ID: 915597308

View in Genome Browser
Species Human (GRCh38)
Location 1:156902909-156902931
Sequence CAGGGCAGTCTGAGGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 655
Summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 596}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915597298_915597308 -3 Left 915597298 1:156902889-156902911 CCCCATTTCCGAATGGCTGACAG 0: 1
1: 0
2: 1
3: 13
4: 119
Right 915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG 0: 1
1: 0
2: 1
3: 57
4: 596
915597301_915597308 -5 Left 915597301 1:156902891-156902913 CCATTTCCGAATGGCTGACAGGG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG 0: 1
1: 0
2: 1
3: 57
4: 596
915597299_915597308 -4 Left 915597299 1:156902890-156902912 CCCATTTCCGAATGGCTGACAGG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG 0: 1
1: 0
2: 1
3: 57
4: 596
915597295_915597308 22 Left 915597295 1:156902864-156902886 CCAGGGGTGGTGGGGATGGAGAG 0: 1
1: 0
2: 10
3: 94
4: 810
Right 915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG 0: 1
1: 0
2: 1
3: 57
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915597308 Original CRISPR CAGGGCAGTCTGAGGGAGGC GGG Intronic
900122227 1:1053687-1053709 CAGGACAGGGTGGGGGAGGCGGG - Intronic
900484433 1:2914719-2914741 CAGAGCAGGATGAGGGAGGCTGG + Intergenic
900517841 1:3091566-3091588 TGGGAGAGTCTGAGGGAGGCTGG + Intronic
900540930 1:3202338-3202360 TGGGGGAGTCTGGGGGAGGCTGG + Intronic
900540943 1:3202368-3202390 TAGGGGAGGCTGGGGGAGGCTGG + Intronic
900612089 1:3548550-3548572 CAGGGCAGTCTGTCGGGGCCAGG - Intronic
900624407 1:3601584-3601606 CTGGGCAGGCTGAGGGGGCCAGG - Intronic
901053920 1:6440058-6440080 CAGGGACCTCTGAGGGAGGGTGG + Intronic
901174432 1:7288572-7288594 CAGGGCAGTGTGCTGGATGCAGG + Intronic
901438298 1:9262744-9262766 CAGGGCTTTCTGGGAGAGGCTGG + Intronic
901629827 1:10642659-10642681 AAGGGCAGTGCCAGGGAGGCGGG + Intronic
902480373 1:16708252-16708274 CAGGGGCCTCTGAGGGAGGGTGG - Intergenic
902609392 1:17588289-17588311 CAGGGCTGGGGGAGGGAGGCGGG + Intronic
902742135 1:18446013-18446035 GGTGGCAGTCTTAGGGAGGCAGG - Intergenic
903228762 1:21909319-21909341 CAGGGCAGGCAGATGGAGCCTGG + Intronic
903306851 1:22418785-22418807 CATGGGGGTCTGAGAGAGGCCGG - Intergenic
903663005 1:24990094-24990116 GAGGGAAGACTGTGGGAGGCAGG + Intergenic
903930911 1:26862060-26862082 GAGAGCAGTCTGAGTCAGGCAGG + Intergenic
904037680 1:27567594-27567616 CAGTGCAGTGCAAGGGAGGCAGG - Intronic
904317248 1:29673414-29673436 CAGGGCAGTCTGGGGTGGGCAGG + Intergenic
904912973 1:33949286-33949308 CAGGGCAGTGTGGGAGAGGCTGG + Intronic
905244948 1:36606453-36606475 CAGGGCTGGCTGAGCTAGGCTGG + Intergenic
905798988 1:40831333-40831355 GAGGGCCGGCTGAGGGTGGCAGG + Intronic
906129549 1:43448007-43448029 CAGGGCAGGGTGGGGCAGGCTGG - Intronic
906184517 1:43851371-43851393 CAGGGGAGCCTGAGCAAGGCTGG + Intronic
906249398 1:44299898-44299920 CAGGGCAGTCTTTGGAAGTCTGG - Intronic
906372067 1:45262485-45262507 CAGGACAGTATGACAGAGGCTGG - Intronic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
906711103 1:47930521-47930543 CAGGGCAGTAGCAGGGAGGAGGG - Intronic
908562308 1:65319031-65319053 CAGGGCAGTGTCAGTGAGACTGG + Intronic
909742295 1:79045433-79045455 CGGGGCAGTCAGAGGAAAGCTGG - Intergenic
910987387 1:93018743-93018765 CTTGGGAGTCTGAGTGAGGCAGG + Intergenic
911163248 1:94702523-94702545 CAGGGCCTCCTGAGGAAGGCTGG - Intergenic
912513718 1:110205245-110205267 CATGGCAGTCTCAGGGTGGTTGG - Intergenic
912821867 1:112874366-112874388 CAGGGCCCTGTGAGGGAAGCAGG - Intergenic
912945316 1:114079620-114079642 CAGGGCAGCGGGAGGGAGCCAGG + Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
915118989 1:153616909-153616931 AAGGGCAGCCTGATGGAGGGAGG + Exonic
915120882 1:153628967-153628989 CGGGGGAGTCTGGGGGTGGCAGG + Intronic
915225063 1:154405778-154405800 CACCGCAGTCTGTGGGAGGCTGG + Intronic
915244701 1:154548172-154548194 CAGGGCAGTGGAAGGGTGGCTGG - Intergenic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
916740839 1:167645865-167645887 CATGACAGACTGAGGGAAGCAGG - Intronic
916873466 1:168942244-168942266 GAGGCTAATCTGAGGGAGGCTGG - Intergenic
917165063 1:172102717-172102739 TGGGGCAGCCGGAGGGAGGCAGG - Intronic
917417516 1:174826047-174826069 CAGGACTATTTGAGGGAGGCAGG - Intronic
917745958 1:178007403-178007425 CAGAGCAAAATGAGGGAGGCAGG + Intergenic
918180943 1:182085725-182085747 CAGGTGATTCTGATGGAGGCAGG + Intergenic
918187911 1:182144067-182144089 CAGGGCAGTGTGGTTGAGGCTGG - Intergenic
919158631 1:193800731-193800753 CATGGCAGTAGGAGGGAAGCTGG - Intergenic
919610185 1:199735780-199735802 CAGGGCAGAGTGGGGCAGGCAGG - Intergenic
919747283 1:201016792-201016814 GAGGGCAGTCTCAGGAGGGCTGG - Intronic
919942179 1:202295841-202295863 CAGGGCAGTCTGAGGGTAATTGG + Intronic
919985913 1:202674830-202674852 CCGGCCAGTCTGAGGGTGTCTGG - Intronic
920535178 1:206732460-206732482 AAGGGCAGGGTGAGGGCGGCAGG - Intronic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
923019434 1:230151520-230151542 CAGGGCTATCTTGGGGAGGCCGG - Intronic
924308899 1:242719813-242719835 GTGGGCAGGGTGAGGGAGGCAGG - Intergenic
924539207 1:244965422-244965444 CAGGACAGTGAGAGGGAGGGAGG - Intergenic
1063043054 10:2362568-2362590 CACGGGAGCCTGATGGAGGCTGG - Intergenic
1065827425 10:29584745-29584767 CAGGGCATTCTGAGGTGGGAAGG + Intronic
1065884916 10:30068463-30068485 GATGGGAGTTTGAGGGAGGCAGG - Intronic
1066656776 10:37704307-37704329 CAAGCTAGTCTGAGGGAGGGAGG + Intergenic
1069096214 10:64262864-64262886 CAGGGCAGTGGGAGTCAGGCAGG - Intergenic
1069619044 10:69825001-69825023 CAGGTCAGTCAGAGAGAGGCAGG - Intronic
1069836432 10:71311320-71311342 CAGGGAAGTGGGAGGGCGGCAGG + Intergenic
1069984779 10:72275572-72275594 CAGAGCAGCCGGAGGGAGGGGGG + Exonic
1070168191 10:73913502-73913524 GAGGGATGTCTTAGGGAGGCAGG - Intronic
1070279180 10:75036496-75036518 CAGGGCAGTCCCAGGAAGCCAGG + Intergenic
1070662419 10:78316787-78316809 CAGGGCAGGCAGAGGGAACCAGG + Intergenic
1071566262 10:86672909-86672931 CAGGGCTGTTTGAGAAAGGCTGG + Intronic
1072095298 10:92172239-92172261 CAGTGCAGTTTGAGGTAGGGAGG - Intronic
1073043662 10:100623741-100623763 CAGCGCAGTATGAGGGCGGGGGG + Intergenic
1074110574 10:110419883-110419905 CAGGTGAGCCTGAGGGTGGCAGG + Intergenic
1074206118 10:111284363-111284385 CTGAGCAGGCTGAGGAAGGCTGG - Intergenic
1074578872 10:114697072-114697094 CAGGGCACTCTGGGGGAGGAAGG + Intergenic
1075077359 10:119360104-119360126 CGAGGGAATCTGAGGGAGGCAGG + Intronic
1075092371 10:119450978-119451000 CAGGGAAGACTGTGGGGGGCGGG - Intronic
1075092380 10:119451001-119451023 CAGGGAAGACTGTGGGGGGCTGG - Intronic
1076371601 10:129959293-129959315 GAGGGCAGGGCGAGGGAGGCCGG + Intronic
1076479732 10:130777330-130777352 CAGGGCAGACTGGAGGAGCCTGG + Intergenic
1076581863 10:131517240-131517262 CATGGCTGAGTGAGGGAGGCTGG - Intergenic
1076613908 10:131743797-131743819 CAGGGCTGTCTGGGAGATGCTGG - Intergenic
1076638693 10:131900165-131900187 CAGTGCAGTCTTAGGGAAACAGG - Intergenic
1076728022 10:132422277-132422299 CAGGGCTCTCTGTGGGAGCCGGG + Intergenic
1076799500 10:132814052-132814074 CAGGGCAGACCCAGGGAGCCGGG + Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077244530 11:1529778-1529800 CAGGGCCTCCTGAAGGAGGCAGG + Intergenic
1077315641 11:1918285-1918307 CCGGGCACTCAGCGGGAGGCAGG + Intergenic
1077393938 11:2312052-2312074 CAGGGCAGGCAGAGCCAGGCAGG + Intronic
1077491639 11:2863339-2863361 CTGGGCAGAGTGAGGGAGGGAGG + Intergenic
1077524733 11:3057306-3057328 CGGGCCAGGCTGAGGGCGGCTGG - Intronic
1077549972 11:3195841-3195863 CTGGGCAGTCAGAGGCAGCCTGG + Intergenic
1077922158 11:6649702-6649724 CAGGGCAGGGTGAGGGAGCTGGG + Intronic
1078058940 11:8031369-8031391 CTGGGCAGTTTCTGGGAGGCTGG + Intronic
1078667957 11:13341562-13341584 GAGGCCAGTGTGAGGGAGGGTGG - Intronic
1080002311 11:27363366-27363388 AAGGGCTGGCTAAGGGAGGCCGG - Exonic
1080572684 11:33570350-33570372 CTGGAAAGTCTGAGGGAAGCGGG + Intronic
1080628211 11:34050707-34050729 CAGTGCATCCTGAGGGAGCCTGG - Intergenic
1081350291 11:42043959-42043981 CAGGGCAGTCCCAGGGAAACTGG - Intergenic
1081967214 11:47177180-47177202 CCGCGCAGGCTGCGGGAGGCTGG + Intergenic
1083254482 11:61487731-61487753 CAGGGCAGTGCGAGGGAGTCTGG + Intronic
1083263690 11:61536491-61536513 CAGGGCAGTCAGAGGGCCACTGG - Intronic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083888415 11:65583906-65583928 CAGGGCATCCTGAGAGAGGAGGG - Intronic
1084267581 11:68012782-68012804 CAGGGGACTGTGAGGGAGGTGGG + Intronic
1084651088 11:70489935-70489957 CAGGGCAGGGTGGGGGAGGGGGG + Intronic
1085283755 11:75346898-75346920 CAGGGCAGTCTGTTATAGGCTGG - Intronic
1085335167 11:75687949-75687971 CCGGCCAGTGTTAGGGAGGCTGG - Intergenic
1085544168 11:77301684-77301706 AAGGGCAGCCCGAGGGAGGCGGG + Intronic
1085774203 11:79350959-79350981 CAGTGAGGTCTGAGGGAGGTAGG - Intronic
1085859194 11:80212168-80212190 CAGGGCCGTTTGAGGGACTCAGG + Intergenic
1085953300 11:81359377-81359399 CAGAGCAGCCTGAGGGCTGCTGG + Intergenic
1086114239 11:83230387-83230409 TAGGGGAGTCAGAGGGAGGTAGG - Intronic
1088576539 11:111277691-111277713 CAGAGCAGTTTAAGGGAAGCAGG + Intronic
1089177795 11:116561011-116561033 CAGCCCGGCCTGAGGGAGGCAGG + Intergenic
1089255204 11:117190434-117190456 CAGGGCAGGGTGGGGCAGGCTGG - Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089583870 11:119497804-119497826 CGGGTCTGTCTGAGGGAAGCCGG - Intergenic
1089626599 11:119754993-119755015 CAGGCCAGCATGAGGGAGGAGGG + Intergenic
1089962584 11:122629032-122629054 CTGTGCAGTAAGAGGGAGGCAGG + Intergenic
1090076741 11:123584497-123584519 CAGGGCAGCCTTGGGGAGGGAGG + Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1091023906 11:132125077-132125099 GCGGGCAGTGTGAGGAAGGCAGG - Intronic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091703165 12:2677403-2677425 GAGGGCAGTCGGTGGGTGGCAGG - Intronic
1091849793 12:3686452-3686474 CTGGGCAGTGTTGGGGAGGCAGG + Intronic
1094221696 12:28000936-28000958 CAGGGCAGCCTGAGGGCTGCTGG + Intergenic
1094687536 12:32732986-32733008 CTGGGGAGGCTGAGGCAGGCAGG + Intronic
1094804708 12:34078138-34078160 TAGGACAGTCTGATGGAGACTGG - Intergenic
1095116729 12:38363073-38363095 CAGGACAGTCTGATGGAGACTGG - Intergenic
1095449463 12:42314707-42314729 CTGGGCAGGCTGAGGCAGGTGGG + Intronic
1095476211 12:42589650-42589672 CAGCGCAGGCTGCGCGAGGCTGG + Exonic
1095957135 12:47813372-47813394 CAGGGCAGTCTGGGAGTGACAGG - Intronic
1095976207 12:47942538-47942560 GAGGGAGGTCTGAGAGAGGCTGG - Intronic
1096445229 12:51683993-51684015 CAGGGCAGAGGGAGGGAGGTGGG + Intronic
1096766249 12:53892723-53892745 CAGGGCAGTGGGTGGGAGGTAGG + Intergenic
1097051174 12:56224256-56224278 CAGGGCAGGCGGCGGGACGCAGG + Intronic
1097261945 12:57725390-57725412 CTGGGTTGGCTGAGGGAGGCAGG + Intronic
1097270777 12:57772591-57772613 GAGGGCAAACTCAGGGAGGCGGG + Exonic
1097938591 12:65279206-65279228 CGGGGCAGCCCGCGGGAGGCAGG + Intronic
1100353677 12:93808789-93808811 ATGGTCAGTCTGAGGAAGGCAGG - Intronic
1101005734 12:100399257-100399279 CAGGGCAGTCTGGGAGCAGCTGG + Intronic
1101984327 12:109433791-109433813 CAGCACATCCTGAGGGAGGCAGG + Intronic
1102659509 12:114513711-114513733 TAGGGCAGTCTCAGGGAAGTTGG - Intergenic
1103172309 12:118832232-118832254 CAGGAAAGTGTGTGGGAGGCAGG - Intergenic
1103329671 12:120145242-120145264 GAGGTGAGTCTGAGGTAGGCTGG - Exonic
1104581544 12:130014650-130014672 CAGCTCAGTCTAAGGGTGGCTGG - Intergenic
1104605127 12:130182648-130182670 CAGGGAAGAATGAGGGGGGCTGG - Intergenic
1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG + Intergenic
