ID: 915595987

View in Genome Browser
Species Human (GRCh38)
Location 1:156896770-156896792
Sequence CTGAGTCACCTGGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 293}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915595987_915595996 9 Left 915595987 1:156896770-156896792 CCCTCCACCTCCAGGTGACTCAG 0: 1
1: 0
2: 4
3: 34
4: 293
Right 915595996 1:156896802-156896824 CTGTTGTGCACTCATCCCATAGG 0: 1
1: 0
2: 1
3: 7
4: 113
915595987_915595998 19 Left 915595987 1:156896770-156896792 CCCTCCACCTCCAGGTGACTCAG 0: 1
1: 0
2: 4
3: 34
4: 293
Right 915595998 1:156896812-156896834 CTCATCCCATAGGAACTTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 94
915595987_915595997 16 Left 915595987 1:156896770-156896792 CCCTCCACCTCCAGGTGACTCAG 0: 1
1: 0
2: 4
3: 34
4: 293
Right 915595997 1:156896809-156896831 GCACTCATCCCATAGGAACTTGG 0: 1
1: 0
2: 1
3: 5
4: 102
915595987_915595999 23 Left 915595987 1:156896770-156896792 CCCTCCACCTCCAGGTGACTCAG 0: 1
1: 0
2: 4
3: 34
4: 293
Right 915595999 1:156896816-156896838 TCCCATAGGAACTTGGAGGCCGG 0: 1
1: 0
2: 4
3: 26
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915595987 Original CRISPR CTGAGTCACCTGGAGGTGGA GGG (reversed) Intronic
901051064 1:6426126-6426148 CTGGGTGACCTGGAGATGGAAGG + Intronic
901055023 1:6445380-6445402 CAGGGTCACCTGGAAGGGGAGGG - Intronic
901818000 1:11805887-11805909 CTGAGTCACCCGGGACTGGAGGG - Intronic
901819162 1:11815346-11815368 CTGAGTCATCTGGGGCTGCAGGG + Intronic
902479341 1:16703234-16703256 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
903086857 1:20868878-20868900 CTGAGTGACCTGTATGTGGATGG - Intronic
903454452 1:23477550-23477572 GTGAGTCACCTGGAGATGGGAGG + Intronic
904004591 1:27357106-27357128 CTGCTTCACCTGCAGGGGGAGGG + Exonic
905456432 1:38091386-38091408 CTCACTCACCAGGAGGTAGAGGG + Intergenic
905513186 1:38540393-38540415 CTAAGTGACCTAGGGGTGGAAGG - Intergenic
907299539 1:53477908-53477930 CTCAGGCAGCTGGAGGTGGCTGG - Intergenic
912537194 1:110383491-110383513 CTGAGTCACTTCTGGGTGGAAGG + Intronic
914203016 1:145503259-145503281 CTGAGTGTCCTGGAGGTGATAGG - Intergenic
914236946 1:145821193-145821215 CTGAGTGTCCTGGAGGTGATAGG - Intronic
914247449 1:145896684-145896706 CTGAGGCACATGGAAGGGGAGGG + Intronic
914482138 1:148076410-148076432 CTGAGTGTCCTGGAGGTGATAGG - Intergenic
915007744 1:152655712-152655734 CTGAGTCAGCTGGCTGGGGAGGG + Intergenic
915129746 1:153688112-153688134 CAGAGTCACCTGGAGGAGTTGGG + Exonic
915595987 1:156896770-156896792 CTGAGTCACCTGGAGGTGGAGGG - Intronic
915614441 1:157025832-157025854 CTAAGTCACTTGGAGGGAGATGG + Intronic
916418237 1:164612199-164612221 CTGAGGCGCCCAGAGGTGGAAGG - Intronic
917741920 1:177969338-177969360 GTGAGTGACCTTGAGGTGGGAGG - Intronic
918593224 1:186262850-186262872 CAGAGTGAACTGGAAGTGGATGG + Intergenic
919742541 1:200989603-200989625 TTGAGTCTGCTGGAGGTGGAGGG - Intronic
922743368 1:228029362-228029384 CTGAGCCACCCTGGGGTGGATGG - Intronic
923817531 1:237397651-237397673 CTGAGTGACCTGTAGGGGTAGGG + Intronic
