ID: 915598097

View in Genome Browser
Species Human (GRCh38)
Location 1:156906637-156906659
Sequence AGTGTGCCCCAGGAATGTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 257}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915598080_915598097 14 Left 915598080 1:156906600-156906622 CCCCTGGTGACCCCCTTCCCGCC 0: 1
1: 0
2: 1
3: 27
4: 235
Right 915598097 1:156906637-156906659 AGTGTGCCCCAGGAATGTGGGGG 0: 1
1: 1
2: 0
3: 22
4: 257
915598087_915598097 -3 Left 915598087 1:156906617-156906639 CCCGCCTCCTTATCCCACAGAGT 0: 1
1: 0
2: 2
3: 19
4: 319
Right 915598097 1:156906637-156906659 AGTGTGCCCCAGGAATGTGGGGG 0: 1
1: 1
2: 0
3: 22
4: 257
915598081_915598097 13 Left 915598081 1:156906601-156906623 CCCTGGTGACCCCCTTCCCGCCT 0: 1
1: 0
2: 2
3: 27
4: 223
Right 915598097 1:156906637-156906659 AGTGTGCCCCAGGAATGTGGGGG 0: 1
1: 1
2: 0
3: 22
4: 257
915598088_915598097 -4 Left 915598088 1:156906618-156906640 CCGCCTCCTTATCCCACAGAGTG 0: 1
1: 0
2: 2
3: 17
4: 304
Right 915598097 1:156906637-156906659 AGTGTGCCCCAGGAATGTGGGGG 0: 1
1: 1
2: 0
3: 22
4: 257
915598090_915598097 -10 Left 915598090 1:156906624-156906646 CCTTATCCCACAGAGTGTGCCCC 0: 1
1: 0
2: 2
3: 24
4: 181
Right 915598097 1:156906637-156906659 AGTGTGCCCCAGGAATGTGGGGG 0: 1
1: 1
2: 0
3: 22
4: 257
915598089_915598097 -7 Left 915598089 1:156906621-156906643 CCTCCTTATCCCACAGAGTGTGC 0: 1
1: 0
2: 1
3: 14
4: 131
Right 915598097 1:156906637-156906659 AGTGTGCCCCAGGAATGTGGGGG 0: 1
1: 1
2: 0
3: 22
4: 257
915598086_915598097 1 Left 915598086 1:156906613-156906635 CCTTCCCGCCTCCTTATCCCACA 0: 1
1: 0
2: 1
3: 41
4: 501
Right 915598097 1:156906637-156906659 AGTGTGCCCCAGGAATGTGGGGG 0: 1
1: 1
2: 0
3: 22
4: 257
915598085_915598097 2 Left 915598085 1:156906612-156906634 CCCTTCCCGCCTCCTTATCCCAC 0: 1
1: 0
2: 0
3: 36
4: 923
Right 915598097 1:156906637-156906659 AGTGTGCCCCAGGAATGTGGGGG 0: 1
1: 1
2: 0
3: 22
4: 257
915598084_915598097 3 Left 915598084 1:156906611-156906633 CCCCTTCCCGCCTCCTTATCCCA 0: 1
1: 0
2: 1
3: 35
4: 528
Right 915598097 1:156906637-156906659 AGTGTGCCCCAGGAATGTGGGGG 0: 1
1: 1
2: 0
3: 22
4: 257
915598083_915598097 4 Left 915598083 1:156906610-156906632 CCCCCTTCCCGCCTCCTTATCCC 0: 1
1: 0
2: 5
3: 69
4: 871
Right 915598097 1:156906637-156906659 AGTGTGCCCCAGGAATGTGGGGG 0: 1
1: 1
2: 0
3: 22
4: 257
915598082_915598097 12 Left 915598082 1:156906602-156906624 CCTGGTGACCCCCTTCCCGCCTC 0: 1
1: 0
2: 1
3: 24
4: 331
Right 915598097 1:156906637-156906659 AGTGTGCCCCAGGAATGTGGGGG 0: 1
1: 1
2: 0
3: 22
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915598097 Original CRISPR AGTGTGCCCCAGGAATGTGG GGG Exonic
900234882 1:1583668-1583690 AGTGTGCCCCACGGATGTCCTGG - Intergenic
901795177 1:11675703-11675725 CGTGTGCACCAGGACTGTGAAGG + Exonic
902225927 1:14996466-14996488 TGGGTGCCCCAGGAATGTAGGGG + Intronic
903545043 1:24118705-24118727 ACTGTGTCCCAGGAAAGGGGAGG + Intergenic
904371224 1:30048615-30048637 AGTGTACCCCTGGATTGAGGGGG + Intergenic
904416365 1:30363292-30363314 AGTGAGCCCCATGAGGGTGGGGG - Intergenic
905516225 1:38564042-38564064 AGTGTCCTCCAGGAGTGTGCAGG + Intergenic
907427916 1:54392742-54392764 AATAGGCCCCAGGAATGGGGTGG + Intronic
908327263 1:63035460-63035482 TGTGTGGTGCAGGAATGTGGTGG + Intergenic
910366660 1:86472453-86472475 ACTGAGCCCAGGGAATGTGGGGG - Intronic
912651293 1:111441847-111441869 AATGTGCCCCAGGAATGGACAGG + Intronic
913073586 1:115322433-115322455 AGTGGGCCCCAGAAATCTGTGGG + Intronic
915598097 1:156906637-156906659 AGTGTGCCCCAGGAATGTGGGGG + Exonic
922615255 1:226957290-226957312 AGTGTGAACCAGGGAGGTGGGGG - Intronic
924780219 1:247140943-247140965 AGAGTGCCCCAGAGCTGTGGTGG - Intronic
1063146029 10:3296036-3296058 AGTTTCCTCCAGGAATGTGGAGG - Intergenic
1065554186 10:26897893-26897915 AGTTTGGCTCAGGAATTTGGGGG - Intergenic
1065599139 10:27350715-27350737 AGTTTGGCTCAGGAATTTGGGGG + Intergenic
1067085237 10:43234652-43234674 GGTGTGGCCCAGTAATGAGGTGG - Intronic
1067165176 10:43860465-43860487 AGTGTGAACCAGCAGTGTGGCGG + Intergenic
1067216778 10:44310334-44310356 AGTGTGCCCAAGCAATGTCCCGG + Intergenic
1067229064 10:44394401-44394423 AGTGCCCCCCAGGAAGGTGCTGG - Intergenic
1067478998 10:46583544-46583566 CGTGTACCCCTGGAAAGTGGGGG - Intronic
1067615740 10:47758257-47758279 CGTGTACCCCTGGAAAGTGGGGG + Intergenic
1069793277 10:71036891-71036913 AGTGTGGCTCAGGAAGCTGGGGG + Intergenic
1070555629 10:77525617-77525639 ACTGAGCTCCAGGAATGAGGAGG - Intronic
1070574263 10:77665598-77665620 ACTTAGCCCCTGGAATGTGGAGG - Intergenic
1070762592 10:79034034-79034056 CGTATGCCCCAGGGATGAGGTGG + Intergenic
1071640622 10:87303559-87303581 AGTGTGGACCAGGATTATGGCGG + Intergenic
1071654614 10:87434386-87434408 AGTGTGGACCAGGATTATGGCGG - Intergenic
1072283940 10:93894865-93894887 AGTGAGGCCCAGGAAGGTGAGGG + Intronic
1072666407 10:97396130-97396152 TGAGTGCCCCTGGCATGTGGGGG - Intronic
1074099879 10:110346486-110346508 AGTGTGGCCCAGTGAGGTGGTGG - Intergenic
1074535594 10:114326284-114326306 AGTTGCCCCCAGGAATGGGGAGG - Intronic
1075002440 10:118808610-118808632 AGAGTGGCCCAGGACTGAGGGGG - Intergenic
1075683629 10:124349362-124349384 AGTGTGCCCCTGAGAAGTGGGGG + Intergenic
1075954145 10:126507816-126507838 AGGGTGCCGCAGAAATGTTGGGG - Intronic
1076387385 10:130067114-130067136 CGTGTGCCCCAAGGGTGTGGAGG - Intergenic
1076388419 10:130076315-130076337 GGTGGGACACAGGAATGTGGGGG - Intergenic
1078623191 11:12927887-12927909 AGGGTACCCCAGGAATCTGGGGG - Intronic
1081187906 11:40067334-40067356 AGTGTGACTTAGAAATGTGGAGG - Intergenic
1082655935 11:55857150-55857172 ATTGTGCACCAAGAATGTTGCGG - Intergenic
1082693623 11:56332873-56332895 ATTGGGCACCAGGAATGTTGGGG + Intergenic
1083596174 11:63919157-63919179 AGTGTGTCCTAGGAGTTTGGGGG + Intergenic
1083855841 11:65392681-65392703 ACTGTGCCCCAGGGATACGGCGG + Intronic
1084492612 11:69486914-69486936 AGGGGACCTCAGGAATGTGGTGG - Intergenic
1084707706 11:70824967-70824989 GGGGTGCCCCAGGAAGCTGGGGG - Intronic
1085032215 11:73279704-73279726 AGTTTGCCCCAGGAATTTTGTGG - Intronic
1085186885 11:74583251-74583273 AGTGTGCCACAAGAACCTGGAGG - Intronic
1085470130 11:76752514-76752536 TGTGTGCCCCAGGACAGTCGGGG - Intergenic
1085514867 11:77106143-77106165 TGTGTGACCCAGGAGAGTGGTGG - Intronic
1086165646 11:83774843-83774865 AGTCTTCACCAGGAATGTAGGGG - Intronic
1088781080 11:113134942-113134964 AGTGTGCCCCAGTGATGAGTGGG - Intronic
1088824885 11:113484924-113484946 AGTGTGCCCAAGGGCTCTGGGGG - Intergenic
1088852811 11:113719216-113719238 AATATGCCACAGAAATGTGGAGG + Intergenic
1089819602 11:121212828-121212850 GGTCTGCATCAGGAATGTGGTGG - Intergenic
1091000428 11:131906414-131906436 ATTGAGCCCCAGGAAGGAGGAGG - Intronic
1091058227 11:132438709-132438731 GGTGTGCAGCAGGAAGGTGGAGG + Intronic
1091609824 12:1996474-1996496 ATTGGGCCTCAGGAATATGGTGG - Intronic
1093481814 12:19612139-19612161 AGTGTGTGCCAGCAAAGTGGTGG + Intronic
1093496525 12:19763774-19763796 AGTGTGCACCAGTAAGGTGGTGG - Intergenic
1096771108 12:53936626-53936648 AGGGAGCCCCAAGAATGGGGTGG + Intergenic
1097146915 12:56948074-56948096 AGTGAGACCCAGCACTGTGGTGG - Intergenic
1102458789 12:113087476-113087498 TGTGTTCCCCAGGACTGTGGGGG + Intronic
1103015636 12:117492502-117492524 AGTGTGCCCCAAGGTCGTGGGGG - Intronic
1103936506 12:124480259-124480281 AGGGTGCCCCAGGGCTGTGCAGG + Intronic
1104432985 12:128732033-128732055 AGTGTGCTCATGAAATGTGGTGG + Intergenic
1104638082 12:130450324-130450346 CGTGTGCCGCGGGAATGGGGTGG - Intronic
1105344274 13:19559755-19559777 AGCGTGCCCCAAGAGTGTAGGGG - Intergenic
1105418424 13:20232428-20232450 AGTGCGCCCCGGGTAGGTGGGGG - Intergenic
1105535760 13:21261819-21261841 AGCGTGCCCCAAGAGTGTAGGGG + Intergenic
1106804780 13:33295050-33295072 AGTATGGCCCACGACTGTGGAGG + Intronic
1107873062 13:44764635-44764657 AGTGGGCCCCAGGGATGCGCTGG - Intergenic
1107883012 13:44850022-44850044 ACTGAGCCCCAGGGATGTGGAGG + Intergenic
1108389366 13:49933209-49933231 ACTGTGGCCAAGAAATGTGGAGG - Intronic
1111092914 13:83470919-83470941 AGTGTGTCCCATGAATGAAGAGG - Intergenic
1111338138 13:86848070-86848092 AGATTGCCCCAGGGCTGTGGTGG + Intergenic
1112313647 13:98342145-98342167 AGAGTGCTACAGGAATGTAGAGG + Intronic
1113798961 13:113076783-113076805 AGCCTTCCCCAGGCATGTGGAGG - Intronic
1114803469 14:25806185-25806207 TGTGTGCTCCAGGCATCTGGGGG + Intergenic
1117180673 14:53188132-53188154 AGGCTGCCCCAGGAATCAGGAGG + Intergenic
1117351219 14:54883795-54883817 AGTGTTCCACAGGAATGACGTGG - Intronic
1119196203 14:72718361-72718383 AGTGTGGCCCAGGAATCCTGGGG + Intronic
1120969370 14:90194393-90194415 AGTGAGCCCCCTGAAGGTGGGGG - Intergenic
1122737239 14:103849731-103849753 TGTGTGCTCCAGGAAGATGGAGG - Intergenic
1122854499 14:104553630-104553652 AGTGTGCCCAGGGTCTGTGGCGG - Intronic
1126266596 15:46762383-46762405 AGTTTGGTCCAGGAATGTGATGG - Intergenic
1127074690 15:55313887-55313909 AGTGTGAACCCGGAAGGTGGAGG + Intronic
1128542179 15:68543808-68543830 AGTGTGCGTCAGGAGGGTGGAGG - Intergenic
1129224692 15:74162140-74162162 AAAGTGCCCCAGGGAGGTGGGGG + Intergenic
1129869352 15:78930797-78930819 GATGTGCCCCAGGGAGGTGGAGG + Intronic
1131120579 15:89820954-89820976 CATGTGCCCCAGGACTGTGGGGG - Intergenic
1132623483 16:879228-879250 AGTGGATCCCAGGAATGTGGGGG + Intronic
1132628878 16:906667-906689 AGTGTGACACAGGTGTGTGGAGG - Intronic
1132748667 16:1447381-1447403 ACGGTGCCCCAGGCATGTGCAGG - Exonic
1133281256 16:4666699-4666721 AGAGTGCCGCAGGCAGGTGGCGG - Intronic
1133637004 16:7676735-7676757 AATGTGACTCAGGAATGTAGCGG - Intronic
1135854147 16:25991624-25991646 AGTGGGCACTAGGAATGTGCTGG + Intronic
1137500795 16:49010501-49010523 AGTGTGACCTGGGAATGAGGAGG - Intergenic
1139344935 16:66296788-66296810 GGGGTCACCCAGGAATGTGGTGG - Intergenic
1139961782 16:70722121-70722143 AGTGAGTCCCAGGAGAGTGGGGG - Intronic
1142102643 16:88283798-88283820 AGTGTGCCCGAGGTCTGTGAAGG + Intergenic
1142102673 16:88283915-88283937 AGTGTGCCCGAGGTCTGCGGAGG + Intergenic
1142102683 16:88283951-88283973 AGTGTGCCCAAGGTCTGTGGAGG + Intergenic
1142102692 16:88283987-88284009 AGTGTGCCCGAGGTCTGTGGAGG + Intergenic
1142102713 16:88284068-88284090 AGTGTGCCCGAGGTCTGCGGAGG + Intergenic
1142102722 16:88284104-88284126 AGTGTGCCTGAGGTCTGTGGAGG + Intergenic
1142102731 16:88284140-88284162 AGTGTGCCCGAGGTCTGCGGAGG + Intergenic
1142390847 16:89798779-89798801 AGTGTGTTCTAGAAATGTGGGGG + Intronic
1203077378 16_KI270728v1_random:1129126-1129148 GGTGTGTCCCAGGAATGGTGAGG + Intergenic
1142496060 17:306914-306936 AGTGTGCCCAGGAAGTGTGGGGG - Intronic
1143400308 17:6638880-6638902 GGGGTGCCCCAGGCCTGTGGGGG - Intronic
1145811588 17:27767501-27767523 AGGGAGCCCCAGGAGGGTGGTGG - Intronic
1146453168 17:32990786-32990808 TGTGTGCCCAAGGATTGTGAGGG - Intronic
1146453238 17:32991108-32991130 TGGGTGCCCCAGGATGGTGGTGG - Intronic
1146841869 17:36161927-36161949 AGGGAGCCCCAGGAGGGTGGTGG + Intergenic
1146854179 17:36249887-36249909 AGGGAGCCCCAGGAGGGTGGTGG + Intronic
1146870083 17:36373779-36373801 AGGGAGCCCCAGGAGGGTGGTGG + Intronic
1146877440 17:36424860-36424882 AGGGAGCCCCAGGAGGGTGGTGG + Intronic
1147072964 17:37974403-37974425 AGGGAGCCCCAGGAGGGTGGTGG + Intergenic
1147084486 17:38053941-38053963 AGGGAGCCCCAGGAGGGTGGTGG + Intronic
1147100433 17:38177907-38177929 AGGGAGCCCCAGGAGGGTGGTGG + Intergenic
1147136024 17:38434583-38434605 TGTGGGCCGGAGGAATGTGGTGG + Intronic
1147147094 17:38491620-38491642 AGTGTGCCCCAGGAAGGGCTCGG + Intronic
1147906349 17:43825587-43825609 AGTGTGCCCGGGGTATGGGGTGG - Intronic
1148276207 17:46305854-46305876 AGTGTGCTCCTGGCATCTGGTGG + Intronic
1148298324 17:46523429-46523451 AGTGTGCTCCTGGCATCTGGTGG + Intronic
1148351639 17:46945727-46945749 CTTGTGCCCCAGGCATGTGCAGG + Intronic
1148362865 17:47027902-47027924 AGTGTGCTCCTGGCATCTGGTGG + Intronic
1150083374 17:62260953-62260975 AGGGAGCCCCAGGAGGGTGGTGG + Intergenic
1150404267 17:64886519-64886541 AGTGTGCTCCTGGCATCTGGTGG - Intronic
1150655120 17:67034161-67034183 ACTTTGCCCCAGGAGGGTGGAGG - Intergenic
1151766310 17:76135164-76135186 TGTGTGCCCCAGGCCTGTGCTGG - Intergenic
1151887467 17:76931724-76931746 AGAGAGCCACAGGAATGAGGAGG + Intronic
1153953625 18:10077147-10077169 AGTGTGGCCTAGGAGTGTTGGGG + Intergenic
1154008831 18:10558768-10558790 AGCGTGGCCCAGGCATCTGGAGG + Intergenic
1155680840 18:28483644-28483666 AGTGGGCTCCAGAAAGGTGGAGG - Intergenic
1156213928 18:34977334-34977356 TGTGCACCCCAGGAAAGTGGAGG + Intronic
1159682542 18:71372667-71372689 AGTGTGTCCAAGGAATGGGAAGG - Intergenic
1161575600 19:5052715-5052737 AGTGGGACCCAGGAGTCTGGTGG + Intronic
1162079196 19:8208823-8208845 AGGGCGCCCCGGGAGTGTGGGGG + Intronic
1162566681 19:11448629-11448651 AGTGCGTCCCAGGAATGCAGGGG + Exonic
1164455645 19:28404378-28404400 TGTGTGGCCCAGGATAGTGGGGG + Intergenic
1165428542 19:35758609-35758631 CGTGTCCCCCAGGAATGTATGGG + Intronic
1166322071 19:42024716-42024738 CGAGTGGCCCAGGAATGCGGTGG - Intronic
1166641407 19:44498024-44498046 AGTGGACCCCAGAAGTGTGGAGG - Intronic
1166704558 19:44901421-44901443 AGTGTTCCCTGGTAATGTGGAGG - Intronic
1167002451 19:46753984-46754006 GGTGTGGCCAATGAATGTGGAGG + Intronic
1167710374 19:51106877-51106899 AAGGTGCCCCAGCCATGTGGAGG - Intronic
1168355057 19:55695462-55695484 AGTGGGCCCCAGGAAGGGGAAGG - Intronic
929437368 2:41938959-41938981 AGGGTGCCCCAGGTGTGGGGAGG - Intronic
932622208 2:73271388-73271410 AGTGAGCCCCAGGACTGTTCTGG + Intronic
933983758 2:87574163-87574185 GCTGTGCCCCAGGCATGTAGTGG + Intergenic
934927526 2:98391974-98391996 AGTGTGCCCCAGGCCTGGGGAGG + Intronic
935559619 2:104546694-104546716 TCTGGGACCCAGGAATGTGGGGG + Intergenic
935627030 2:105180081-105180103 AGTGTGCTTTAGGAGTGTGGGGG + Intergenic
936310093 2:111376631-111376653 GCTGTGCCCCAGGCATGTAGTGG - Intergenic
940312737 2:152295283-152295305 AGTGGGGGCCAGGCATGTGGTGG - Intergenic
940385324 2:153064698-153064720 ACTGTGCCTCAGGCATGTGAGGG + Intergenic
940685399 2:156843638-156843660 TGTGTCCCCCATGAATATGGGGG + Intergenic
941054968 2:160777049-160777071 AGTGGGCACCAGTAAAGTGGTGG - Intergenic
943345461 2:186733403-186733425 AGTCTCCCCCAAGAATTTGGAGG + Intronic
944551476 2:200848560-200848582 GGTTTGACCCAGGAAGGTGGTGG + Intergenic
945158277 2:206862032-206862054 AGTGTGCCACAGCAACATGGTGG + Intergenic
948532086 2:238615458-238615480 AGGGTCCCCCAGGCCTGTGGAGG - Intergenic
948686736 2:239674940-239674962 GGTGTCCTCCAGGAGTGTGGTGG + Intergenic
1169953157 20:11070762-11070784 AGTGAGGCCAAGGAATGAGGTGG - Intergenic
1172976036 20:38906770-38906792 GGTGTGGCCCAGGCATGTGGAGG + Intronic
1173858022 20:46263547-46263569 AGTGTCCCCTATAAATGTGGGGG - Intronic
1173999286 20:47362601-47362623 AGTGAGCCACAGGAGGGTGGAGG - Intergenic
1175165070 20:57037795-57037817 AGTGAGCCCCAGGGCTGTGGAGG + Intergenic
1175366339 20:58458844-58458866 AGTGTGGCCGGGGCATGTGGAGG + Intergenic
1175566840 20:59986521-59986543 AGTGTGTCCCAGGAAAGAAGAGG - Intronic
1175898554 20:62351004-62351026 GGTGAGGCCCAGGAATGTGCCGG + Intronic
1176072808 20:63235725-63235747 TGTCTGCCCCAGGGCTGTGGGGG - Intergenic
1176076155 20:63249096-63249118 TGGGTGCCCCGGGAATGAGGCGG + Intronic
1176369474 21:6053709-6053731 GGTGTCCGCCAGGAATGAGGTGG - Intergenic
1177656209 21:24020402-24020424 AGTGTGGAAGAGGAATGTGGGGG + Intergenic
1179754045 21:43484832-43484854 GGTGTCCGCCAGGAATGAGGTGG + Intergenic
1181904867 22:26186385-26186407 AGTGGTCCCCATCAATGTGGTGG - Intronic
1182582700 22:31324431-31324453 AGGGTGACCCTAGAATGTGGAGG - Intergenic
1183058797 22:35322880-35322902 AGTGAGACCCTTGAATGTGGAGG - Intronic
1183251393 22:36732847-36732869 AGTGTTTCCCAGGACTGAGGAGG - Intergenic
1183352607 22:37342557-37342579 AGTGGGACCCAGGAGTGGGGGGG - Intergenic
1183702634 22:39458418-39458440 GGTGTGTCCCAGGAATGAAGTGG - Intronic
1183781097 22:39999439-39999461 GGTGTGAGCCAGGAATGCGGGGG - Intronic
1184503389 22:44887265-44887287 AGTGTGGCCCCTGAGTGTGGTGG - Intronic
1184696632 22:46143059-46143081 GGTCTGCCCCAGGCATGAGGAGG + Intergenic
1185144846 22:49126848-49126870 AGTTTACCCCAGGAATGAGAGGG - Intergenic
949305821 3:2639479-2639501 AGGGAGCTCCATGAATGTGGAGG - Intronic
950354322 3:12392055-12392077 AGTGTGCCCCATCATTGTTGTGG - Intronic
950452754 3:13074351-13074373 AGTGTGCGACAGGGAGGTGGAGG + Intergenic
950583398 3:13877768-13877790 TGAGTGCCCCATAAATGTGGTGG + Intronic
951043176 3:18010786-18010808 AGTTTGCCCCAGCAAAGGGGTGG - Intronic
954568048 3:51615709-51615731 AGTGAGCCCCAGCAGTGGGGAGG + Intronic
954819755 3:53315497-53315519 TCTGTCACCCAGGAATGTGGTGG - Intronic
959397190 3:105855241-105855263 GGTGGGCCCCAGGGATGGGGAGG + Intronic
960773716 3:121225293-121225315 ATTGTGCCCCAGGACTCTCGGGG + Intronic
961009702 3:123427413-123427435 AGAGTGGCCAAGGAATATGGTGG - Intronic
961669317 3:128517650-128517672 AGTGTGGCCCAGGTGGGTGGAGG - Intergenic
961724876 3:128921188-128921210 ATTGGGCGCCAGGAATGTTGGGG - Intronic