1104814476 12:131637830-131637852 TGGGGCAGTCAGAGGGAGGAGGG + Intergenic
1104855113 12:131898086-131898108 GAGGGCTGTGTGAGGGAGGAGGG + Intronic
1104869348 12:131983518-131983540 CAGGGCACTGACAGGGAGGCCGG + Intronic
1104981513 12:132574982-132575004 CTGGGAAGGCTGAGGAAGGCGGG + Intronic
1105411242 13:20173643-20173665 CAGGGCAGGCTGAGGATGCCAGG - Intergenic
1107019974 13:35741336-35741358 CAGAGCAGTCCGAGGGCTGCTGG + Intergenic
1107366334 13:39681831-39681853 CATGACAGTATTAGGGAGGCAGG - Intronic
1107963623 13:45579879-45579901 CAGGGCACTCTGAAGAAAGCAGG + Intronic
1108500862 13:51068670-51068692 CCAGGCAGTCTGAGGTAGACTGG - Intergenic
1109212231 13:59547867-59547889 CTGGGCACTCTGAGAGAGGTAGG - Intergenic
1110046591 13:70840870-70840892 CAGAGCAGACTGAGGGCTGCTGG - Intergenic
1110046747 13:70841697-70841719 CAGAGCAGCCTGAGGGCTGCTGG - Intergenic
1110647938 13:77910613-77910635 AAGGGCATTCTGATGGATGCAGG - Intronic
1112250463 13:97774555-97774577 CACGGCAGCCTGAGGCAGGGAGG - Intergenic
1113500221 13:110767475-110767497 CAGGGCTGGCTGATAGAGGCTGG + Intergenic
1113570754 13:111355242-111355264 CTGTGCAGTCTGAGAGATGCTGG + Intergenic
1113781638 13:112980777-112980799 CAGTGGACTCGGAGGGAGGCTGG - Intronic
1113917103 13:113880983-113881005 CTGGGCTGTGTGATGGAGGCTGG - Intergenic
1114260751 14:21034466-21034488 CAGGGCTGGCTGAAGGTGGCTGG - Intronic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1114778278 14:25511457-25511479 CCTGGGAGTATGAGGGAGGCAGG - Intergenic
1116134344 14:40901381-40901403 CAGGGCCTTCTGAGGGAGTGTGG - Intergenic
1118609793 14:67531404-67531426 CTTGGCAGTCTGTGGGAGGGTGG - Intronic
1119968915 14:78947724-78947746 CAGGGCAGGCTGAGGGACCATGG - Intronic
1120312909 14:82854287-82854309 CAAGGAAGTCAGAGGGAGTCTGG - Intergenic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1122122288 14:99561009-99561031 CTGTGGAGACTGAGGGAGGCAGG - Intronic
1122179238 14:99943638-99943660 CAGGGCAGTTTGTGAGAGGCAGG + Intergenic
1122276615 14:100593995-100594017 CAGGGCAGTCGTGGGCAGGCAGG - Intergenic
1122286787 14:100657128-100657150 AAGGGCGGTGTGAGGCAGGCAGG - Intergenic
1122529834 14:102417926-102417948 CAGGGGAGCCGCAGGGAGGCAGG + Intronic
1122970220 14:105149468-105149490 CTGGGCAGTCTCAGGTGGGCAGG - Intronic
1123037797 14:105478515-105478537 CAGGGCAGGCCGAGGGCAGCCGG - Intronic
1123144178 14:106111718-106111740 CAGGGCAGTGTGAGGGGAGGAGG - Intergenic
1123220950 14:106854807-106854829 CAGGGCAGTGTGAGGGGAGGAGG - Intergenic
1124120762 15:26886485-26886507 CAGGGCTGTCTGAGGGCTGAAGG - Intronic
1124258185 15:28163074-28163096 CAGGTGAGTCTCAGGGAGGGCGG - Exonic
1125022947 15:35003020-35003042 CAGGACAGTTTGTGGGTGGCTGG - Intergenic
1126228285 15:46296421-46296443 CAGGGCAGTCCGAGGCGAGCCGG + Intergenic
1126688057 15:51265481-51265503 GAAGACAGGCTGAGGGAGGCAGG + Intronic
1126745025 15:51817625-51817647 CAGGGCAGTCGGAGGAGAGCCGG - Intergenic
1126876378 15:53045945-53045967 CTTGGGAGGCTGAGGGAGGCAGG - Intergenic
1127530516 15:59839164-59839186 CAGAGCAGTGTGAAGGAAGCTGG - Intergenic
1127886649 15:63207385-63207407 CAGAGGAGTCTGAGAGAGGCCGG - Intronic
1127935290 15:63631453-63631475 CAGTGCAGTCTCTGAGAGGCAGG - Intronic
1128333969 15:66774319-66774341 GACTGCAGTCTGAGGGAGGCGGG - Intronic
1128382644 15:67124807-67124829 CAGGGCAGCCGGGGAGAGGCTGG + Intronic
1128727607 15:69999485-69999507 CTGGTCAGGGTGAGGGAGGCGGG - Intergenic
1129072493 15:72962819-72962841 CAGTGCAGTATGGGGCAGGCAGG - Intergenic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129426702 15:75468719-75468741 CAGGGTAGTTTAAGGAAGGCTGG + Exonic
1129681796 15:77662342-77662364 AAGGGCGGTCAGAGGGAGGAAGG + Intronic
1130117234 15:81015686-81015708 AATTGCAGTCTGAGAGAGGCCGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130322699 15:82854027-82854049 GAGGGCACTCTGAGAGAGACAGG + Intronic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1131156152 15:90076994-90077016 CAAGGCTGTATGAGGGAGGTGGG - Intronic
1132068993 15:98758797-98758819 GAGGGGACTGTGAGGGAGGCAGG + Intronic
1132540602 16:507054-507076 CATCGAAGGCTGAGGGAGGCGGG - Intronic
1132545045 16:529032-529054 CTGGCCTGTCTGGGGGAGGCAGG + Intronic
1132591172 16:727094-727116 AAGGACAGACTGACGGAGGCGGG - Intronic
1132600603 16:770953-770975 CCGGCCAGCCTGTGGGAGGCGGG + Exonic
1132690595 16:1180363-1180385 CAGGGCAGGCTGGGTGAGGAGGG + Intronic
1132749438 16:1450704-1450726 CAGGGCAGTCCTGCGGAGGCGGG - Intronic
1132858123 16:2056546-2056568 CAGCGCAGGCTGAAGGAGGTGGG + Intronic
1132943317 16:2519200-2519222 CAGGGCTGTGGGAGGAAGGCGGG - Exonic
1134056520 16:11173711-11173733 CAGGACAGTGTGAGGAGGGCAGG - Intronic
1135083893 16:19459244-19459266 CAGGGCCATGTGAGGGAGGCAGG + Intronic
1135645063 16:24154639-24154661 CAGGGCAGTTGGAAGGAGTCTGG - Intronic
1135770759 16:25216798-25216820 CAGGGCAGGGTGAGGGAGTCAGG - Intronic
1135899757 16:26446179-26446201 GTGGACAGACTGAGGGAGGCTGG - Intergenic
1137293556 16:47068764-47068786 CAGGGCAGTTTAATGGATGCTGG + Intergenic
1137685874 16:50386441-50386463 CAGGACAGTGTCTGGGAGGCGGG + Intergenic
1137759306 16:50927681-50927703 CTTGGGAGGCTGAGGGAGGCAGG - Intergenic
1138246468 16:55470588-55470610 CAATGCAGTCTGAGGGTGGGAGG - Intronic
1139407606 16:66731434-66731456 GAGTGCAGTCTGTGAGAGGCTGG - Intronic
1139476045 16:67203044-67203066 GAGGGCAGGCAGAGGGCGGCTGG + Intronic
1140072506 16:71663417-71663439 CAGTGCAGTCTAAGAAAGGCAGG - Intronic
1140121254 16:72084883-72084905 CACAGAAGTCTGAGGCAGGCAGG + Exonic
1140281310 16:73557468-73557490 CAGAGCAGCCTGAGGGCTGCTGG + Intergenic
1141079893 16:81040949-81040971 CAGGGGAGCATGAGGGAGGTTGG + Intronic
1141193626 16:81842880-81842902 CAGGGAGGGCTGAGGGAGGGTGG + Intronic
1141945333 16:87305499-87305521 CAGGGCAGCCTGGGGGCGGCGGG - Intronic
