ID: 915593888

View in Genome Browser
Species Human (GRCh38)
Location 1:156885603-156885625
Sequence CAGGATAGAGAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915593888_915593894 -1 Left 915593888 1:156885603-156885625 CCTTCCTCCTCCTCTCTATCCTG No data
Right 915593894 1:156885625-156885647 GCCAGCCGAGGCCCTAGCCCTGG No data
915593888_915593898 9 Left 915593888 1:156885603-156885625 CCTTCCTCCTCCTCTCTATCCTG No data
Right 915593898 1:156885635-156885657 GCCCTAGCCCTGGTATGTGGAGG No data
915593888_915593897 6 Left 915593888 1:156885603-156885625 CCTTCCTCCTCCTCTCTATCCTG No data
Right 915593897 1:156885632-156885654 GAGGCCCTAGCCCTGGTATGTGG No data
915593888_915593904 18 Left 915593888 1:156885603-156885625 CCTTCCTCCTCCTCTCTATCCTG No data
Right 915593904 1:156885644-156885666 CTGGTATGTGGAGGTGAGGCAGG No data
915593888_915593901 14 Left 915593888 1:156885603-156885625 CCTTCCTCCTCCTCTCTATCCTG No data
Right 915593901 1:156885640-156885662 AGCCCTGGTATGTGGAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915593888 Original CRISPR CAGGATAGAGAGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr