ID: 915594910

View in Genome Browser
Species Human (GRCh38)
Location 1:156891236-156891258
Sequence CATTATCTGCAAAGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915594910 Original CRISPR CATTATCTGCAAAGGGGAGC AGG Intergenic
900134784 1:1111697-1111719 CAGTAACTGAAAAGGGGAGGCGG + Intronic
900815662 1:4841927-4841949 CTTTATAGGCAAAGGGGAGATGG + Intergenic
903124347 1:21237646-21237668 CATCATCTGCAATGTGGAGACGG - Intronic
903857118 1:26344030-26344052 CATCATCTCCAGAGGAGAGCAGG + Exonic
906934095 1:50196530-50196552 CATTTTCATCAAAGGGAAGCTGG - Intronic
907257350 1:53190045-53190067 CCTTATCTGTAAAAGGGAGATGG - Intergenic
909702450 1:78542282-78542304 CATTATTTGAAAGAGGGAGCTGG - Intergenic
910413714 1:86974235-86974257 CATCTTCTGGAAAGGGGAGAGGG + Intronic
911846940 1:102765616-102765638 CATTCTCTGAAGAGGGGAGAGGG + Intergenic
914855433 1:151346969-151346991 CGGTTTCTGCAAAGTGGAGCGGG + Intronic
914871302 1:151477042-151477064 CTTTATCTGCAAACAGGGGCAGG - Intergenic
915594910 1:156891236-156891258 CATTATCTGCAAAGGGGAGCAGG + Intergenic
916143918 1:161723410-161723432 CACCATCTTCAAAGGGGAGCGGG + Exonic
916932852 1:169597335-169597357 CATTTGCTGCAAAGGGCAGTGGG + Intronic
917507700 1:175643171-175643193 CATTATCTGAAAAGAGGTGCAGG - Intronic
917624340 1:176830555-176830577 AATTAGCTGAAAAGGGAAGCAGG + Intronic
917980565 1:180266494-180266516 CATCATCTGCAACCGGCAGCTGG + Exonic
918081653 1:181212385-181212407 CCTTATCTGAAAGGGGCAGCAGG - Intergenic
920562892 1:206951767-206951789 CACTATCTGCTAATGGGAACAGG - Intergenic
1063557754 10:7096929-7096951 CATCATCTCCTAAGGGGAGGTGG + Intergenic
1066035382 10:31476526-31476548 CCTTATCTACAAAGGAGAGCAGG + Intronic
1067824862 10:49563559-49563581 CATTCACTGTAAAGGGCAGCAGG - Intergenic
1072822691 10:98573707-98573729 CTTTATCTGCAAAGGAAACCAGG + Intronic
1074653832 10:115558907-115558929 TAGCATCTGCAAAAGGGAGCTGG - Intronic
1076113082 10:127875428-127875450 CAGATTCTGCAAAGGGCAGCAGG - Intergenic
1077483596 11:2828033-2828055 CACTACCTGCAAAGGGGCGAGGG + Intronic
1082257368 11:50046065-50046087 CTTTATGTGCAAAGTGGTGCAGG - Intergenic
1083966078 11:66044756-66044778 AATTATCTGGCAAGGGGGGCTGG + Intronic
1084323079 11:68384379-68384401 CACAATCTGCAAAGGGGCCCGGG - Intronic
1086510937 11:87557107-87557129 CATTGTCTCCAAAAGGGAGCTGG - Intergenic
1089745885 11:120616466-120616488 CATTATCTTCAGACGGAAGCTGG + Intronic
1090803489 11:130188763-130188785 GGTGATCTGCAAAGGGGACCCGG + Intronic
1091988221 12:4931574-4931596 CAATCTCAGCAAAGGAGAGCAGG - Intergenic
1092222581 12:6724981-6725003 CCTTATCTCCAAAGGAGAGCTGG - Intronic