1142253200 16:89002212-89002234 CAGAGCAGCCGGAGGGACGCAGG + Intergenic
1142352600 16:89586951-89586973 CTGGGCTGCCTGCGGGAGGCAGG + Intronic
1142597653 17:1037331-1037353 GAGGTCAGGCAGAGGGAGGCTGG - Intronic
1143138050 17:4723113-4723135 CACGGGAGTCGGAGGGATGCTGG - Intergenic
1143563133 17:7706845-7706867 CAGAGAAGTGTGAGGGAGGCTGG - Intronic
1143586476 17:7853172-7853194 CAGTGCAGTCAGGGGGAGGGAGG - Intronic
1143620102 17:8075780-8075802 CAGGGCACCCTGGGGGAGGTGGG - Intronic
1143714251 17:8755786-8755808 CCGGGAAGTCGGAGGGAGGGAGG + Intronic
1143732090 17:8887026-8887048 CAGGGCCTTCTAAGTGAGGCTGG + Intronic
1145256179 17:21323690-21323712 CAGGGCAGTTTGAGAAAGCCAGG + Intergenic
1145265576 17:21378182-21378204 CAGCGCAGCGCGAGGGAGGCTGG - Intronic
1145722893 17:27089694-27089716 CAGAGCAGTAAGAGGGTGGCCGG + Intergenic
1147122573 17:38344175-38344197 AAGGGCAGGCAGAGGGAGGGAGG - Intergenic
1147164120 17:38584418-38584440 AAGGGCAGGGTGAGGAAGGCGGG + Intronic
1147441896 17:40452660-40452682 CAGGGAGGTCTGAGGCAGGCAGG - Intronic
1147844263 17:43393850-43393872 CAGGGAACACTGAGGCAGGCAGG - Intergenic
1148127568 17:45244805-45244827 CAGGACAATCTGGGAGAGGCAGG - Exonic
1148245037 17:46024910-46024932 CAGGGCAGCCTGTGGGAGAAGGG + Exonic
1148341931 17:46878418-46878440 CAGGGCAGTCTGCTGGATGCTGG + Intronic
1148633914 17:49132763-49132785 TCCGGCAGTCTGAGGGCGGCGGG + Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1149552777 17:57552388-57552410 CAGGGCAGTGAGTGGGGGGCTGG - Intronic
1149867170 17:60157373-60157395 TAGAGGAGGCTGAGGGAGGCTGG + Intronic
1150469791 17:65427150-65427172 CATGGCAGTGTGAAGCAGGCTGG + Intergenic
1150833080 17:68541047-68541069 CAGGGCAGGATCAGGGAGGCAGG - Intronic
1151539534 17:74758078-74758100 CAGGGAAGGCTGTGGGAGCCTGG - Intronic
1151858216 17:76737752-76737774 CAGCGGAGTCTGAGGGGGCCGGG - Exonic
1152147843 17:78579805-78579827 CAGAGCAGCCTGAGGGCTGCTGG - Intergenic
1152158825 17:78654143-78654165 CAGGGTAGTGTGCGGGATGCTGG - Intergenic
1152228232 17:79102471-79102493 CAGGGCAGCCAAAGGGTGGCTGG - Intronic
1152241351 17:79163015-79163037 CAGGGCTGTCTGGGGGAGAGAGG + Intronic
1152251669 17:79215768-79215790 CAGGGCAGGCTGAGAGAGGGCGG - Intronic
1152756413 17:82088868-82088890 CAGGACAGCCTGGGGGCGGCAGG + Exonic
1152834905 17:82523146-82523168 AAGGGCAGTGAGATGGAGGCTGG + Intronic
1153836110 18:8965547-8965569 CCGGGCAATCTGAGGGTGGTGGG - Intergenic
1155630540 18:27887533-27887555 CAGGGAAGGAGGAGGGAGGCAGG - Intergenic
1156835052 18:41542655-41542677 CATGGAAGGCTGAGGCAGGCAGG + Intergenic
1157079542 18:44507946-44507968 AAGGGCAGTCTGATGAATGCAGG - Intergenic
1157241597 18:46015032-46015054 CAAGGGAGTCAGAGGGATGCAGG + Intronic
1157381515 18:47222533-47222555 CAGGGCAGTTTGTGGAGGGCTGG - Intronic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1157862522 18:51153856-51153878 CAGGGCTGGCCGAGGGGGGCTGG + Intergenic
1160419081 18:78731919-78731941 CGTGGCAGTCTCAGGGTGGCTGG - Intergenic
1160557903 18:79738017-79738039 CAGGGCGGGCGGGGGGAGGCGGG - Intronic
1160659080 19:290089-290111 GAGGGCAGTGTGAGGGCGGGAGG - Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1161849581 19:6731549-6731571 CAGGGGAGACTGAGGGTGGGAGG + Intronic
1162183062 19:8883710-8883732 CAGGGCAGAGTGAGGTGGGCAGG + Intronic
1162185149 19:8898881-8898903 CAGGGCAGAGTGAGGAGGGCAGG + Intronic
1162362389 19:10227851-10227873 CAGGGCAGCCTGGGGGTGTCTGG - Intronic
1162965965 19:14156241-14156263 CAGTGCTCACTGAGGGAGGCAGG - Intronic
1162994596 19:14326109-14326131 CATGGCAATTTGAGGGGGGCAGG + Intergenic
1163305061 19:16472459-16472481 CGGGGCAGGGTGAGGGGGGCAGG - Intergenic
1163556962 19:17998534-17998556 CTGGGCAGTCTGGGCGGGGCAGG - Exonic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1163681249 19:18683856-18683878 CAGGGCCGGCGGAGGGAGGGAGG + Intronic
1165020887 19:32923022-32923044 CAGGGCAGGCGGATGGAAGCTGG + Intronic
1165333683 19:35154975-35154997 CTGGGGAGACTGAGGCAGGCGGG - Exonic
1165705248 19:37971398-37971420 CAGGGCAGAATCAGGGAAGCGGG - Intronic
1165815540 19:38639886-38639908 CAGGGCCCTCTGAGGAATGCTGG - Intergenic
1166785627 19:45365007-45365029 CAGGGCTGAGGGAGGGAGGCAGG - Intronic
1167448710 19:49554855-49554877 CAGGGGAGAGTGAGGGAGCCAGG - Intergenic
1167636083 19:50656566-50656588 AAGGGGAGGCTGAGGGGGGCAGG + Intronic
1167668901 19:50838702-50838724 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1167669194 19:50839630-50839652 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167674896 19:50877889-50877911 CAGGAGACTGTGAGGGAGGCTGG - Intronic
1167713157 19:51124667-51124689 AAGGGCATTGAGAGGGAGGCAGG + Intergenic
1168104963 19:54160937-54160959 CTGGGTGGTCTCAGGGAGGCTGG + Exonic
1168681060 19:58316190-58316212 TAGAGCAGGCTGAGGAAGGCAGG - Intergenic
1168695297 19:58400812-58400834 CAGGGCCCCCTGAGGGTGGCGGG - Intergenic
1202714414 1_KI270714v1_random:34154-34176 CAGGGGCCTCTGAGGGAGGGTGG - Intergenic
925011712 2:490436-490458 CAGGGCTGTATGATGGAAGCAGG + Intergenic
926020128 2:9487282-9487304 CAGGGCAATGGGAGGGAGACTGG + Intronic
926088696 2:10036245-10036267 CTGGCCTGTCTGGGGGAGGCTGG + Intergenic
926693087 2:15750929-15750951 CAGGGCAGTAGGCTGGAGGCAGG - Intergenic
926926827 2:17995800-17995822 CAGGGCAGTCTCAGGGACCAAGG + Intronic
927673983 2:25091232-25091254 CAGGGCAGCCTGTGAGTGGCAGG - Intronic
927866054 2:26588353-26588375 CAGGGCAGCCTGGGAGGGGCTGG + Intronic
928162385 2:28939997-28940019 CTCGGGAGGCTGAGGGAGGCAGG + Intronic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
928940160 2:36719102-36719124 AAGGGCAGGCTGAGAAAGGCAGG - Intronic
930017340 2:46979936-46979958 CATGGAAGGCTGAGTGAGGCAGG - Intronic
931450377 2:62363226-62363248 TAGGGGAGTCTGAGGAAGGATGG - Intergenic
931579762 2:63759982-63760004 GGGGGCAGTAAGAGGGAGGCTGG + Intronic
933398821 2:81765599-81765621 CAGAGCAGTCTGAGGAGAGCTGG + Intergenic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
934732736 2:96669680-96669702 CCGGGAAGTCTGACTGAGGCAGG - Intergenic
935054025 2:99549944-99549966 CAGGACGGTCTGAGAAAGGCAGG - Intronic
935341261 2:102061630-102061652 AAGGGCAGCCTGATGGAGGGAGG - Intergenic
935924192 2:108049675-108049697 CAAGCCATCCTGAGGGAGGCTGG - Intergenic
936075645 2:109399980-109400002 CAGGGCAGCCAGAGGGACTCTGG - Intronic
936463151 2:112726159-112726181 CAGGGCAGACACAGGCAGGCAGG + Intronic
936846065 2:116835016-116835038 CAGGGCAGACTGAGGGACTTGGG - Intergenic
937288317 2:120766935-120766957 CAGGGCAGCTGGAGAGAGGCTGG + Intronic
937340689 2:121088773-121088795 CCAGGCAGGCTCAGGGAGGCAGG - Intergenic
938063646 2:128269870-128269892 CAGGGCAGTGTGAGGGGAGGAGG - Intronic
938077634 2:128348239-128348261 CAGGGCAGCTTTAGGAAGGCAGG + Intergenic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
938732695 2:134158685-134158707 CAGGGCAGCCAGCGGGAGACGGG - Intronic
938770204 2:134495058-134495080 CAGGGCAGGCTGAGGGGTGGTGG + Intronic
938995680 2:136674945-136674967 CAGGTCAGTCTGAATGATGCAGG - Intergenic
939190958 2:138916414-138916436 CAGGTCAGCGTGAGGCAGGCAGG - Intergenic
942058175 2:172204656-172204678 CAGAGCAGGGTGAGGGAGACTGG - Intergenic
944587468 2:201185344-201185366 CAAAGCAATCTGGGGGAGGCAGG - Intronic
944677221 2:202043586-202043608 CAGGGCAGGCTCAAGGAGGGTGG + Intergenic
944781333 2:203021031-203021053 CTCGGGAGGCTGAGGGAGGCAGG - Intronic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
947986284 2:234450364-234450386 CAGGGCAGTGGGAGGGAGAGTGG + Intergenic
948612049 2:239176183-239176205 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612078 2:239176267-239176289 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612086 2:239176286-239176308 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948756493 2:240162577-240162599 CAGGGCGGGTGGAGGGAGGCGGG + Intergenic
948844710 2:240677502-240677524 GAGGGCAGGCCCAGGGAGGCGGG + Intronic
948849150 2:240697377-240697399 GAGGGCAGGCCCAGGGAGGCGGG - Intronic
948870244 2:240794159-240794181 CAGGGAAGCCTGACGGAGGAAGG - Intronic
949009801 2:241671975-241671997 CAGGGCAGGGTGAGGAGGGCAGG - Intronic
949020946 2:241741105-241741127 CAGGGAAGGCTGGGGGAGCCGGG - Intronic
1168848000 20:958615-958637 CAGGGAAGTCAGAGAGAGGGTGG + Exonic
1168970882 20:1929991-1930013 GAGGGCAGACTGTGGGAGGAGGG - Intronic
1170296546 20:14832440-14832462 AATGGCAGTTTGAGGAAGGCTGG + Intronic
1170589689 20:17762457-17762479 CAGCTCTGTCTGAGTGAGGCTGG + Intergenic
1171242869 20:23585932-23585954 CAGGGCAGGACGAGGGAGGGAGG - Intergenic
1172620887 20:36317867-36317889 CAGGGCTGGCTGAGGTTGGCAGG + Intronic
1172657263 20:36544782-36544804 AAAGCCAGTCTGGGGGAGGCAGG + Intronic
1172722631 20:37011968-37011990 CTGGGCAGGCTGAGGCAGGGAGG - Intronic
1172894525 20:38291233-38291255 CATGGCTGACTCAGGGAGGCTGG + Intronic
1173884037 20:46441148-46441170 CAGGGCACCATGAGGGATGCTGG - Intergenic
1174196534 20:48776341-48776363 CTCGGCTGTCTGAGGGGGGCGGG - Intronic
1174843836 20:53924154-53924176 GGGGTCAGTATGAGGGAGGCGGG - Intergenic
1174983335 20:55421719-55421741 GACGGCATTCTGGGGGAGGCTGG - Intergenic
1175306750 20:57981485-57981507 CAGGGCAAGGTGAGTGAGGCGGG + Intergenic
1175385423 20:58591893-58591915 CATGACAATGTGAGGGAGGCAGG + Intergenic
1175550391 20:59813725-59813747 CAGGGCTGGGTGAGGGTGGCAGG + Intronic
1175744443 20:61445439-61445461 GAGGGCCCTCTGAGGCAGGCGGG + Intronic
1175764276 20:61582023-61582045 CAGGGCAGCCTGTGGGAAGAGGG + Intronic
1175823929 20:61926410-61926432 CAGCGCTGGCTGGGGGAGGCTGG - Intronic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1175948769 20:62571534-62571556 CAGGGGAGGCTGAGTGAGGGAGG + Intergenic
1175964136 20:62652022-62652044 CGGGGCAGGGTGGGGGAGGCGGG - Intronic
1176022338 20:62968167-62968189 CAGGGCAGTGGGTGGGTGGCGGG + Exonic
1176047226 20:63099247-63099269 CAGGTGGGTCTGAGGGAGGAAGG - Intergenic
1177223626 21:18224898-18224920 CAGGGCGGCCTTAGGGAGGCTGG + Intronic
1179337922 21:40475113-40475135 CACGACAGTCTGAAGGAGGAGGG - Intronic
1179596545 21:42446430-42446452 CAGGGGGGTCTGAGTGAGGCTGG - Intronic
1179615267 21:42579521-42579543 CAGGGCTGTCTGATGAGGGCAGG - Intronic
1179624027 21:42638096-42638118 CAAGCCAGACTGAGGGAGCCTGG - Intergenic
1180011359 21:45053670-45053692 CAGGGCAGACTGTGGAAGGGAGG - Intergenic
1180039848 21:45270146-45270168 CAGGGCTGTCTAAGGGATTCAGG + Intronic
1180063978 21:45403985-45404007 CTGGGAAGGCTGAGGCAGGCAGG + Intergenic
1180149883 21:45942106-45942128 CAGGGCTGTGTGAGAGAGGAGGG - Exonic
1180823005 22:18844990-18845012 CAGACAAGTCTGCGGGAGGCAGG + Intergenic
1181024542 22:20120552-20120574 CAGAGTCGTCTGAGAGAGGCAGG + Intronic
1181189955 22:21131022-21131044 CAGACAAGTCTGCGGGAGGCAGG - Intergenic
1181209249 22:21279483-21279505 CAGACAAGTCTGCGGGAGGCAGG + Intergenic
1181491027 22:23260871-23260893 CAGGGCCCTCTGAGAGAGGAGGG - Intronic
1181502660 22:23326703-23326725 CAGACAAGTCTGCGGGAGGCAGG - Intergenic
1181666877 22:24404647-24404669 GAGGGCAGTCAGAGGCCGGCTGG - Intronic
1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG + Intergenic
1182058817 22:27382186-27382208 GAGGGCAGAGTGAAGGAGGCTGG + Intergenic
1182086309 22:27563547-27563569 CAGGGCAGAGGGATGGAGGCAGG - Intergenic
1182285888 22:29246703-29246725 CAGGCCAGGCTGAAGGAGACTGG + Intronic
1182302228 22:29343381-29343403 CAGGGAAGGCTGACAGAGGCAGG + Intronic
1182659528 22:31915500-31915522 AAGGGCAGGCTGGGTGAGGCAGG - Intergenic
1182697637 22:32207309-32207331 CAGAGCAGTAGGAGGGCGGCTGG + Intergenic
1182960202 22:34465021-34465043 CAGGCCAGGCTGAAGGTGGCAGG + Intergenic