923950843 1:238951606-238951628 CTGAGTCACTTAAAGGTGTAAGG - Intergenic
924588597 1:245381662-245381684 CAGAGTATTCTGGAGGTGGATGG - Intronic
1062970324 10:1643322-1643344 CTTAGCCACCTGCAGATGGAAGG + Intronic
1063123674 10:3122568-3122590 GTGAGGCAACTGGACGTGGATGG + Intronic
1064322602 10:14319930-14319952 CTGTGACTCCTGGAGGTGCAGGG - Intronic
1064764876 10:18660311-18660333 ATGAGACACCTGGAAGTGGCAGG + Intronic
1064832701 10:19489012-19489034 CTGAGACCCCTGGCGGGGGATGG - Intronic
1067099296 10:43322992-43323014 CTGAGTCAGTTGGAGGGGGCGGG + Intergenic
1067350647 10:45472695-45472717 TTCAGTCTCCTGAAGGTGGAAGG - Intronic
1068055193 10:52004668-52004690 CAGAGTGACCTGGAAGTGGTAGG + Intronic
1068439031 10:57028415-57028437 CTGTGTCACCTCCTGGTGGAGGG - Intergenic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1070169783 10:73924198-73924220 CTGAGCCAGCTGGAGGAGGGAGG - Intergenic
1070636328 10:78131079-78131101 CTGAGTCACTTGAAAGTGGGTGG + Intergenic
1070707813 10:78654160-78654182 CTGAGTAACCTGGAGGTCCCTGG + Intergenic
1071574347 10:86715013-86715035 GTGGGTCACCTGGGAGTGGAAGG + Intronic
1071946888 10:90656007-90656029 CTGAGTCAACAGGATATGGAGGG - Intergenic
1074803673 10:117027006-117027028 CTGAGCCACCTGGAGCTGGAGGG - Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076739815 10:132477634-132477656 CTGGGGCCCCTGGAGGTGGGCGG - Intergenic
1077118061 11:894309-894331 CTCTGGCCCCTGGAGGTGGAGGG + Intronic
1077161388 11:1114162-1114184 CAGAGCCACCTGCAGCTGGAAGG - Intergenic
1077277494 11:1721039-1721061 CTGAGTCTCGTGGGGCTGGAAGG + Intergenic
1077467106 11:2738613-2738635 CCGAGTCACCAGGAGATGCAGGG + Intronic
1077694953 11:4385501-4385523 TGGAGGCACCTGAAGGTGGAGGG + Exonic
1078290525 11:10006160-10006182 CTGACTTGCCTCGAGGTGGACGG - Intronic
1079059593 11:17236583-17236605 CTGACTCTCTTGGAGGAGGAGGG - Intronic
1079675680 11:23223409-23223431 CTGAGTCCCCTGTAGGTTGAGGG + Intergenic
1080441241 11:32296663-32296685 CTGAGTCCCCTGAAGTGGGAGGG + Intergenic
1080774914 11:35376914-35376936 CTGGATCACTTGGAGGTTGAAGG + Intronic
1081613715 11:44578478-44578500 CTGGGCCACATGGAGCTGGAAGG - Intronic
1082140522 11:48603425-48603447 CTGAGTCTCTTCTAGGTGGAGGG + Intergenic
1083233721 11:61339052-61339074 CTATGAAACCTGGAGGTGGAAGG - Exonic
1083327250 11:61879002-61879024 CTGAGTCCCAGGGAGGTGGAGGG + Intronic
1083431228 11:62614491-62614513 CTGACTCACCTGCAGTAGGAAGG - Exonic
1083618546 11:64037831-64037853 CTGAGGCACAGGGAGGTGGAGGG - Intronic
1084903781 11:72330308-72330330 CTGAGTCCCCTGGAAGGGCATGG + Intronic
1085119404 11:73957555-73957577 CTGCGGCACCTGGAGGAGGGAGG - Intronic
1086347805 11:85915151-85915173 CTGAGTCAGCTTTAGGGGGAAGG - Intronic
1088812111 11:113399063-113399085 CTGGGCCACCAGGAAGTGGAGGG - Exonic
1089153591 11:116384293-116384315 CTGAGTCTCCTGGAGTTGGGGGG - Intergenic
1090247694 11:125228526-125228548 CGGAGTCACCTGGGGGAGGGAGG + Intronic
1090347030 11:126079824-126079846 CAGCCCCACCTGGAGGTGGAAGG + Intergenic
1090500500 11:127256232-127256254 CTGAGTCATCTTGAGGTCAAAGG - Intergenic