1092709884 12:11324834-11324856 CATTATTTGGAAAGAGAAGCTGG + Intergenic
1092717355 12:11404523-11404545 CATTATTTGGAAAGAGAAGCTGG + Intronic
1093953860 12:25194848-25194870 CAGTTTCTGCAAACGGGAGATGG - Intronic
1094297061 12:28918816-28918838 CCATATCTGCAAAGAGGAGCTGG + Intergenic
1095791645 12:46174489-46174511 CATTATTTGAAAAGGGGATGTGG + Intergenic
1096898204 12:54846399-54846421 CATGACCTGCGAAGGGGATCAGG + Intronic
1097256088 12:57675493-57675515 CAATATCAGCGAAAGGGAGCTGG + Intergenic
1099450329 12:82800280-82800302 CAATATCTGCAAGAGGCAGCAGG - Intronic
1100387081 12:94113337-94113359 CATGTCCTGCAAAGGGGATCAGG + Intergenic
1102352999 12:112208529-112208551 CATCATCTGCAATGGGAGGCGGG + Exonic
1102451907 12:113048188-113048210 CAACATATGAAAAGGGGAGCGGG + Intergenic
1104913008 12:132248948-132248970 CAGGATCTGCAGAGTGGAGCGGG + Intronic
1106642999 13:31605659-31605681 AATTATCTCCACAAGGGAGCAGG + Intergenic
1107129958 13:36884686-36884708 CAGTAACTGCTAATGGGAGCTGG - Intronic
1110762932 13:79250741-79250763 CATTCTCAGTAAAGGGAAGCAGG - Intergenic
1114949174 14:27725815-27725837 CCTTATTTGCAAAGAGGAGGAGG + Intergenic
1117570285 14:57041702-57041724 CAGTATTTGCAAAGGGGGGCTGG - Intergenic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1121439511 14:93939866-93939888 CCTTATCTGTAAAGCGGAGACGG - Intronic
1122635907 14:103129588-103129610 CATCATCTGAAATGGGGACCGGG + Intronic
1122970062 14:105148853-105148875 CAATGTCTGCAGAGGCGAGCGGG + Exonic
1123959413 15:25380382-25380404 CATTTTCTGTAAAGGGCAGGTGG - Intronic
1126385085 15:48086016-48086038 TATTAGCTGCAGAGGGCAGCGGG - Intergenic
1128229281 15:66023725-66023747 AATTATCTGCCCAGGGCAGCAGG - Intronic
1128428530 15:67568617-67568639 CAGTATTTGCAAAGCTGAGCAGG - Intronic
1131680140 15:94712943-94712965 CAGTTTCTACAAAGTGGAGCAGG - Intergenic
1132182321 15:99766954-99766976 CATTTTCTGTAAAAGGGAGGAGG - Intergenic
1132422482 15:101684074-101684096 CATTTTTTGCACAGTGGAGCAGG - Exonic
1132889620 16:2197175-2197197 CATTATTTGCGGAGAGGAGCAGG - Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133593348 16:7267111-7267133 TATTAAATGCAATGGGGAGCTGG + Intronic
1134876856 16:17708121-17708143 CTTTGTCTGCAAAGGGGAGAAGG - Intergenic
1135290559 16:21234144-21234166 CATTATCTGCATGGGGAAGAGGG + Intronic
1135859671 16:26044350-26044372 CATTCTCTGGAGAGGGGAGAAGG + Intronic
1136041799 16:27585118-27585140 CCTCATCTGGCAAGGGGAGCTGG + Intronic
1136613353 16:31380506-31380528 CAATATCTGCAAAGGGGTTGGGG - Exonic
1137868635 16:51928160-51928182 CACGGTTTGCAAAGGGGAGCTGG + Intergenic
1139382143 16:66539301-66539323 CAAGATCAGCAAAGGGGACCGGG + Intronic
1140207160 16:72942797-72942819 CAGAGTCTGCAAAGAGGAGCTGG - Intronic
1140455763 16:75104767-75104789 CATCATCTGCAAGGGGGACAGGG - Exonic
1140982194 16:80121293-80121315 CAATGTCTGCAAATGGGACCAGG - Intergenic
1144050571 17:11494283-11494305 CATTAACAGCAGAGGAGAGCTGG - Intronic
1144863105 17:18318092-18318114 CATAATGTGCAAAGGGGAGGAGG - Exonic
1148876715 17:50691885-50691907 CAATATCTGCACAGCAGAGCAGG - Exonic
1151620716 17:75243253-75243275 CAAGACCTGCAAAGGGTAGCAGG + Intronic
1153991122 18:10401698-10401720 AATTATCTGCACGGGGGTGCGGG + Intergenic
1159039601 18:63311287-63311309 GGTTATCTGCTAAGGAGAGCTGG + Intronic
1160662338 19:306894-306916 CATTCTCCACAAATGGGAGCAGG - Intronic
1161983457 19:7642216-7642238 CATTATCAGCAGCTGGGAGCGGG - Exonic
1163087409 19:14992381-14992403 TCTTATCTGTAAAAGGGAGCTGG - Intronic
1163544089 19:17930689-17930711 CAGTATATGCAAAGGTGAGGAGG - Intergenic
1164587301 19:29484055-29484077 CATCATCTGCAAAATGGGGCTGG - Intergenic
1167528981 19:50003057-50003079 CTTCATCTGCAGAGGGGAGATGG - Intronic
925232067 2:2242247-2242269 CAATCTCTGCAAAGGAGCGCAGG + Intronic
928787029 2:34900516-34900538 CATTATGTGCAATGATGAGCGGG - Intergenic
929485341 2:42348331-42348353 TATTAACTGCAAAGGGGAAAGGG + Intronic
929657217 2:43745874-43745896 CATTATTTCCAAATGGGAACAGG + Exonic
929846172 2:45530623-45530645 TATTAACTGTGAAGGGGAGCAGG + Intronic
932026594 2:68139836-68139858 CTATATCTGCAAAGGCTAGCAGG + Intronic
932583035 2:73004958-73004980 CATGTTCTGGAAAGGGCAGCGGG - Intronic
935475999 2:103525177-103525199 CATGATGAGCAAATGGGAGCAGG + Intergenic
936650357 2:114419304-114419326 CATTATCTGGTAAGGACAGCAGG + Intergenic
937558293 2:123187707-123187729 CATTATATGCAAAAAGGAACAGG - Intergenic
939670443 2:145004891-145004913 TATTCTCTGCAAATAGGAGCTGG + Intergenic
939866954 2:147483443-147483465 CAGTGTCTGCAAAGCTGAGCTGG + Intergenic
941477839 2:165970510-165970532 CATTTTCTGCAAATTGGTGCAGG - Intergenic
1169624532 20:7549516-7549538 CACTATCTGGGAAGGGGAGAGGG - Intergenic
1169935985 20:10883849-10883871 CATTCTCTGAAAAGGGAAGGGGG - Intergenic
1171141768 20:22749726-22749748 CAATATCTGCGAAGGGTAGAGGG + Intergenic
1172862229 20:38063543-38063565 GTTTAGCTGCAAGGGGGAGCAGG + Intronic
1174143639 20:48434954-48434976 CATGAGATGCAGAGGGGAGCAGG - Intergenic
1175490440 20:59376934-59376956 CATTGTCTGCAAAGGAGATCAGG + Intergenic
1178148115 21:29763255-29763277 CATCTTCTTCACAGGGGAGCAGG - Intronic
1178758138 21:35372656-35372678 CATCCTCTGCAGAGGGGAACAGG + Intronic
1184201759 22:42974374-42974396 AATCATTGGCAAAGGGGAGCTGG - Intronic
949868528 3:8567423-8567445 TATTATCTGGGGAGGGGAGCAGG - Exonic
954867148 3:53739367-53739389 CCTTATCTGCAAAGGCGAGTTGG - Intronic
956640662 3:71412553-71412575 CATTTTCTTCAAAGGGTAGTTGG - Intronic
957476634 3:80733934-80733956 CATTATCTGCAAGGCCTAGCAGG - Intergenic
957816228 3:85301099-85301121 CATTATATGCAAAGTGGATATGG + Intronic
959619184 3:108381676-108381698 CATTAACTTCAAAGGGAGGCAGG + Intronic
961380723 3:126494961-126494983 CCTCATCTGCAAAGCGGAGACGG - Intronic
963779873 3:149476290-149476312 CCTCATCTGCAAAGGGGACTTGG + Intronic
966847919 3:184144812-184144834 GTTTATCTGCCGAGGGGAGCAGG + Intronic
968867926 4:3225615-3225637 CTTGATCTGCACAGGGGGGCAGG - Intronic
974029847 4:56766649-56766671 CAATTTCTGCATATGGGAGCTGG - Intergenic
974119120 4:57617045-57617067 CTTTATCTGCAAACTGGAGTGGG - Intergenic
975416319 4:74109403-74109425 CCTTAGCTGCAAAGGGCACCAGG + Intergenic
978177902 4:105756293-105756315 CATTCTCTGGAGAGGGGAGAGGG - Intronic
978570847 4:110135308-110135330 CTTTATCTGCAAATGGGGGATGG - Intronic
985972841 5:3391875-3391897 CATTCTCAGCAAAGGTGAGCTGG - Intergenic
988225472 5:28406704-28406726 CCTTTTCTGAACAGGGGAGCGGG + Intergenic
988808320 5:34761123-34761145 TATTATCTGCAAAAGGGAGGTGG - Intronic
992436901 5:76763177-76763199 CATGAGCTGCAGAGGGGAGAAGG - Intergenic
996488667 5:124066629-124066651 ATTTATCTGCAAAAGGTAGCAGG + Intergenic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
998232177 5:140367708-140367730 CACTACCTGCAGAAGGGAGCTGG + Exonic
998652166 5:144132891-144132913 CCTTATCCGTAAAGAGGAGCTGG - Intergenic
999237637 5:150108738-150108760 GTGGATCTGCAAAGGGGAGCTGG + Intronic
999894463 5:156014974-156014996 CAATATCTACGAAGGGGAGATGG - Intronic
999935404 5:156480696-156480718 CATTATCTCCAGAAGAGAGCAGG - Intronic
1000486339 5:161848783-161848805 ATTTATTTGCAAGGGGGAGCTGG + Intronic
1002542349 5:179914576-179914598 CAGAATCTCCCAAGGGGAGCTGG - Intronic
1005698421 6:28373890-28373912 TATAATCTGCAAATAGGAGCAGG + Intergenic
1006100759 6:31684729-31684751 CCTTAAATGCAAAGAGGAGCTGG - Intergenic
1007875041 6:45088424-45088446 CATTATTTGCCAATGGGAACAGG - Intronic
1008299572 6:49818561-49818583 CATTATCTGTAAAATGGAGATGG + Intergenic
1010388802 6:75312802-75312824 CATTATCTGAATAGGGGATGTGG + Exonic
1010669862 6:78674756-78674778 CATTATCTGCAAGGAAGAGAAGG - Intergenic
1013957498 6:115857534-115857556 CCTCATGTGCAAAGAGGAGCTGG + Intergenic
1014462572 6:121714770-121714792 CATTATCTGGAAAGGGTGACTGG - Intergenic
1018594050 6:165459409-165459431 CATTTTCTACTAAGGGGAACTGG - Intronic
1020237498 7:6367628-6367650 CATTGTCATCACAGGGGAGCTGG + Intergenic
1021920099 7:25476186-25476208 CATTAGCAGCAAAGAGTAGCAGG - Intergenic