1183074205 22:35416453-35416475 CAGGGCAGCCTGAGGACGGTTGG - Intronic
1183469431 22:37997747-37997769 CGGGGCAGTCTCAGGGAAGCTGG - Intronic
1183524263 22:38314489-38314511 CAGGCCAGGCTGTGGGAGCCTGG - Intronic
1183546171 22:38455688-38455710 CAGCGCGGGCAGAGGGAGGCGGG - Intergenic
1184088680 22:42281257-42281279 CAAGGCAGCCTGAGAGAGGCTGG + Intronic
1184189501 22:42885498-42885520 CAGGGCCTTCTGAGGAAGGATGG + Intronic
1184384580 22:44166989-44167011 CAGGGCAGTCTCAGGCCTGCAGG - Intronic
1184390668 22:44201404-44201426 CATGGCAGGCTGCGGGCGGCAGG - Intronic
1184571797 22:45329658-45329680 CAGGGCCGCCTGAGGGGAGCGGG + Intronic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1184735375 22:46394819-46394841 CGGGGGAGGCTCAGGGAGGCAGG - Intronic
1184746348 22:46458384-46458406 CAGGGCAGGACGAGGGTGGCAGG + Intronic
1184872657 22:47250850-47250872 CAGGGCAGTGTGAGGATGGAGGG - Intergenic
1184992537 22:48180487-48180509 CATGGCAGCCCGAGGGAGGAGGG - Intergenic
1185011278 22:48316025-48316047 CATGGCAGCATCAGGGAGGCTGG + Intergenic
1185017697 22:48354503-48354525 TAGGTTAGGCTGAGGGAGGCAGG + Intergenic
1185079873 22:48703753-48703775 CAGGGCAGGCTGTGAGAGGGTGG - Intronic
1185117539 22:48946143-48946165 CAGGGCATACGGAGGGAGGGAGG + Intergenic
1185133180 22:49052151-49052173 CAGGTCAGGCTGAGCGGGGCCGG - Intergenic
1185146507 22:49139921-49139943 CAGGCCAGTGTGAGGGCTGCAGG - Intergenic
1203217696 22_KI270731v1_random:15960-15982 CAGACAAGTCTGCGGGAGGCAGG - Intergenic
1203273146 22_KI270734v1_random:70896-70918 CAGACAAGTCTGCGGGAGGCAGG + Intergenic
950050643 3:9986466-9986488 CACGGCGGTGTGAGGTAGGCTGG + Intronic
950056085 3:10026000-10026022 CACGGCGGTGTGAGGTAGGCTGG + Intergenic
950078675 3:10205866-10205888 AACTGCAGTCTGAGGGATGCGGG + Intronic
950089334 3:10284395-10284417 CATGGCTGTCTGAGGGTGGAGGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951543821 3:23806600-23806622 CAGGGCGGCCAGAGGCAGGCAGG + Intronic
951739606 3:25905914-25905936 CTGGGCAGTCTGATGGAGAATGG + Intergenic
952945768 3:38477186-38477208 CAGGCCACCCTGAGGGAGGGAGG - Intronic
953140708 3:40226916-40226938 CAGGGCAGGCTGTGGGAGACAGG - Intronic
953472297 3:43177627-43177649 CAGGGGAGTCAGAGGGGGGGGGG - Intergenic
953545964 3:43863760-43863782 CAGTGAGGTCTGATGGAGGCTGG + Intergenic
953755560 3:45643081-45643103 GTGGCCTGTCTGAGGGAGGCTGG + Intronic
954688701 3:52384452-52384474 CAGGGCTCTCAGAGAGAGGCAGG + Intronic
954936516 3:54331926-54331948 CAGGGTAGATTGAGGGAGGGAGG - Intronic
955951917 3:64251150-64251172 GTGCCCAGTCTGAGGGAGGCTGG + Intronic
958145039 3:89613211-89613233 CATGTCATTCTGAGGGAAGCAGG - Intergenic
959500425 3:107100343-107100365 CAGCACAGTGTGAGGGAGGAGGG + Intergenic
959542265 3:107553540-107553562 GAGGGCAGTTTGTGGGAGGAGGG + Intronic
961017918 3:123481772-123481794 CAGAGAGGGCTGAGGGAGGCAGG + Intergenic
961291249 3:125848582-125848604 CTGGGGAGCCTGAGGTAGGCAGG - Intergenic
962264413 3:133935102-133935124 CAGGACCGTCTGGGGGTGGCTGG - Intronic
962350820 3:134654526-134654548 CAGGGTAGGCTGAGGGAGTTAGG - Intronic
962397967 3:135034291-135034313 CATGAAGGTCTGAGGGAGGCAGG - Intronic
962947131 3:140182456-140182478 CAGGACAGACTGAAGAAGGCTGG - Intronic
963043287 3:141084478-141084500 CAGGGCAGGCAGGGGGAGGGGGG - Intronic
965597378 3:170422063-170422085 CAGGGCACTGTGGGTGAGGCAGG + Intronic
966595155 3:181719429-181719451 CAGGGCAGCCGGCGGGAGGCCGG - Intergenic
967106199 3:186256723-186256745 CAGGCCAGGCTGCTGGAGGCAGG - Intronic
967852684 3:194093954-194093976 CGTGGCAGTGTGAGGCAGGCGGG + Intergenic
967979687 3:195058484-195058506 CAGGGCAGACTGAGGGGTGGAGG - Intergenic
968213317 3:196867740-196867762 CAGCGCGTTCTGAGGGAGGCCGG + Intergenic
968447929 4:661850-661872 CCAGGCAGTCGGATGGAGGCTGG + Intronic
968521788 4:1037516-1037538 CAGGGCTGCCTGCAGGAGGCTGG - Intergenic
968521808 4:1037596-1037618 CAGGGCTGCCTGCAGGAGGCTGG - Intergenic
968581376 4:1396941-1396963 CAGGGCAGTCGGGAGGAGGTGGG + Intergenic
968712371 4:2128294-2128316 CAGGAGAGTCTGAGGGTGGCCGG - Intronic
968919908 4:3517134-3517156 CAGGTCAGGCTAAGGGAGCCTGG + Intronic
968969111 4:3784330-3784352 CAGGGAGCTCTGAGGGAAGCTGG - Intergenic
969006042 4:4020906-4020928 CTGGGGAGCCTGAGGTAGGCAGG + Intergenic
969379224 4:6783104-6783126 GGGGCCAGCCTGAGGGAGGCCGG + Intronic
969469428 4:7378773-7378795 CACGGTGGTCTGAGGGAGGTGGG - Intronic
969489334 4:7490318-7490340 CAGGCCTGGCAGAGGGAGGCAGG - Intronic
969515112 4:7643098-7643120 CAGGGCAGTCTGAGGGTAGGTGG - Intronic
969576556 4:8039346-8039368 CAGGGAAGCCTGAGGAAGGCTGG - Intronic
969601496 4:8179236-8179258 TCCGGCAGGCTGAGGGAGGCCGG - Intergenic
969806906 4:9616384-9616406 CTGGGGAGCCTGAGGTAGGCAGG - Intergenic
969867577 4:10085693-10085715 CAGGGAAGTCTCAGGGCAGCAGG - Intronic
970012988 4:11481015-11481037 CAGAAGAGTCTGTGGGAGGCAGG + Intergenic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
970636975 4:18021177-18021199 CAGGGCGGCCGGAGGAAGGCGGG - Intronic
970658655 4:18260369-18260391 GAGGGCAGTGGGAGTGAGGCTGG - Intergenic
970946369 4:21697784-21697806 CAGACCATTCAGAGGGAGGCGGG + Intronic
972425902 4:38932602-38932624 CAGGGGAGACTGAGGCAGGAGGG - Intronic
972774638 4:42229708-42229730 CAGGCCAGTCTGAGCGACACAGG + Intergenic
975072163 4:70155474-70155496 CTGGGTAGGCTGAGTGAGGCAGG - Intronic
976070645 4:81236134-81236156 CAGGGCAGTCTGAGAAGAGCCGG - Intergenic
976244091 4:82990150-82990172 CATGGCATTCTGAAGGAGGAAGG - Intronic
976456025 4:85247568-85247590 CAGAGCAAAATGAGGGAGGCAGG - Intergenic
977928013 4:102722915-102722937 GAGGGCAGTCTGGGGGAACCTGG + Exonic
979341216 4:119526389-119526411 CTGCTCAGTCTGAGGGAGCCAGG - Intronic
979860095 4:125682874-125682896 CAGGGCAGTCGGAGGAGAGCCGG - Intergenic
981067259 4:140498227-140498249 CTGGCCAGGCTGCGGGAGGCCGG + Intronic
981944801 4:150328733-150328755 GAGGGCAGTCAGAGGGTGGGTGG + Intronic
984708125 4:182862728-182862750 CAGGGAAGGCTGGGGGTGGCAGG - Intergenic
985062397 4:186092394-186092416 CAGAGCAGTCTTGCGGAGGCTGG + Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985487623 5:160430-160452 CGGGGCAGCCGGCGGGAGGCAGG - Intronic
985489489 5:171147-171169 CCGGGCAGGCTGTGGGGGGCGGG - Intronic
985687106 5:1288412-1288434 GAGGGAAGTCTGACGAAGGCTGG + Intronic
985719720 5:1482614-1482636 CAGGGCAGGCTGGGGTGGGCTGG + Intronic
985761432 5:1751279-1751301 CAGGGCAGTCTCTGGGGGGCTGG - Intergenic
986968418 5:13303219-13303241 CAGGGAAGTCTTAAGGAGGTAGG + Intergenic
987375411 5:17229597-17229619 AAGGGAAGTCTGGGAGAGGCTGG + Intronic
992366091 5:76091443-76091465 CTGGGCAGTGAGAGGCAGGCTGG - Intronic
992424329 5:76640561-76640583 CTTGGCAGTCCGAGGGAAGCGGG + Intronic
992568187 5:78023496-78023518 CAGGGCAGTATGTAGGAGTCTGG + Intronic
992616118 5:78547846-78547868 CAGGGTGGTCTGAGGGAGACTGG + Intronic
992732278 5:79683810-79683832 CTTGGGAGGCTGAGGGAGGCAGG + Intronic
994090299 5:95803858-95803880 TTGGGCAATGTGAGGGAGGCTGG + Intronic
995173877 5:109150506-109150528 CAGAGAAGTCTGAGGGAGAGAGG - Intronic
995853668 5:116572806-116572828 ATGTGCAGTCTGAGGGAAGCCGG - Intronic
997613273 5:135229939-135229961 CAGGGCAGGATGAGGGAGGAAGG - Intronic
998059488 5:139108529-139108551 CAGGGCTGTGGGAGGCAGGCTGG + Intronic
998927472 5:147142332-147142354 CCTGGCAGTCTTAAGGAGGCTGG - Intergenic
999200319 5:149811810-149811832 CAGGGCAGTGTCAGGGATCCTGG + Intronic
999264095 5:150255335-150255357 CAGGACAGTCAGAGAGGGGCAGG + Intronic
999503627 5:152172052-152172074 GAGGGCAGTGTCAGGGAGTCAGG + Intergenic
1000289870 5:159860342-159860364 CAGGGCAGTCTGGGGGTGCTAGG - Intergenic
1002473518 5:179451487-179451509 AAGGACAGTCTGGGAGAGGCAGG + Intergenic
1002518693 5:179777934-179777956 CAGGGCAGCCTGGGAGAGGCTGG + Intronic
1002547598 5:179960572-179960594 CAGGGCAGTGTGTGGGACCCAGG - Intronic
1002705625 5:181159681-181159703 AAGGGCAGCAGGAGGGAGGCTGG - Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003298638 6:4856514-4856536 CCAGGCAGCCTGAGGGTGGCAGG + Intronic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1003531566 6:6941402-6941424 CTTGGCAGGCTGAGGGAGGCTGG + Intergenic
1005321514 6:24659901-24659923 CATGGCAGTCTCAGGGTGGTTGG - Intronic
1006163306 6:32050198-32050220 CAGGACAGGCTGAGGGAGTCGGG + Intronic
1006163930 6:32053588-32053610 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006164557 6:32056786-32056808 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006165556 6:32062357-32062379 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006166507 6:32068590-32068612 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006520045 6:34565976-34565998 CAGGGCAGGCCCAGGCAGGCAGG - Intergenic
1006793482 6:36718137-36718159 CCGGGCAGTGGGAAGGAGGCAGG - Intronic
1007392612 6:41558740-41558762 CAGGGCTGAATGGGGGAGGCTGG + Intronic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007746107 6:44043854-44043876 CCTGGCAAGCTGAGGGAGGCAGG - Intergenic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1010078962 6:71835092-71835114 CAGGGCAGTCTCAGTGTGCCAGG + Intergenic
1011010391 6:82696799-82696821 CATGGGAGGCTGAGGCAGGCGGG - Intergenic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1011907280 6:92387450-92387472 CATGGCAGCCTGAGGCAGGAAGG + Intergenic
1014717960 6:124887750-124887772 CAGGGCAGTCAGAGGAGAGCTGG + Intergenic
1015137631 6:129891585-129891607 CTGGGCAGTGTGAGGGAGTCAGG - Intergenic
1015190231 6:130464239-130464261 CCGGGGAGAGTGAGGGAGGCAGG - Intergenic
1017276967 6:152581130-152581152 GAGGGCATTCTCAGGGAAGCAGG - Intronic
1018383848 6:163285159-163285181 GAGGGGTGTCTGGGGGAGGCTGG - Intronic
1019168841 6:170117325-170117347 CACGGCCCTCGGAGGGAGGCTGG - Intergenic
1019283280 7:211200-211222 GAGGGGAGGCTGAGGGAGGTTGG - Intronic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1019623487 7:2003725-2003747 CAGGGCAGTGTGAGGGCAGCAGG - Intronic
1019633612 7:2063852-2063874 GAGGGCAGAGCGAGGGAGGCTGG - Intronic
1019759231 7:2797056-2797078 CAGAGCAATCTGAGGGACTCAGG + Intronic
1019846598 7:3509045-3509067 CAGGGCAGCCTAAGGAAGGTGGG + Intronic
1019979936 7:4613954-4613976 CAGGCCTGTGTGCGGGAGGCGGG - Intergenic
1022242231 7:28523655-28523677 CAGAGCAGTTTCAGGGAGGATGG - Intronic
1022415674 7:30174781-30174803 GAGGACAGTCGGAGGGAGGGAGG + Intergenic
1022728942 7:33005084-33005106 CAGAGCAGTCTGGGGGTGACAGG - Intronic
1023121533 7:36914181-36914203 CAGGTCAGTATCAAGGAGGCAGG - Intronic
1023626373 7:42119024-42119046 CAGGGCTGTAGGAGGCAGGCAGG + Intronic
1023856305 7:44186174-44186196 CAGGGCAGCTGGAGGGAGGAAGG + Intronic
1025044704 7:55682894-55682916 CAGAGCAGTCTGGGGGTGACAGG + Intergenic
1025739461 7:64183670-64183692 CAGGGCCCTCCGAGGGAGTCAGG - Intronic
1025756736 7:64351488-64351510 CAGGGCAGTCTCAGGTACCCTGG - Exonic
1026035160 7:66825239-66825261 CAGGGCAGCTGGAGGGGGGCTGG + Intergenic
1026424490 7:70276619-70276641 CTTGGCAGGCTGAGGCAGGCAGG - Intronic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029155999 7:98518481-98518503 CAGGCCAGCCTGGTGGAGGCTGG - Intergenic
1029565786 7:101336804-101336826 CTCGGGAGGCTGAGGGAGGCAGG - Intergenic
1029705417 7:102273326-102273348 CATGGCCGTCAGAGGGAGCCTGG - Intronic
1029728801 7:102425915-102425937 CAGAACAGGCTGAGAGAGGCGGG + Exonic
1031642014 7:124176165-124176187 CATGGCAGCCTGAGGGTGGTGGG - Intergenic
1032057952 7:128698509-128698531 CTGGGCTGTCTGTGGGAGGGAGG + Intergenic
1032112358 7:129086885-129086907 CAGGTCAGAGTGAGGGTGGCTGG + Intergenic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032551404 7:132787489-132787511 CAGGGAAGTCAGTGGGAGCCTGG + Intronic