1091594786 12:1870157-1870179 GTGAGTCACACAGAGGTGGAGGG - Intronic
1094288867 12:28823409-28823431 ATGAGTTACCAGGAGGTGTATGG + Intergenic
1096048606 12:48586516-48586538 CAGTGTCTCCTGGAGGGGGATGG - Intergenic
1096077283 12:48813829-48813851 CTGAGCAACTTGGAGGTGGGTGG + Intronic
1096677124 12:53231965-53231987 CTGACTCACCTGGAGTGGGAGGG + Exonic
1096829230 12:54301349-54301371 CTGAGTCATATCAAGGTGGAAGG + Intronic
1097314492 12:58157466-58157488 CTGAGGCAGCTGGAGTTTGAGGG - Intergenic
1098219398 12:68252639-68252661 CTCACTCATCTGCAGGTGGAAGG + Exonic
1102609402 12:114098185-114098207 CTGAGCCACCTGGAGGAAGATGG + Intergenic
1104057280 12:125240113-125240135 CAGAATCACCAGAAGGTGGAAGG - Intronic
1104171459 12:126285637-126285659 CTGAGTCACCAGGAAGTTGGTGG + Intergenic
1105006046 12:132721188-132721210 CTGAGGCACGTGGATGAGGAGGG + Exonic
1105707977 13:22980596-22980618 CTGTGTCTCCTGGAGGAGGCTGG + Intergenic
1105756839 13:23473536-23473558 GTGGGGCACCTGGATGTGGACGG - Intergenic
1106149079 13:27080477-27080499 CTGAGTCACCTGGCCATGCATGG + Intronic
1107888429 13:44893684-44893706 CTGCTTCACCGGGAGGTGGCTGG + Intergenic
1108546703 13:51502385-51502407 ATGAGTCAGCTGGAGGCAGAAGG - Intergenic
1109479300 13:62928272-62928294 CTGAGTCACTTAGAGGAGCATGG - Intergenic
1111426589 13:88092697-88092719 CTGAGCCACCTGAAGCTGGGGGG + Intergenic
1114051482 14:18922050-18922072 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1114111079 14:19479874-19479896 CTCAGTCACCAGCAGGAGGAGGG + Intergenic
1114661001 14:24344816-24344838 CTGAGTCGGCAGGGGGTGGAAGG - Intergenic
1118800391 14:69184352-69184374 CTGGGCCTGCTGGAGGTGGAGGG - Intergenic
1118920356 14:70144235-70144257 TTGTGTCACATGGAGGTGAATGG - Intronic
1121229118 14:92343401-92343423 CTGAGTCATGTGGAGGGTGATGG - Intronic
1121434855 14:93912320-93912342 CTGAGTCATGTGGAGTTGGGAGG - Intergenic
1121526251 14:94621450-94621472 CTGAGTCCCCTGAAGGAGGAAGG - Intronic
1121712244 14:96047336-96047358 CTGGGACATCTGCAGGTGGATGG + Intronic
1122217026 14:100211542-100211564 CTGAGGCACCTGGGGCTGGCGGG - Intergenic
1122378463 14:101285260-101285282 CTGAGGCAACTGAAGGTGGTTGG - Intergenic
1122412054 14:101530638-101530660 ATGAGTCAACTGTGGGTGGATGG - Intergenic
1124341091 15:28889474-28889496 CCGAGTAACGTGGATGTGGAGGG - Intronic
1124720115 15:32104430-32104452 CAGAGTGGGCTGGAGGTGGAGGG - Intronic
1124887606 15:33701631-33701653 CAGAGCAACCTGGAGGGGGAGGG + Intronic
1124966029 15:34434222-34434244 CCGAGACACATGGATGTGGAGGG + Intronic
1124982646 15:34580321-34580343 CCGAGACACATGGATGTGGAGGG + Intronic
1125338511 15:38651919-38651941 CTTTGTCACCTGGAGGGGAAGGG - Intergenic
1128722194 15:69958245-69958267 ATGAATCACCTGGGGGTGGGGGG - Intergenic
1129192547 15:73946105-73946127 CTGAGTCACCTGCAGGTATCAGG + Intronic
1131996593 15:98138912-98138934 GTGAGTCACCAAGAGGTAGATGG + Intergenic
1133813331 16:9177915-9177937 CTGTGTCCTCTTGAGGTGGAAGG + Intergenic
1135345957 16:21688670-21688692 CTGTGTCCCCTTGTGGTGGAAGG + Intronic
1135409942 16:22225962-22225984 CTCACTCACCTTGAAGTGGAAGG - Exonic
1135588611 16:23689941-23689963 CTGAGTCTCCTGGAGGAGTACGG + Exonic
1136232443 16:28894617-28894639 CTGAGCCAACTGGAAGGGGAAGG - Intronic
1136418812 16:30119569-30119591 CTGAGTCACATGGCTGTTGAGGG + Intronic
1139336138 16:66232661-66232683 CAAACACACCTGGAGGTGGAAGG - Intergenic
1139449112 16:67016191-67016213 CTGAGACACCTTGGGGTGGGAGG + Intergenic
1139517967 16:67462976-67462998 CTCACTCAGTTGGAGGTGGAGGG + Intronic
1140357531 16:74319184-74319206 ATGGGTCCCCTGGAGCTGGAGGG - Intergenic
1141009808 16:80386999-80387021 CTGAATGACGTGGAGGAGGAGGG - Intergenic
1141669156 16:85482476-85482498 CTGAGTCACGTGGAGGCTGAGGG - Intergenic
1141821014 16:86445793-86445815 ATGAGGCACCTGGAGCTTGAGGG - Intergenic
1142320529 16:89379650-89379672 CCCAGTCACCTGGAGGTGGGAGG - Intronic
1143462690 17:7114325-7114347 CAGATTCACGTGGAGGTTGATGG + Exonic
1143631558 17:8143149-8143171 CTCAGCCTCCAGGAGGTGGAGGG - Intronic
1144087393 17:11823052-11823074 CCAAGTCCCCTGCAGGTGGAAGG - Intronic
1144184993 17:12788890-12788912 CTTGGTCTCCTGGTGGTGGAAGG + Intergenic
1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG + Intronic
1146797955 17:35795794-35795816 CCGGGTCAACTGGAGGTGGCGGG - Intronic
1147039172 17:37704247-37704269 ATGAGCCTCCTGGAGCTGGAGGG + Intronic
1148750731 17:49944468-49944490 CTGAGGAGCCTGGAGGTGGAGGG - Intergenic
1148999170 17:51739478-51739500 CAGAGTCAAGTGGAGGAGGATGG + Intronic
1149578879 17:57733847-57733869 CTGAGTCCCCGGGAGGTGGCTGG + Intergenic
1150586510 17:66523100-66523122 CTGAGTCACCTGGTAGAGGTGGG + Intronic
1151513962 17:74580294-74580316 CTGAGTTTACTGGAGGTGTAGGG - Intronic
1152028107 17:77824757-77824779 TTGAGTCACATTGAGGAGGAGGG + Intergenic
1152089566 17:78239248-78239270 CTGAGTCCCCAGCAGGTGGGAGG + Exonic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152703590 17:81831926-81831948 TTGGGTCCCCTGGAGGAGGAAGG - Intronic
1152778995 17:82218213-82218235 CTCAGTCACTGGGGGGTGGACGG + Intergenic
1156132321 18:33991164-33991186 TGGAGTCAGCTAGAGGTGGAGGG - Intronic
1156395698 18:36697919-36697941 CTGAGTCTCCTTCAGGTGTAGGG + Intronic
1156399685 18:36729085-36729107 GTAACTCACCTGGTGGTGGAGGG - Intronic
1157717359 18:49897203-49897225 CTGTGACACCTGCAGGTGCAAGG - Intronic
1160733025 19:649740-649762 AGGACTCCCCTGGAGGTGGAAGG + Exonic
1162916011 19:13874802-13874824 CAGAGTCACCGGCAGGAGGATGG - Intronic
1163510885 19:17734259-17734281 CAGGGTCACCTGCAGGTGGAGGG - Exonic
1164701042 19:30284514-30284536 CTGAGTCACCTGGTGAGTGATGG - Intronic
1166000570 19:39875291-39875313 CTGAGCCCCATGGAGGAGGAAGG + Intronic
1166003368 19:39891546-39891568 CTGAGCCCCATGGAGGAGGAAGG + Intronic
1166380392 19:42352497-42352519 CTGGGGCACATGGAGGTGGAGGG + Intronic
1166510061 19:43400843-43400865 CTGATTCACCTATAGGAGGAGGG - Intergenic
1166528770 19:43529857-43529879 CTGAGACACAGGGAGGTGTAGGG + Intronic
1167449073 19:49556526-49556548 GTGAGTCACCTGGGAGGGGAGGG - Intronic
1168058818 19:53879236-53879258 CTAGGTCACCTGGAGGTGGCTGG + Intronic
1168501998 19:56900620-56900642 CTGAGTTACCTGGCCGTGGAAGG + Intergenic
1202713380 1_KI270714v1_random:29140-29162 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
924985296 2:264578-264600 GGGAGTCACCTGGAGGGGGCGGG - Intronic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
925777176 2:7347014-7347036 CAGAGTCTGCTGGAGATGGATGG + Intergenic
925973063 2:9121201-9121223 CAGAGTCCCCTGGAGATGCACGG + Intergenic
926304495 2:11628177-11628199 CTTAGTCCCATGGAGGTGTATGG + Intronic
926426577 2:12743970-12743992 CTTAGACACCTGGGGTTGGAAGG - Intergenic
926744702 2:16141408-16141430 CTGAGGCTCAGGGAGGTGGAGGG - Intergenic
928979057 2:37119419-37119441 CTGAGTCACTTAGAGGAGGCAGG + Intronic
931817626 2:65920422-65920444 CTGAGTCCCCTCTAGGTAGAAGG + Intergenic
932777957 2:74539735-74539757 CTGCGGCCCCAGGAGGTGGATGG - Intronic
933729425 2:85445948-85445970 CTGGGTGACCTGGAAATGGAGGG + Intergenic
934982975 2:98862015-98862037 GGGAGTCACCTGGGGCTGGAGGG - Intronic
934995342 2:98952718-98952740 CTGAGTCATGTGGAGGAGGCTGG - Intergenic
935572258 2:104674088-104674110 GTGTGTCACCTGGAAGTGAAAGG - Intergenic
935821291 2:106895502-106895524 CTGAGTGACCAGGGGGTGGGTGG - Intergenic
937315519 2:120929823-120929845 CTCAGCCACCTGCAGGTGGAGGG - Intronic
937316876 2:120937391-120937413 CTGTGCCTCCTGGAGGTAGAAGG - Intronic
937872807 2:126798071-126798093 GTGAGTCACCTGGAGTGTGAGGG + Intergenic
937967817 2:127527171-127527193 CTGAGTCACATGGAGACGGGTGG - Intergenic
938794935 2:134710027-134710049 CTGGGACAACTGGAAGTGGATGG - Intronic
939717950 2:145609363-145609385 ATGTGATACCTGGAGGTGGATGG + Intergenic
941154644 2:161960786-161960808 AGGAGCCACCTGGAGCTGGAAGG + Intronic
942480695 2:176385240-176385262 CTGAAACATCTGGATGTGGAAGG - Intergenic
942525730 2:176850584-176850606 CAGAGTGGGCTGGAGGTGGAAGG + Intergenic
943974461 2:194455215-194455237 CTGAGTCAACTGGAACTGCAGGG - Intergenic
944490856 2:200256436-200256458 CTGTGTCACATGGAGGAGGTGGG - Intergenic
946157330 2:217815581-217815603 CTGAGCCACCTCCTGGTGGAGGG + Intronic
946254941 2:218435448-218435470 CTTGGTAACCTGGAGGCGGAGGG - Intronic
946406756 2:219496023-219496045 CTGAGTCAGAGGGAGGCGGATGG + Intronic
947915359 2:233828876-233828898 CTGCTTCACCTGGAGGGGCATGG - Exonic
948912391 2:241011083-241011105 CTGGGTCTCCTGGGGGTGGCAGG + Intronic
948912401 2:241011110-241011132 CTGGGTCTCCTGGGGGTGGCAGG + Intronic
948912413 2:241011146-241011168 CTGGGTCTCCTGGGGGTGGCAGG + Intronic
948912426 2:241011182-241011204 CTGGGTCTCCTGGGGGTGGCAGG + Intronic
948912448 2:241011245-241011267 CTGGGTCTCCTGGGGGTGGCAGG + Intronic
1169705489 20:8498887-8498909 CTGTGTCACATGGTGGTGGTAGG + Intronic
1173126998 20:40346236-40346258 CTGAGCCACCTGGAACTGGAAGG - Intergenic
1173262196 20:41446560-41446582 CAGAGGCAGCTGGAGGGGGAGGG - Intronic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175923074 20:62459012-62459034 CTGAGGCGCCTGTCGGTGGAGGG + Intergenic
1176221358 20:63970541-63970563 CTGAGTGGTCTGGAGGTGGCGGG + Intronic
1176296640 21:5076660-5076682 GTGAGTGACCAGGAGGAGGAGGG + Intergenic
1177192046 21:17862916-17862938 CTGAGTCACCTATTGGTTGAAGG + Intergenic
1178585422 21:33867094-33867116 CTGAGAGACCTGGGGTTGGAAGG - Intronic
1179353037 21:40631490-40631512 CTGAGTCAGCTGGAGGAAAACGG - Intronic
1179860409 21:44185461-44185483 GTGAGTGACCAGGAGGAGGAGGG - Intergenic
1179908177 21:44434902-44434924 CGGGGTCACCTGGTGGGGGAAGG - Intronic
1180047917 21:45318315-45318337 GTGACTGACCTGGAGGTGGTGGG - Intergenic
1180129736 21:45819885-45819907 CTGAGTCCCCTGGAGTGGGCAGG + Intronic
1180186122 21:46140212-46140234 GTGAGGCACGTGAAGGTGGACGG - Intronic
1180186154 21:46140363-46140385 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186194 21:46140563-46140585 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186205 21:46140614-46140636 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186217 21:46140664-46140686 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186236 21:46140764-46140786 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186262 21:46140914-46140936 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180469955 22:15644426-15644448 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1181107240 22:20582597-20582619 CTGGCTGACCTGGAAGTGGAGGG - Exonic
1181949939 22:26546537-26546559 CTGTGTTCCCTGGAGGGGGATGG - Intronic
1184919623 22:47596534-47596556 CTTAGACAACTGCAGGTGGATGG + Intergenic
1184995121 22:48199755-48199777 CGCAGACACCTGCAGGTGGAGGG + Intergenic
1185184016 22:49381796-49381818 CTGAGTAAACTGGAGCCGGAGGG - Intergenic
949766741 3:7535256-7535278 CTGACGCAACTGGAGGAGGATGG + Intronic
949894612 3:8759972-8759994 CTGTCTCACCTGGAGGAGGCGGG - Intronic
951259806 3:20494845-20494867 CTGAGTCACCTGGAACTGGATGG + Intergenic
953468557 3:43146818-43146840 CCCAGTCACCAGGAGGAGGAGGG - Intergenic
953677655 3:45015914-45015936 CTGGGTCACATGGAGCAGGAGGG - Intronic
954720264 3:52555562-52555584 CTGAGTGACCTGGACTTGGTTGG - Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
955410688 3:58653585-58653607 CTGGGTCACCTAGGGATGGAGGG + Intronic
956805970 3:72811775-72811797 TGAAGTCACCTGGAGGTAGAAGG + Intronic
956816215 3:72910813-72910835 CTCAGTCCCCTGCAGTTGGATGG - Intronic
957615778 3:82524870-82524892 CTGAGACACCAGGAAGTGCAGGG - Intergenic
957643505 3:82888329-82888351 CTGTGTCATCTTGTGGTGGAAGG + Intergenic
960719330 3:120610432-120610454 CTGAATTTCCTGGAGCTGGATGG + Intergenic
961110232 3:124277365-124277387 CTCCGTCAACAGGAGGTGGAGGG - Intronic
961393213 3:126568995-126569017 CTGTGTCCCCTGGAGGCAGAGGG + Intergenic
961441217 3:126954457-126954479 CTGAGCCTCATGGAGCTGGAGGG - Intronic
962333706 3:134505704-134505726 CTAAGTCACCTAGTGGTGGCAGG + Intronic
962936772 3:140088654-140088676 CTCAGTGACATGGAGGTGGAAGG - Intronic
963052366 3:141152982-141153004 CTGAGGCCCCTGGAGCTGGTTGG - Intergenic
963738771 3:149053259-149053281 ATGAGGGGCCTGGAGGTGGAAGG + Intronic
963859794 3:150297374-150297396 TTGAGTTGGCTGGAGGTGGAAGG + Intergenic
963889062 3:150613214-150613236 CTGAGTCAGCTCATGGTGGAAGG + Intronic
964507313 3:157413564-157413586 CTGTGTCACCTGAAGAAGGAGGG - Intronic
965317730 3:167211922-167211944 CTGAGCCAACCGGAGGTGGAAGG + Intergenic
967887365 3:194342235-194342257 CTGGTTCCCCTGCAGGTGGAGGG + Exonic
968227122 3:196979797-196979819 TTGAGTCACCTGGAGGCTGGAGG + Intergenic
968446777 4:656099-656121 CTGAGGCACGTGGAGCTGGCCGG - Intronic
968642784 4:1722627-1722649 CACAGGCACCTGGTGGTGGAGGG - Intronic
969293473 4:6255319-6255341 CTGAGTCACCATGTGGAGGAAGG - Intergenic
970139700 4:12968445-12968467 CTGAGTCACATGGATGTGAAAGG - Intergenic
971448238 4:26775590-26775612 CTGTGTCATCTGATGGTGGAAGG - Intergenic
976444217 4:85111228-85111250 CTGAGCTGCCTGGAGGTGAAGGG - Intergenic
977396968 4:96483642-96483664 CTGAGCTGCCTGGAGGTGGTTGG + Intergenic
979090916 4:116481143-116481165 CTGAGTCACCTGAAGTAGAATGG + Intergenic
981400794 4:144311877-144311899 GTGAGTCTCCTGAAGGTGGCAGG + Intergenic
981835998 4:149054184-149054206 CTGACCAACCTGGAGGGGGAAGG - Intergenic
985552646 5:541343-541365 CTCAGTGACCTGGAGGTCGGAGG - Intergenic
985628015 5:1000121-1000143 CTGAGAGACCTGGGGATGGAGGG + Intergenic
991215897 5:64157163-64157185 CTCAATCACCTGGAAGGGGAGGG + Intergenic
991588982 5:68229448-68229470 CTAAGTCAGGTGGAGGTGGAGGG - Intronic
993011973 5:82493035-82493057 CTGTGGCTCCTGGAGGTGAATGG - Intergenic
995047415 5:107668923-107668945 AAGAGTCTCCTGGAGGTGGGTGG - Intronic
997364056 5:133314240-133314262 CTGAGTCACCTGCAGGTCCCTGG + Intronic
997472059 5:134122642-134122664 CAGAGCCTCCTGGAGGTGCAAGG + Intronic
997655775 5:135553214-135553236 CTGAGTCACTAGGAGGTGGGTGG + Intergenic
997713502 5:136025782-136025804 CTGGGTCATCTGGGGATGGAGGG + Intergenic
998497287 5:142601740-142601762 TTGAGAAACCTGGAGATGGAGGG + Intronic
1001047093 5:168382550-168382572 CTGTGCCAGCTGGAGGTGTAGGG + Intronic
1001641518 5:173247219-173247241 ATGACTCTCCTGGAGGGGGAGGG + Intergenic
1002585606 5:180245054-180245076 CTTAGCCCCCTTGAGGTGGAGGG - Intronic
1003520925 6:6857528-6857550 CAGAACCACCCGGAGGTGGAAGG + Intergenic
1004042001 6:11988510-11988532 CTGAGTGACCTGGCCTTGGAGGG + Intergenic
1005103493 6:22198901-22198923 CTGAGTCACCTCTGGGTGGGAGG + Intergenic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1005726611 6:28655378-28655400 CTGAGTCTCCTGCAGGAGGCTGG + Intergenic
1006057847 6:31399060-31399082 CTGACACATCTGGAGGTAGAGGG + Intergenic
1006070279 6:31493590-31493612 CTGACACATCTGGAGGTAGAGGG + Intergenic
1006594523 6:35183045-35183067 ATGGGTTACCTGGAGATGGAGGG - Intergenic
1006714795 6:36110272-36110294 CTGAGTCAACTGGAGCAAGAAGG + Exonic
1007377854 6:41468691-41468713 CAGAGTCCCCAGGAAGTGGAGGG - Intergenic
1008136538 6:47784018-47784040 CTGATACACATGGAGTTGGAAGG + Intronic
1009996977 6:70906776-70906798 CTGAGAAACCCAGAGGTGGAAGG - Intronic
1017818676 6:158033223-158033245 CTGTGTCACGTAGAGGAGGATGG - Intronic
1017825861 6:158081481-158081503 CTCAGTGTCCTGGACGTGGACGG + Exonic
1018917497 6:168145780-168145802 CTGAGGCACCTGGAGCTGGGAGG + Intergenic
1020264170 7:6549333-6549355 CTGAGTCACCTGCAGGAAGTAGG - Intronic
1020573122 7:9890891-9890913 CTGGGTCACCTGGAGGTGGGTGG - Intergenic