962251202 3:133837073-133837095 AGGGTGCCCGAGGTATGGGGAGG - Intronic
962508963 3:136079346-136079368 AATGTGCTTCAGGAAAGTGGGGG - Intronic
962681273 3:137802600-137802622 AGTGCGACCCAGGAACGTGGTGG + Intergenic
965839476 3:172887273-172887295 AGTGGGATCCAGGAATGTGGAGG + Intergenic
966207524 3:177420264-177420286 AATATGCCCCAGGAAGGTGGGGG - Intergenic
966862098 3:184236266-184236288 AGTGTGGTCCAGGGATCTGGGGG + Intronic
967822389 3:193850124-193850146 ACTGTGGCCCACGCATGTGGGGG - Intergenic
968641666 4:1717895-1717917 AGTGCTCCCCAAGAATCTGGGGG + Intronic
968871482 4:3244916-3244938 AGTCTGCCGGAGGGATGTGGTGG + Intronic
970807804 4:20056392-20056414 GGTGTCACCCAGGAAGGTGGGGG + Intergenic
970864910 4:20747227-20747249 AATGTGCCCTAGGAAATTGGTGG + Intronic
979726800 4:123972143-123972165 ATTGTTCCCCAGCAATGAGGAGG + Intergenic
981567511 4:146116136-146116158 CTTGTGCCCCAGGAAACTGGAGG - Intergenic
982127550 4:152197484-152197506 AGTGTGCCCTGGTGATGTGGGGG - Intergenic
985811628 5:2094420-2094442 GGTGTGCCCCACGCATGTGTAGG + Intergenic
986725736 5:10595090-10595112 AGTGTGCCCTGTGACTGTGGAGG + Intronic
987245173 5:16041539-16041561 AGTAGGCCCCAGGGCTGTGGGGG - Intergenic
988481787 5:31638003-31638025 AGTGGGCCCAAGGCATTTGGAGG - Intergenic
990347652 5:54885306-54885328 ACTGTGGCCCATGAATGTGGAGG - Intergenic
995484366 5:112624957-112624979 TATGTGCCCCGGGGATGTGGTGG - Intergenic
996324694 5:122259166-122259188 AGTGTGTCCCAAGAGTGAGGGGG + Intergenic
996557286 5:124791924-124791946 TGTGGAACCCAGGAATGTGGAGG - Intergenic
998686487 5:144533160-144533182 AGTGGGGACCAGGAATGAGGAGG - Intergenic
998735014 5:145127615-145127637 AAAGTGCCCCAGCAATATGGAGG + Intergenic
999313469 5:150568880-150568902 AGTCTCCCCCAGGTAGGTGGGGG + Intergenic
999481659 5:151954021-151954043 ACTGTGCCTCAGGAGGGTGGAGG + Intergenic
1001491868 5:172161780-172161802 AGAGTACCCTAGGAATGAGGCGG + Intronic
1001900052 5:175419697-175419719 GGTATGCCCCTGGCATGTGGTGG - Intergenic
1006966763 6:37994861-37994883 AGTGTACACCAGAAATTTGGGGG - Intronic
1006992972 6:38231344-38231366 ATTCTGCACCAGCAATGTGGAGG - Intronic
1007138802 6:39550387-39550409 GGTGTGCCCCAGGAGTGGGAGGG + Intronic
1007476173 6:42121536-42121558 TGTGTGTCCCAGGCATGAGGAGG - Intronic
1007704878 6:43784450-43784472 AGGGGCCCCCAGGAATGGGGAGG + Intronic
1010579397 6:77575400-77575422 AGTGTGCCCGAGGTGGGTGGGGG - Intergenic
1013168181 6:107612559-107612581 AGTGGGGCCCAGGAATCTGTGGG + Intronic
1013169787 6:107626508-107626530 AATCTGCCCCAGGAAACTGGAGG - Intronic
1018476937 6:164151630-164151652 AGGGTGCCCGGGGACTGTGGAGG - Intergenic
1019278553 7:188663-188685 TGGGTCCCCCAGGAATGGGGGGG - Intergenic
1020129078 7:5549325-5549347 AGTGTGTCCCAGGAGGGTGTGGG + Intronic
1022389981 7:29935082-29935104 AGTGTGTACAAGGAAAGTGGTGG - Intronic