1032825202 7:135561940-135561962 CTGGGCAGAGTGAGGGAGGGAGG - Intronic
1033561837 7:142539258-142539280 CAGGGCAGTAAGGGGCAGGCAGG + Intergenic
1034275977 7:149824046-149824068 CAGGGTAGACTAAGGGAGGCAGG - Intergenic
1034898060 7:154890270-154890292 AAGAGCTCTCTGAGGGAGGCAGG - Intronic
1035239687 7:157521492-157521514 CAGGGCAGTGAGTGGGAGGAGGG + Intergenic
1035275427 7:157745409-157745431 GAGGACAGGCTGCGGGAGGCAGG + Intronic
1035275437 7:157745440-157745462 GAGGACAGGCTGTGGGAGGCAGG + Intronic
1035275446 7:157745471-157745493 CAGGGCAGGCTCAGGGAGGCAGG + Intronic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1035812677 8:2505602-2505624 CAGTGCATTCTCAGGGAAGCCGG - Intergenic
1036035833 8:5017992-5018014 CATGGGAGTCTGAGGCAGGTGGG - Intergenic
1036673865 8:10812817-10812839 CTGGGCGGTGTCAGGGAGGCTGG - Intronic
1036741200 8:11363190-11363212 CTGGGGAGTCTGAGGCAGGAGGG + Intergenic
1037521782 8:19686794-19686816 CAGGGCAGTCAGAGGATGGATGG - Intronic
1037881989 8:22578065-22578087 CAGGACGGTCTGTGGGAGGAGGG + Intergenic
1038680131 8:29659072-29659094 CTGGGCAGTCTGAGGGCAGCAGG + Intergenic
1039909312 8:41811581-41811603 GAGGGCAGTCTGAGCCAGGGAGG - Intronic
1039954145 8:42194687-42194709 CTGAGCAGTCTAAGGCAGGCTGG - Intronic
1040372208 8:46788185-46788207 CAGGGCAGTCTCAGGTATACTGG - Intergenic
1040380649 8:46868663-46868685 CAGGGCAGTCTCAGGTACCCTGG + Intergenic
1040659054 8:49547973-49547995 AAGGGCAGGCTGAGGGAGAGAGG + Intronic
1040816288 8:51511635-51511657 CAGGCCAGACTCAGGCAGGCAGG + Intronic
1040941043 8:52833995-52834017 CAGGGAAGACTGAGGGCTGCAGG - Intergenic
1041022075 8:53648209-53648231 CAGGGCAGTTAGGGGGTGGCAGG - Intergenic
1041215529 8:55596382-55596404 CAGGGCAGGAGGAAGGAGGCAGG - Intergenic
1041927859 8:63254623-63254645 CAGGAAAGGATGAGGGAGGCAGG + Intergenic
1042021937 8:64378020-64378042 AAGCGCAGTGTTAGGGAGGCGGG - Intergenic
1042427085 8:68661111-68661133 CAGGGCAGTCTCAGGGATCAAGG - Intronic
1045135514 8:99212513-99212535 AAGGGAAGTCTGAGGAAGACAGG + Intronic
1046353506 8:113047093-113047115 CTGAGTGGTCTGAGGGAGGCTGG + Intronic
1049063433 8:140294330-140294352 CCGGGCAGGCTGGGTGAGGCGGG - Intronic
1049438498 8:142598629-142598651 CAGGGCAGGCTGGGGGTGGGAGG - Intergenic
1049444670 8:142624487-142624509 CAGGGCATCCAGACGGAGGCTGG + Intergenic
1049579951 8:143406714-143406736 CAGGCCAGCCTGAGGCAGGCAGG - Intergenic
1049726971 8:144151449-144151471 CAGGGCAGTCGGAGGAGAGCTGG + Intronic
1049879760 8:145053558-145053580 CAGGGAAGCCTGAGGGAGCAGGG + Intronic
1052521574 9:29554431-29554453 CAGAGCAGCCTGAGGGCTGCTGG - Intergenic
1053316740 9:37058599-37058621 CAGAGCAGTCTGAGTGAAGTGGG - Intergenic
1053444709 9:38143116-38143138 GAAGGCAGGCTGAGGGAGGATGG - Intergenic
1054949121 9:70830083-70830105 CAAAGCAGTCTGTGAGAGGCAGG + Intronic
1056030807 9:82551491-82551513 CAGTGAAGTCTGAGTGAGGCTGG + Intergenic
1056168709 9:83962385-83962407 CAGGGCAGTTTTTGGGAGGAAGG + Intergenic
1056495776 9:87153886-87153908 CAGGACAGTGTCAGAGAGGCTGG - Intronic
1056762867 9:89427411-89427433 CCCGGCTGTCTCAGGGAGGCAGG - Intronic
1057432053 9:95004366-95004388 CACGGCAGTCTGAGGGCTGCGGG + Intronic
1059341919 9:113602158-113602180 CGGGGCAGAGGGAGGGAGGCTGG + Intergenic
1059406031 9:114098681-114098703 CGGGGCATTCTGGGGGGGGCGGG + Intronic
1059770238 9:117416955-117416977 AAGGAGAGACTGAGGGAGGCAGG - Intergenic
1060010683 9:120040705-120040727 CAGGGCATCCTGAGGGAGTTGGG - Intergenic
1060187359 9:121571869-121571891 CAGGACAGTCAGAGGCAGGAAGG + Intronic
1060991756 9:127853597-127853619 CAGGGAGGTAGGAGGGAGGCAGG + Intronic
1061342883 9:129997214-129997236 CTCGGGAGTCTGAGGGAGGCAGG + Intronic
1061547862 9:131315175-131315197 CAGGGTAGGCTGAGGGGGCCAGG + Intergenic
1061885194 9:133587758-133587780 TTGGGTGGTCTGAGGGAGGCGGG + Intergenic
1062079880 9:134618182-134618204 CAGGGCACTCTGGGAGAAGCGGG + Intergenic
1062128672 9:134880746-134880768 AATTGGAGTCTGAGGGAGGCTGG + Intergenic
1062262956 9:135671921-135671943 CACGGGAGTCTGAAGGAGGCTGG + Intergenic
1062466112 9:136682362-136682384 GAGGGGAGTTTGAGTGAGGCAGG - Intronic
1185822912 X:3221846-3221868 CAGGACACTCTGAGGCAGGGGGG + Intergenic
1186385342 X:9105187-9105209 CAGGACAGTCTGGGGGAGGGGGG - Intronic
1187822406 X:23302246-23302268 CAGGGCAGTCAGAGTTAGACAGG - Intergenic
1187880166 X:23839371-23839393 CAGGGGAGTCTGCTTGAGGCTGG + Intronic
1190308819 X:49102061-49102083 CCTGGAAGTCTGAGGGAGGAGGG + Intergenic
1190334283 X:49253034-49253056 GAGGGCACTCAGAGGGAGACAGG + Intronic
1190468031 X:50746766-50746788 CAGCACAGTCTGAGGGACTCAGG + Intronic
1190496646 X:51033412-51033434 CTGAGGAGTCTGAGGGAGGATGG - Intergenic
1190509326 X:51160525-51160547 CTGAGGAGTCTGAGGGAGGATGG + Intergenic
1190636035 X:52434718-52434740 AAGGCCAGTGTGTGGGAGGCAGG - Intergenic
1192261366 X:69507420-69507442 CAGCTGAGGCTGAGGGAGGCGGG - Intronic
1195704574 X:107729647-107729669 CTGGGCCGACAGAGGGAGGCAGG + Intronic
1195993155 X:110703215-110703237 CAGGGGATTCTGATGGATGCAGG + Intronic
1196735416 X:118977233-118977255 CAGGGCAATATGAATGAGGCAGG + Intronic
1197773515 X:130105753-130105775 CATGGCAGTCTCAGGCTGGCTGG - Intronic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199721127 X:150543418-150543440 AAGGCCAGTGTGAGGGAGGGAGG + Intergenic
1200019178 X:153187854-153187876 AAGGGGAGTCTGAGGCAGGGTGG - Intergenic
1200052095 X:153438974-153438996 AAGACCAGGCTGAGGGAGGCTGG - Intergenic
1200097741 X:153672092-153672114 CTGGGCAGGCTGTGGGAGCCGGG - Intronic
1200120841 X:153789831-153789853 CACGGCAGGGTCAGGGAGGCTGG + Intronic
1200136747 X:153878947-153878969 CTGGGCAGTCGGAGACAGGCAGG + Intronic
1201010227 Y:9544437-9544459 CAGGGCAGTGGGAGTGAGGATGG + Intergenic
1202110267 Y:21409892-21409914 CAGGGCAGTGTGAGTGACGATGG - Intergenic