1021880920 7:25094463-25094485 CTGAGTCAGCTGCAGGCTGAGGG - Intergenic
1021935864 7:25630640-25630662 CTGAGTCCCCTGGGGAAGGAAGG + Intergenic
1024042902 7:45568732-45568754 CACAGTCACATGGAGGTGAATGG + Intergenic
1026471922 7:70701057-70701079 CTTAAACATCTGGAGGTGGAGGG - Intronic
1028871410 7:95774370-95774392 CACAGTCCCCTGGAGGAGGAGGG + Intronic
1029223259 7:99006964-99006986 CTGAGTCAGCTGGAGGCGGCAGG - Intronic
1029270601 7:99374818-99374840 GGGAGCCACCTGGAGGTGGGGGG + Intronic
1029290629 7:99499864-99499886 CTGCGTTACCAGGAGGTGGCTGG - Exonic
1033983296 7:147192548-147192570 CTGAGTCACTTGGAGAGGGTGGG - Intronic
1034341301 7:150357967-150357989 GTGAGTCACCTGCTGGTGGGAGG - Intergenic
1035337352 7:158138434-158138456 CTGAGTGGCCTGGAGCTGGACGG - Exonic
1036644637 8:10604451-10604473 CTGAGGGACCTGGAGCTGAAGGG - Intergenic
1037735792 8:21564955-21564977 GTGAGTCACCTGGAGCTGTGAGG + Intergenic
1039339472 8:36631128-36631150 CTGTCTCATCTGGACGTGGAAGG + Intergenic
1040372767 8:46794030-46794052 CTGAGGCCCCTGCAGGTGGGAGG - Intergenic
1041356472 8:57005912-57005934 CTGAGCCACCTAGAGGAGTATGG + Intergenic
1041829995 8:62143408-62143430 CTGAGTCTCCTGGAGGATTAAGG - Intergenic
1045528090 8:102958625-102958647 ATGAATCACCTGGTGGTGGTGGG - Intronic
1047009414 8:120654878-120654900 CAGAGTCACTTGGAGGGGAAAGG - Intronic
1047348505 8:124051344-124051366 CTGAGGCACCAGGAGGTGCCTGG - Intronic
1049506861 8:143007101-143007123 CTGAGTTTCCTGGATTTGGATGG + Intergenic
1049708682 8:144054146-144054168 CTGAGTCACTGGGTGGTGGGTGG - Intronic
1049776041 8:144405667-144405689 CAGATTCACCTGGAGAGGGAGGG - Intronic
1050865032 9:10488011-10488033 CTGAACCACCTGGAGCTGGGGGG + Intronic
1053427032 9:38016943-38016965 GTGAGTCACCTGGGGGTGGGGGG + Intronic
1056230462 9:84538303-84538325 CTGAGCTGCCTGGAGCTGGAGGG + Intergenic
1057338224 9:94174436-94174458 CTGCTTTACCTGGAGGTTGAGGG + Intergenic
1057424347 9:94936328-94936350 CTGAGCTACCTGGAGGGAGAGGG - Intronic
1058140982 9:101356759-101356781 CTCAGTGGCCTGGAGGTGCAGGG + Intergenic
1058756568 9:108088210-108088232 CTGAGTCCCCAGGAGGAGAAGGG - Intergenic
1060622426 9:125080082-125080104 CTTAGTCACTTGTAGCTGGAAGG + Intronic
1061178710 9:129011906-129011928 CAGAGACAGCAGGAGGTGGAGGG + Intronic
1061899595 9:133666147-133666169 CAGGGTCACCTGGAGGGGGTGGG + Intronic
1062093140 9:134689049-134689071 CTGAGTCCCCTGGAGGGACAGGG + Intronic
1186397742 X:9226583-9226605 CTGAGTCACAGGGAGGTGAGAGG + Intergenic
1189727052 X:43977742-43977764 CTGAGTATCATGGAAGTGGAAGG - Intergenic
1190274461 X:48891378-48891400 CGGAGTCACCTGGAGTGGGGCGG - Intergenic
1190989276 X:55528622-55528644 CTCAGTCCTCTGGAGGGGGAAGG - Intergenic
1195314940 X:103668286-103668308 ATGTGTCTCCTGGAGTTGGAAGG + Intergenic
1196020321 X:110984474-110984496 CTGAGGCAGCTGGAAGTGGGAGG - Intronic
1196758669 X:119180087-119180109 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196758948 X:119182359-119182381 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1197714478 X:129696566-129696588 AGGAGTCACCAGGAGCTGGAAGG - Intergenic