ID: 915596363

View in Genome Browser
Species Human (GRCh38)
Location 1:156898526-156898548
Sequence AGCAGCCTGCTGCACTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 177}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915596363_915596369 -2 Left 915596363 1:156898526-156898548 CCTGTGGAGTGCAGCAGGCTGCT 0: 1
1: 1
2: 2
3: 22
4: 177
Right 915596369 1:156898547-156898569 CTGGGGGAGCTCCCTGTGTAGGG 0: 1
1: 2
2: 1
3: 16
4: 173
915596363_915596371 2 Left 915596363 1:156898526-156898548 CCTGTGGAGTGCAGCAGGCTGCT 0: 1
1: 1
2: 2
3: 22
4: 177
Right 915596371 1:156898551-156898573 GGGAGCTCCCTGTGTAGGGAGGG 0: 1
1: 2
2: 1
3: 24
4: 302
915596363_915596374 7 Left 915596363 1:156898526-156898548 CCTGTGGAGTGCAGCAGGCTGCT 0: 1
1: 1
2: 2
3: 22
4: 177
Right 915596374 1:156898556-156898578 CTCCCTGTGTAGGGAGGGAGGGG 0: 1
1: 0
2: 3
3: 52
4: 422
915596363_915596373 6 Left 915596363 1:156898526-156898548 CCTGTGGAGTGCAGCAGGCTGCT 0: 1
1: 1
2: 2
3: 22
4: 177
Right 915596373 1:156898555-156898577 GCTCCCTGTGTAGGGAGGGAGGG 0: 1
1: 1
2: 3
3: 43
4: 382
915596363_915596368 -3 Left 915596363 1:156898526-156898548 CCTGTGGAGTGCAGCAGGCTGCT 0: 1
1: 1
2: 2
3: 22
4: 177
Right 915596368 1:156898546-156898568 GCTGGGGGAGCTCCCTGTGTAGG 0: 2
1: 0
2: 4
3: 19
4: 241
915596363_915596377 19 Left 915596363 1:156898526-156898548 CCTGTGGAGTGCAGCAGGCTGCT 0: 1
1: 1
2: 2
3: 22
4: 177
Right 915596377 1:156898568-156898590 GGAGGGAGGGGAGAAGTCTTTGG 0: 1
1: 1
2: 7
3: 64
4: 540
915596363_915596370 1 Left 915596363 1:156898526-156898548 CCTGTGGAGTGCAGCAGGCTGCT 0: 1
1: 1
2: 2
3: 22
4: 177
Right 915596370 1:156898550-156898572 GGGGAGCTCCCTGTGTAGGGAGG 0: 1
1: 1
2: 1
3: 26
4: 233
915596363_915596372 5 Left 915596363 1:156898526-156898548 CCTGTGGAGTGCAGCAGGCTGCT 0: 1
1: 1
2: 2
3: 22
4: 177
Right 915596372 1:156898554-156898576 AGCTCCCTGTGTAGGGAGGGAGG 0: 1
1: 1
2: 2
3: 35
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915596363 Original CRISPR AGCAGCCTGCTGCACTCCAC AGG (reversed) Intronic
900407441 1:2498783-2498805 TGCTCCCTGCTGCAGTCCACAGG - Exonic
901916719 1:12505853-12505875 GGCAGCCTGCTCCCCTCGACAGG + Intronic
903139700 1:21332107-21332129 ACAACCCTGCTGCACACCACTGG - Intronic
906154644 1:43606784-43606806 CACAGCCTGCTGTTCTCCACCGG + Intronic
912702572 1:111889141-111889163 AGCAACCTGCTGCTCTTCCCCGG + Intronic
912932085 1:113973138-113973160 GGCAGCCCGCTACACTCGACAGG + Exonic
914069982 1:144277658-144277680 AGCAGCCAGCTGCACAGCTCCGG + Intergenic
914109173 1:144688696-144688718 AGCAGCCAGCTGCACAGCTCCGG - Intergenic
914720946 1:150288362-150288384 AGAAGCCTGATGCCCTACACAGG - Intergenic
915596363 1:156898526-156898548 AGCAGCCTGCTGCACTCCACAGG - Intronic