1023658086 7:42446809-42446831 TGTGTGCACCAGCAAAGTGGTGG + Intergenic
1023827894 7:44021722-44021744 AGGGTGACCCAGAAGTGTGGAGG + Intergenic
1027539862 7:79453478-79453500 AGTGTGGACGAGGAATGGGGAGG + Exonic
1028056581 7:86252653-86252675 GGTGTGCCCCAGCACTGTGCTGG + Intergenic
1028726120 7:94089891-94089913 AGAGTGCACCAGGAAAATGGAGG + Intergenic
1029756198 7:102575145-102575167 AGGGTGACCCAGAAGTGTGGAGG + Intronic
1029774138 7:102674217-102674239 AGGGTGACCCAGAAGTGTGGAGG + Intergenic
1032965608 7:137093691-137093713 AGTGGGCACCAGCAAAGTGGTGG - Intergenic
1033610521 7:142960020-142960042 AGTGCGTCCCAGGAAGTTGGTGG - Intronic
1034257962 7:149734712-149734734 AGTGTGCCCCAGGAGTCCTGTGG - Intergenic
1034397187 7:150836088-150836110 TGTGAGACCCAGGAATGTTGTGG + Intronic
1037735883 8:21565634-21565656 AGTGTGCACAGGGAAAGTGGAGG - Intergenic
1038713473 8:29971004-29971026 ATTGTGTCTCAGGAATATGGAGG - Intergenic
1039672099 8:39612885-39612907 AGTGTGCACCAACAAAGTGGTGG - Intronic
1041617764 8:59928179-59928201 AGAGTCCCCCAGTAATGTGACGG - Intergenic
1042121159 8:65489960-65489982 TGTGTGCGCCAGGAATGAGGTGG - Intergenic
1042416748 8:68528650-68528672 AGTGTGCCCCTGGAGTTTGGTGG - Intronic
1043497719 8:80821326-80821348 TGTCTGCCCCAGGAAGTTGGTGG - Intronic
1043960862 8:86416970-86416992 AGTGAGTCCCCAGAATGTGGTGG - Intronic
1044908413 8:97029959-97029981 CCTCTGTCCCAGGAATGTGGAGG + Intronic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1050366234 9:4876311-4876333 AGTGGGGCACAGGAGTGTGGAGG + Intronic
1052254710 9:26441439-26441461 AGTAGGGGCCAGGAATGTGGGGG + Intergenic
1053110783 9:35457939-35457961 ATTGTGGCCCAGGACTCTGGAGG + Intergenic
1053148404 9:35727572-35727594 AAAGTGCCCCAGGAGTGGGGAGG - Intronic
1056150803 9:83786178-83786200 AGTGTGCCCCTTGAGTGTAGTGG - Intronic
1058342869 9:103920153-103920175 ATTGTTCACCAGGAAAGTGGGGG - Intergenic
1059346518 9:113632622-113632644 ACTGGGCCCCTGGAAGGTGGGGG + Intergenic
1059991113 9:119867593-119867615 AGTGTGCAGGAGGAGTGTGGGGG + Intergenic
1062550686 9:137085007-137085029 AGTGGGTCACAGGCATGTGGTGG + Intergenic
1186733995 X:12441514-12441536 AGTCTCCCACAGGAATGAGGGGG - Intronic
1186792237 X:13010610-13010632 ACAGTGCCCCAAGATTGTGGAGG + Intergenic
1188430068 X:30096632-30096654 AAAGTGCTCCAGAAATGTGGAGG + Intergenic
1192171852 X:68860662-68860684 AGGGTGCCCCAGGAATGTGGAGG + Intergenic
1194520979 X:94918497-94918519 AGAGTTACACAGGAATGTGGTGG - Intergenic
1195668977 X:107453265-107453287 AATTTGCCCCAGGTATGTGTTGG - Intergenic
1196010134 X:110878079-110878101 ATTCTGCTCCAGGAATGTAGGGG - Intergenic
1199510274 X:148613847-148613869 AGAGTGCAGCAGGAATGTGGTGG - Intronic
1200234552 X:154461972-154461994 AGGGTGCTCCAGGAAATTGGTGG - Intronic
1201947388 Y:19526658-19526680 AGTGGGCTCCAGGGATGTGGAGG - Intergenic