCAAACATTTTGAGGG + Intronic
1113180106 13:107615325-107615347 TGCCCCTGGTACCATGTTGGCGG + Intronic
1113465095 13:110507223-110507245 GCCCCCGGGAAGCATGTTGCTGG + Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1114165670 14:20216226-20216248 GGCCCATGGAACTAAGTTGCAGG - Intergenic
1116671285 14:47846145-47846167 AGCCACTGGAGCCATGGTGATGG - Intergenic
1121889333 14:97574423-97574445 GGCCCCTGGCACCAAGGAGAAGG + Intergenic
1124851740 15:33346472-33346494 GAACCCTGGAACCATTTGGAAGG + Intronic
1128300815 15:66565413-66565435 GGCCCCTGCAGCCAGGCTGATGG + Exonic
1129748086 15:78038885-78038907 GGCCCCTGGGAGCATGTGAATGG + Intronic
1132067401 15:98743625-98743647 GGCCCCAGAAGCCATGTTGAGGG + Intronic
1132523942 16:405090-405112 GACCCCTGGAAAGATGTTGGTGG + Intronic
1133439119 16:5805869-5805891 GTGCCCTGAAACCATATTGATGG - Intergenic
1140977556 16:80074740-80074762 GGCCTCTGGAGGCATTTTGATGG - Intergenic
1142088504 16:88197621-88197643 GGCCCCAGGAACCATGGGGAGGG - Intergenic
1145981030 17:29011718-29011740 GGAACCTGGTACCAGGTTGATGG + Intronic
1148239141 17:45988484-45988506 GGGCCCTGGAACCAGGATGCAGG - Intronic
1148700001 17:49581546-49581568 GGCCCCTGGAAGCATGATGTGGG - Intronic
1156020676 18:32596262-32596284 GGAACCTGGAACCAAGTAGAGGG + Intergenic
1156977504 18:43240916-43240938 GAACACTGGAGCCATGTTGAAGG + Intergenic
1157685684 18:49640737-49640759 TGCCCCTGGAAGCATGCTGGCGG + Intergenic
1157763444 18:50281399-50281421 GGCCCGTGGACCCATGGCGAGGG + Exonic
1158713990 18:59861970-59861992 GACCCTTGACACCATGTTGAAGG - Intergenic
1159932291 18:74326104-74326126 GGCCCCTGGGGCCATGTTTGAGG + Intronic
1160844158 19:1159358-1159380 TGCCCCGGGCTCCATGTTGAGGG - Intronic
1161034439 19:2076658-2076680 GGCCCCGGGGACCCTGCTGATGG - Intronic
1161753818 19:6116898-6116920 AGCCACTTGAACCATGTTGGAGG + Intronic
1162065632 19:8123740-8123762 GGCCCCTGGAAGGATGGGGAGGG - Intronic
1162784484 19:13025683-13025705 GGCCCATAGAACCGTGTTGCAGG - Intronic
1164457196 19:28418656-28418678 GGCCCCCAGAGCCATGTTGTTGG + Intergenic
925075907 2:1015193-1015215 GGCAGCTGGGACCATGTTGGTGG + Intronic
934943562 2:98520069-98520091 GGGCCCTGGCACCATGGCGAGGG - Exonic
936414027 2:112287898-112287920 GGCCGTTGGAAACATTTTGAAGG + Intronic
937086900 2:119177906-119177928 GGCCCCTGTGACGATGTTGGTGG + Intergenic
937432169 2:121848217-121848239 GAACCCTGGAACACTGTTGATGG - Intergenic
937459775 2:122075776-122075798 CATCCCTGGAACCATGATGATGG + Intergenic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
946532906 2:220591958-220591980 AGCCCCTTGGTCCATGTTGAAGG + Intergenic
947757027 2:232573974-232573996 CTCCCCTGGAGCCTTGTTGAAGG + Intronic
1169111917 20:3039709-3039731 GGCCCATGGAGGCATGTTCAGGG + Intergenic
1172267219 20:33626764-33626786 GGCCCCTGGCATCATGTAGTGGG + Intronic
1172655950 20:36538407-36538429 GGCCCCTTGTACACTGTTGATGG + Intergenic
1177252308 21:18610121-18610143 GGTCACTGGAAACATGATGAAGG + Intergenic
1179564157 21:42235902-42235924 GGCCCCCTGAACCATGGGGATGG - Intronic
1179680073 21:43013439-43013461 GGCCCCCGGTCCCATGTTTATGG + Intronic
1180702502 22:17789301-17789323 GGACCCTGGAATCATGTGGCTGG - Exonic
1180790017 22:18570773-18570795 GGCCTCTGGAGGCCTGTTGATGG - Intergenic
1181246929 22:21510326-21510348 GGCCTCTGGAGGCCTGTTGATGG - Intergenic