920729342 1:208468230-208468252 AGCAGCCTGTGCCACCCCACAGG - Intergenic
921839436 1:219812629-219812651 AGCAGTCTGCTGCTCTCCTCTGG + Intronic
922575106 1:226655956-226655978 AGTTGCCTGCAGAACTCCACAGG - Intronic
924118070 1:240767341-240767363 AGCAGTCTCCTGGACTACACAGG - Intergenic
924462160 1:244269314-244269336 AGCAGCCGGCGACACGCCACGGG - Intergenic
1066005284 10:31141176-31141198 AGAAGGCTGCTGCAATCCTCAGG + Intergenic
1069204263 10:65661945-65661967 AGCTGCCTGCAACACTTCACTGG + Intergenic
1070656906 10:78277933-78277955 TGGAGCCTTCTCCACTCCACCGG - Intergenic
1071457727 10:85863650-85863672 GGCAGCCTGCAGCACTCCTGAGG - Intronic
1072617333 10:97058646-97058668 GGCAGGCTCCTGCACTCCCCGGG + Intronic
1075556490 10:123436134-123436156 ACCAGCCTGGTGGACTCCACTGG + Intergenic
1076179918 10:128399230-128399252 AGAAGCCTGCTGACATCCACAGG + Intergenic
1077349277 11:2084797-2084819 AGCAGCCTGCTGCACCTTCCTGG + Intergenic
1080824259 11:35834600-35834622 AGAAGCCTGCTTCAATCAACCGG - Intergenic
1081963223 11:47153518-47153540 GGGAGCTTGCTGGACTCCACAGG - Intronic
1082188542 11:49213407-49213429 AGCAGGCTGCAGCACACCACTGG + Intergenic
1083839969 11:65298804-65298826 AGCAGCCAGCTGTGTTCCACGGG + Intronic
1083936960 11:65874201-65874223 ATCACACTGCTGCACTCCATGGG + Intergenic
1085515099 11:77107095-77107117 AGAGCCCTGCTGCTCTCCACCGG - Intronic
1086677980 11:89633290-89633312 AGCAGGCTGCAGCACACCACTGG - Intergenic
1087218072 11:95516373-95516395 AGCTGCATGCTGCTGTCCACCGG + Intergenic
1089346524 11:117795157-117795179 AGGGGCCTCCTGCACTCCCCGGG + Intronic
1090948025 11:131448815-131448837 ACAAGCCTGCTGCATTCCAGTGG + Intronic
1095389547 12:41689497-41689519 AGCAGCCTACTTAACTCCCCTGG - Intergenic
1096680803 12:53253953-53253975 AGCAGGCTGGTGTACTCAACTGG + Exonic
1098285842 12:68906063-68906085 AACAGCCTGGTGCACTGCAAGGG - Intronic
1099116460 12:78631498-78631520 ATCAGCCTCCTGCACACCAAAGG - Intergenic
1099689144 12:85927966-85927988 AGCAGCCTGAGGCTCTCCCCAGG + Intergenic
1104551756 12:129763537-129763559 ACCAGCTTGCTTCACTCCATGGG + Intronic
1105765313 13:23553454-23553476 GGCAGCCTGCTGTAGACCACCGG - Intergenic
1106493127 13:30247179-30247201 AGCATACTGCTGCACACCCCTGG + Intronic
1107045536 13:35988345-35988367 AGCAGCTGGCTGCACAGCACTGG - Intronic
1107398854 13:40048707-40048729 AGCATCCTGCTGCATGCCTCAGG + Intergenic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1109034826 13:57242754-57242776 AGCTGTCTGCTGAACTCCACTGG - Intergenic
1112611571 13:100960080-100960102 AGCAGCCTGGTGAACACCAATGG + Intergenic
1113227779 13:108177874-108177896 AGCTGCCAGCTGCATACCACTGG - Intergenic
1113344987 13:109468314-109468336 TGCAGCCTCCTGCACTCACCAGG + Intergenic
1113430536 13:110246619-110246641 TGCAGACTGGTGGACTCCACCGG + Intronic
1113713447 13:112486803-112486825 TGGAGCCTGCTGCATGCCACGGG + Intronic
1117811392 14:59551000-59551022 AGCAGGTTGCTGCACTTCACAGG + Intronic
1121495108 14:94386676-94386698 GAGAGCCTGCTGCACTCCCCAGG + Intronic
1122838233 14:104441834-104441856 AGCAGCGTGCTGAGCTTCACGGG - Intergenic
1124021867 15:25932882-25932904 AGCACCTTGCTCCACTCCAGAGG + Intergenic
1129472500 15:75763372-75763394 ACCAGCCTCCTGCCCTCCACAGG + Intergenic
1130581251 15:85138735-85138757 AGCCGCCTAATGCACTTCACAGG + Exonic
1132022030 15:98371093-98371115 AGCAGACTGCTGCTGGCCACAGG - Intergenic
1132323074 15:100941703-100941725 GGCAGCCTGCTACAGTCCCCTGG - Intronic
1133432828 16:5753545-5753567 AGCTGGCTGCAGCACACCACTGG - Intergenic
1138607239 16:58097151-58097173 AGCAGCCGACTGGACTGCACCGG + Intergenic
1138654480 16:58482840-58482862 TGCAGTGAGCTGCACTCCACTGG - Intronic
1139588123 16:67917305-67917327 AGCAGACTGCAGCACTAGACAGG - Intronic
1139611774 16:68064127-68064149 AGCAGTCTCCTTCACTCCCCTGG - Intronic
1139654419 16:68378665-68378687 CCCACCCTGCTGCACTCCACAGG + Intronic
1143917522 17:10304920-10304942 AGCTGCATGCTCCACTCCACTGG + Intronic
1148002544 17:44398265-44398287 GGCAGCAAGCTGGACTCCACAGG + Exonic
1151604977 17:75130365-75130387 ATCTGCCTGCTCCACTCCACGGG + Exonic
1152758107 17:82095528-82095550 AGGGGCCTGCAGCACCCCACAGG - Intronic
1155577491 18:27263916-27263938 ACCATCCTTCTGCACTCCCCAGG + Intergenic
1156106197 18:33664983-33665005 AGCAATCTGCTGCTCTCCAGAGG - Intronic
1160094037 18:75854368-75854390 AGGAGCATGCTGCTCTCCAGGGG - Intergenic
1160591350 18:79946501-79946523 AGCAGGCTCCTGCACCACACAGG - Intronic
1160996270 19:1883511-1883533 AGGGGCCTGCTGCTGTCCACTGG - Intronic
1161456315 19:4371401-4371423 AGCAGCCAGCTCCACTCGGCAGG - Intronic
1161739964 19:6014966-6014988 AGCAGCCTACTGCACTCTCTGGG + Intronic
1163404389 19:17113279-17113301 AGCAGCCTGGTGCACTTCAAAGG + Intronic
1167146948 19:47686857-47686879 AGCAGCCTGCTGAAGGTCACAGG - Intronic
1167664374 19:50815275-50815297 ATCAGCCAACTGTACTCCACTGG - Intergenic
1168327480 19:55545610-55545632 ACCAGCCCCCTGCACCCCACAGG + Intergenic
1168379984 19:55912064-55912086 AGAAGCCTACTGGACTCCAGTGG - Exonic
925771243 2:7284996-7285018 AGCAGCCGGCTTCCCTCCATGGG - Intergenic
929160418 2:38826635-38826657 CACAGCCTGCTGCTCTTCACTGG + Exonic
929579269 2:43071356-43071378 AGCTGCCTCCTGCCCTCCAAGGG - Intergenic
932716039 2:74101269-74101291 AGCTGCCTGCTGCCCCTCACCGG - Exonic
933028976 2:77301662-77301684 AGCTGCCTCCTGCATTCCTCTGG - Intronic
933276403 2:80288856-80288878 AGCAGCCTGCTGAGCTCCACTGG - Intronic
934180287 2:89613013-89613035 AGCAGCCAGCTGCACAGCTCCGG + Intergenic
934290586 2:91687276-91687298 AGCAGCCAGCTGCACAGCTCCGG + Intergenic
935419341 2:102851159-102851181 TGCAGCCGGCTGCTCTCCAAGGG - Intergenic
935419344 2:102851168-102851190 AGCAGCCGGCTGCAGTCCCTGGG + Intergenic
937205263 2:120232351-120232373 AGCTGCCTGCTGCCCTGCTCTGG + Intergenic
937343181 2:121104886-121104908 AGCAGTCTGCTGAACTGCAGGGG + Intergenic
937414062 2:121700225-121700247 AGGTGCGTGCTGGACTCCACTGG + Intergenic
937990481 2:127659416-127659438 AGCTCCCTGCTGGTCTCCACGGG + Intronic
938175092 2:129118450-129118472 AGCACCCTGCTGAACTCAGCTGG - Intergenic
941350800 2:164432280-164432302 AGCAGCCAGCTTCTCTCCACAGG + Intergenic
942218575 2:173746895-173746917 TGGAGCCTGCTTCACACCACCGG - Intergenic
943934201 2:193894062-193894084 AGTAGCTTGGTGCACACCACAGG + Intergenic
1170722525 20:18896335-18896357 ACCAGCCTTCTACACTCCAAAGG - Intergenic
1171379735 20:24725254-24725276 AGCTGCCTGCTCCACTGCAGTGG - Intergenic
1172393584 20:34583344-34583366 AGCCTCCTGCAGCACTGCACAGG + Intronic
1172427090 20:34862914-34862936 TGCTGCCCGCTGCACTTCACTGG - Exonic
1174874333 20:54210686-54210708 AGAAGCCTCCTTCACTCCCCAGG + Intronic
1175884401 20:62280931-62280953 AGCAGCGTGCTGCTCTCCCGCGG + Intronic
1176246407 20:64099327-64099349 AGCTGCCTGCTGCACTTCCCGGG - Exonic
1177822359 21:26045387-26045409 AGCAGCTAGCTGCATTCCAAAGG + Intronic
1178915059 21:36701404-36701426 ACCAGCCCTCTGCGCTCCACCGG - Intronic
1179909119 21:44438694-44438716 GGCAGCCTGCTGCACTGGGCGGG + Intronic
1179955951 21:44738723-44738745 AGCTGCCTGGTGTCCTCCACAGG + Intergenic
1180014339 21:45072998-45073020 GGCAGCCTGCTGCATACCGCGGG + Intergenic
1180142163 21:45899313-45899335 GGCAGCCAGCTGCCCTCCCCCGG + Intronic
1181621018 22:24091262-24091284 AGCACCCTGCTCCACAGCACTGG - Intronic
1183494037 22:38132357-38132379 AGCATCCTGCTTCCCTTCACTGG - Intronic
1184428250 22:44425673-44425695 AGCAGCCTGCAGCTGTCCACAGG + Intergenic
1184688977 22:46108914-46108936 TGCATCCTGCTGCCCTCCTCTGG + Intronic
951189778 3:19754772-19754794 AGAAAGCTGCTTCACTCCACTGG - Intergenic
952243773 3:31562682-31562704 AGCAGCCTGCAGCCCTCAAGTGG + Intronic
952729242 3:36621398-36621420 AGGAGCCTTTTGCACTCCCCAGG + Intergenic
954678561 3:52328826-52328848 AGCAGCCTTCAGCCCTGCACAGG - Intronic
956790115 3:72673667-72673689 AGCGGCCTGCTCCCCTTCACCGG - Intergenic
958667551 3:97160320-97160342 ATCACTCTGCTGCACTGCACTGG - Intronic
960456046 3:117873459-117873481 ACCACCCTGCTGCAGGCCACAGG + Intergenic
963047918 3:141116901-141116923 ATCAGCCTGCTCCACTCTTCAGG - Intronic
963467883 3:145705157-145705179 AGAAGCAAGATGCACTCCACGGG - Intergenic
966065902 3:175821367-175821389 AGCAGGGTGCTGCACACCAGTGG - Intergenic
966805986 3:183808043-183808065 TGCAGCCCGTGGCACTCCACAGG + Exonic
966921324 3:184613498-184613520 AGCAGCCTCCTGCAGTAGACTGG - Intronic
967977567 3:195044078-195044100 AGCAGGCTGCTGCTCTCCAGAGG - Intergenic
968504584 4:965951-965973 AGCAGGCTGCTGTACTCCTCGGG + Exonic
968940192 4:3633665-3633687 GGCTGCCTGCTGCTCTGCACCGG + Intergenic
969261170 4:6034962-6034984 AGCAGCATGCTCCTCTCCTCGGG - Intronic
969343871 4:6559211-6559233 AGCAGCCTGGAGCACATCACTGG + Intronic
969444861 4:7239012-7239034 AGCTCCCTGCTGAACTCCACAGG - Intronic
969707180 4:8818429-8818451 GGCAGCCTGCAGCACCACACGGG + Intergenic
969838677 4:9864390-9864412 AACAGCCTTCTGCTCTCCAAGGG + Intronic
973879698 4:55257044-55257066 AGCAGCCTGCTTCCCTCCTGTGG + Intergenic
974145614 4:57943777-57943799 AGCAGCCTGCTGCGCTCCACAGG + Intergenic
976136530 4:81943363-81943385 AGCAGCATGCTGCATGCAACTGG + Intronic
980456171 4:133046478-133046500 AGGAGCCTGCTGCACTAGAGGGG - Intergenic
987318616 5:16747470-16747492 TGCACCCTGCTGCACACCTCAGG - Intronic
987667293 5:20959579-20959601 AACAACCTGCTGGACTCCAGGGG - Intergenic
987701478 5:21405346-21405368 ACCTGCCAGGTGCACTCCACTGG + Intergenic
989643938 5:43608629-43608651 AGCATCCTGCTGCACTGAACAGG + Intronic
990130379 5:52574874-52574896 AGCAGCCTGAGGCTCTCCAGAGG + Intergenic
993434614 5:87876619-87876641 AGCTGGCTGCAGCACACCACAGG - Intergenic
995576948 5:113546930-113546952 AGAAGCCAGCTGCACCTCACAGG - Intronic
997703026 5:135918146-135918168 AGGAGCCTGCTGCACACTCCAGG + Intergenic
1001453797 5:171845804-171845826 TGCAGCCTTCTCCACCCCACAGG - Intergenic
1001945895 5:175777726-175777748 AGGAGCCTGCTGCATTCACCAGG + Intergenic
1003360719 6:5422506-5422528 AGCCCCATGCTGCCCTCCACTGG - Intronic
1005819053 6:29581985-29582007 AGCTGCATGCAGCACACCACTGG - Intronic
1007324288 6:41048476-41048498 AGCAGCCTCCCGCCCTCCAGAGG + Intronic
1007547334 6:42704396-42704418 AGCAGCCTCATGAACTCCATGGG - Exonic
1007765741 6:44158843-44158865 ACCAGCATGCTGTACTCCCCAGG + Exonic
1011703743 6:89980700-89980722 AGAACCCTGCTGGCCTCCACTGG + Intronic
1012093648 6:94931702-94931724 GGCAGCCTGCCCCACTCCACGGG + Intergenic
1015204047 6:130615077-130615099 ACCCGCCAGCTGCACTCAACAGG + Intergenic
1016071036 6:139739336-139739358 TGCAGCCTCCTGCACTACAAAGG + Intergenic
1017102365 6:150859903-150859925 AGCATCCTGGTGCCCTCCCCAGG - Intergenic
1017276975 6:152581181-152581203 TTTAGCCTGCTGCACTTCACCGG - Intronic
1019436412 7:1024568-1024590 AGCAGACTGCCCCACACCACAGG - Intronic
1021028286 7:15696810-15696832 AGCAACCTGCTGGAGACCACCGG - Intergenic
1022339119 7:29451984-29452006 AGGACCCTGCTGTCCTCCACGGG - Intronic
1022985502 7:35650262-35650284 GGCAGCCTGCTGCACTGGATGGG + Intronic