1022789679 7:33674260-33674282 CTTTATCTGCCAAGAGGTGCTGG - Intergenic
1029056453 7:97749637-97749659 CAATATCTCCAAAAGGTAGCTGG - Intergenic
1029847763 7:103430443-103430465 CCTTATCTGTAAATGGCAGCTGG + Intronic
1030233433 7:107232839-107232861 CATTCTCTCCAAACGGGGGCTGG - Intronic
1031027567 7:116696720-116696742 CATTATCTGCACAGAGGTGATGG - Intronic
1032271772 7:130415158-130415180 CATTATTAGCAAAGGGAAGTTGG + Intronic
1033289556 7:140071759-140071781 GTTTTTCTGCAAAGGGAAGCAGG + Intergenic
1033635648 7:143209373-143209395 CATAATCTGCAAAGGGAATAAGG - Intergenic
1034749117 7:153552284-153552306 CATTGTTTGCATTGGGGAGCTGG - Intergenic
1038490330 8:27965992-27966014 CAGTAACTGCAAAGGGCAGCAGG + Intronic
1038709984 8:29934308-29934330 CATTTTCTTATAAGGGGAGCAGG + Intergenic
1040669771 8:49675928-49675950 AATTGTCTACAAAGGGAAGCTGG - Intergenic
1042313801 8:67404531-67404553 CAATACCTGCAAAGGGGAGGAGG - Intergenic
1042334323 8:67614307-67614329 CATGGTCTGCAAGGGGGATCAGG + Intronic
1042819978 8:72919547-72919569 CATCAGCTGCAAAGGGGAGGTGG - Intronic
1042859506 8:73298081-73298103 CATGATCTACGGAGGGGAGCAGG + Intronic
1043917828 8:85944103-85944125 TAATGTCTTCAAAGGGGAGCTGG - Intergenic
1043991566 8:86762183-86762205 CAAAATCAGCAAAGGGGAACAGG + Intergenic
1044592420 8:93927137-93927159 AATTATCTTTAAAGGGGGGCAGG - Intergenic
1045570623 8:103365683-103365705 CAGTCTCTGGAAAGGAGAGCAGG - Intergenic
1045845502 8:106630604-106630626 AATTATCTGGAAGGGGAAGCGGG + Intronic
1046935623 8:119882865-119882887 CATTATCTACCAAGGAGAGGTGG + Intronic
1047326971 8:123848932-123848954 CCTTAGCTGCAAAGAGGGGCCGG + Intergenic
1048214673 8:132482916-132482938 GAATATCTCCAAATGGGAGCTGG + Intergenic
1049284032 8:141764947-141764969 CCTTCACTGCAAAGGGGAGTGGG - Intergenic
1050266670 9:3897918-3897940 CATTGTCTGGAATGTGGAGCTGG + Intronic
1052398272 9:27968110-27968132 TTTTATATGCAAAGTGGAGCTGG + Intronic
1052576841 9:30301729-30301751 CATTATCTGCAAAGCCAGGCAGG - Intergenic
1053338961 9:37305598-37305620 CAGTATTCGCAAAGGGGGGCTGG - Exonic
1057770442 9:97962834-97962856 CAGAAACTGGAAAGGGGAGCTGG + Intergenic
1057832133 9:98415510-98415532 CATTTTCTGGGAAGGGAAGCTGG + Intronic
1059581175 9:115550165-115550187 CAGCACCTGCAAAGAGGAGCAGG - Intergenic
1185780052 X:2836165-2836187 CATTGTCTGCAAATGTAAGCTGG - Intronic
1190393929 X:49960529-49960551 GATTACCTGCTGAGGGGAGCTGG + Intronic
1192806085 X:74510670-74510692 CAATAGCTGCAGAGGGAAGCAGG + Intronic
1198471791 X:136953806-136953828 CTTTATCTGTAAAAGGGAGTTGG + Intergenic
1201289995 Y:12413824-12413846 CATTGTCTGCAAATGTAAGCTGG + Intergenic