1181547094 22:23608244-23608266 GGCCTCTGGCAGCATGGTGAGGG - Intergenic
1182086581 22:27565246-27565268 AGACACTGGAACCATGTTGAAGG - Intergenic
954629605 3:52040741-52040763 GGCCCCGGGCACCTTGTGGATGG + Intergenic
958056868 3:88423993-88424015 GGCTCCTGTCACCATCTTGATGG + Intergenic
959342968 3:105154504-105154526 GACCCCTGGAGCCATCTAGAAGG - Intergenic
961335927 3:126179846-126179868 GGCCCCAGGAGCCACGTTGTGGG + Intronic
961780634 3:129318260-129318282 CGGCCCTGGAACCAGGTGGAGGG + Intergenic
963248124 3:143081820-143081842 GGCCTCTGTAACAATGTTCATGG - Intergenic
965387677 3:168064086-168064108 GCCTCCTGGGACCATGGTGAAGG - Intronic
966216721 3:177511034-177511056 GGCATCTGGAACCATCTGGAGGG + Intergenic
967476638 3:189928845-189928867 GGGGCCTGGAGCAATGTTGAAGG - Intergenic
970161783 4:13196754-13196776 GGCCCCTGGAACCATGTCATGGG - Intergenic
971143292 4:23948177-23948199 GGTCCCAGGAACCATGTGGTTGG + Intergenic
972606818 4:40621169-40621191 GGACCCTAAAACCATCTTGAAGG - Intronic
983229802 4:165117514-165117536 GGTGCCTGGAACAATGCTGATGG - Intronic
989174564 5:38510574-38510596 TGCCCCTTGATCCATCTTGATGG - Exonic
989559585 5:42836023-42836045 GGCCCCAGGAACCATGTTCCAGG + Intronic
992171405 5:74105521-74105543 GGCCCAAGGAACCATGCTGTGGG - Intergenic
999194245 5:149771306-149771328 GGCCCCTGGAAGCAGGCTCAGGG + Intronic
1001556446 5:172640831-172640853 GGCCCCTGGGACCATGTAAAGGG - Intergenic
1001692597 5:173644074-173644096 GGCCTCTGGTGCCATGGTGACGG + Intergenic
1003122142 6:3327154-3327176 GGCGACTGGAACCATCTTCAAGG - Intronic
1003489321 6:6607061-6607083 GGTCCCTGGGGCCATGTTGGAGG + Intronic
1008371121 6:50731842-50731864 GGCCCCTGGAACTCTGCAGATGG + Intronic
1012578417 6:100831608-100831630 GGCCCCAGGAATCATTTTGATGG - Intronic
1016728825 6:147406518-147406540 GACACCAGGAACCATGTCGAAGG + Intergenic
1018811391 6:167300687-167300709 GGTCCCTGGGACCATGTTGATGG - Intronic
1022029956 7:26483572-26483594 GGCCCCTGGAATCCTGGTCATGG + Intergenic
1022841588 7:34169366-34169388 GGTCCCTGAAGCCATGTTCATGG + Intergenic
1023125628 7:36951513-36951535 GGCCACTGGAACCACCTGGAGGG + Intronic
1025075807 7:55942149-55942171 GAGCCCTGGTGCCATGTTGAGGG + Exonic
1030939178 7:115623917-115623939 TGCCCCTGGCTCCATGCTGAGGG + Intergenic
1031436959 7:121744203-121744225 GGTCCCTGAAACCAAATTGAGGG - Intergenic
1031635883 7:124100283-124100305 GGACACTGCAACCATGGTGATGG + Intergenic
1043877198 8:85499041-85499063 GGACCCTGGGACCAAGATGAAGG + Intergenic
1045555767 8:103213339-103213361 GGCCACTGTCACCATGTTGATGG + Intronic
1049333279 8:142067130-142067152 GGACCCTGGCACCCTGTTGGTGG + Intergenic
1050296208 9:4207949-4207971 TGTCCCTGGAACCACGTTGGGGG + Intronic
1054779991 9:69157134-69157156 GGCCCCTGCAACCATCTGAATGG - Intronic
1059754390 9:117278844-117278866 GGCCCCTTGCTCCATGCTGAGGG - Intronic
1062467066 9:136686224-136686246 TGCCCCTGGAACCACGGGGAAGG + Intronic
1062614039 9:137388007-137388029 GCCCCTTGGAACCATGTGGGTGG + Intronic
1185886132 X:3784999-3785021 GTCCCCAGGGACCATGATGAGGG - Intergenic
1186613649 X:11163842-11163864 GGCTCATGGAACGATGTTGGAGG + Intronic
1187963124 X:24585251-24585273 GGCCACTGGCACCTTGTTTATGG + Intronic
1189762163 X:44332765-44332787 GGCCTCTTGCACCATGCTGAGGG - Intronic