1023723097 7:43114689-43114711 AGCAGCCAACTGCACTAGACTGG - Intronic
1024208777 7:47186243-47186265 TTCAGCCTGCTGCATCCCACAGG + Intergenic
1024385558 7:48748131-48748153 AGAAGCCTGCTGCACTGGAGGGG + Intergenic
1026506575 7:70989596-70989618 AGCAGCCTGCAGCCCTCACCAGG + Intergenic
1026968925 7:74456185-74456207 TGCAGCCTGCTTGACTCCAGAGG + Intronic
1028283638 7:88966908-88966930 TGCAGCTTGTTGCACTTCACAGG + Intronic
1033323206 7:140358688-140358710 AACGGCCTGCTGCAGTCCACTGG - Exonic
1034896351 7:154878709-154878731 AGCTGCCCGCTGCCTTCCACAGG - Intronic
1035453748 7:158996265-158996287 AGTGGCCTGCTGGACCCCACCGG - Intergenic
1035602298 8:903857-903879 AGCAGACTGCCGCGTTCCACAGG + Intergenic
1036087517 8:5628304-5628326 AGCAGCCTGGTGCAGTCCAAAGG - Intergenic
1037127484 8:15368739-15368761 AGCAGCCATCTGCAATCCAAGGG + Intergenic
1043324625 8:79034432-79034454 AGCAGTCTGCTCCACTCCACAGG - Intergenic
1043738400 8:83775724-83775746 AGCACCCTGCTGCAGCCAACAGG + Intergenic
1044592004 8:93922434-93922456 AGCAGGTTGCTGCACTTCTCCGG - Exonic
1048318196 8:133377373-133377395 AGCAGCCTGCTGCACCATAGGGG - Intergenic
1048860070 8:138717784-138717806 ATCAGGCTGCTGCACTTCCCAGG + Intronic
1049183887 8:141238632-141238654 TGGAGCCTGCTGCCCTCCAGGGG - Intronic
1049611821 8:143559411-143559433 ACCAGCCTGCAGAGCTCCACTGG + Exonic
1051660996 9:19426956-19426978 AGCAGCCTGCAGCATTTCTCTGG + Intronic
1053269405 9:36739911-36739933 GGCAGCCGGCTCCCCTCCACAGG - Intergenic
1053426644 9:38014506-38014528 GGCAGCCTGCTGTCCTCCAGTGG - Intronic
1053427944 9:38023305-38023327 ACCACCCTGCTCCACTTCACAGG - Intronic
1054450564 9:65401632-65401654 GGCTGCCTGCTGCTCTGCACCGG - Intergenic
1054928821 9:70615527-70615549 AGCAGCCGGCTTCACTGAACTGG - Intronic
1056051761 9:82776647-82776669 AGCAGCCTGCTGAAGGACACTGG + Intergenic
1058119156 9:101119406-101119428 AGCCCTCTGCTGCCCTCCACTGG - Intronic
1058200024 9:102027869-102027891 GGCAGCCTGCCCCACCCCACTGG + Intergenic
1061399618 9:130361302-130361324 AGATGCCTCCTGGACTCCACAGG - Intronic
1062164491 9:135100469-135100491 ACCAGGCAGCTGCACTCCAAAGG - Intronic
1062295758 9:135825629-135825651 AGCAGCCTCTGCCACTCCACAGG + Intronic
1062427597 9:136513020-136513042 AACTGCCTGCTGCCCTACACAGG - Exonic
1186757768 X:12690847-12690869 AGCAGCCTGCTTGTCTCCCCAGG - Intronic
1187874706 X:23794616-23794638 AGCAGGTTGCAGCACACCACTGG + Intergenic
1192439960 X:71167076-71167098 AGCAGGCTGGTGTACTTCACTGG - Exonic
1196242132 X:113353897-113353919 AGCAGCCTTATGCATTCCAGAGG + Intergenic
1197206736 X:123797542-123797564 TGAAGCCTGCTGCACTCCAAGGG - Intergenic
1200086692 X:153610580-153610602 GGCGGCCTGCTGCACACCAGCGG - Intergenic
1200125949 X:153815047-153815069 CACAGGCTGCTGCACTCCCCGGG - Intronic