ID: 915598345

View in Genome Browser
Species Human (GRCh38)
Location 1:156907829-156907851
Sequence CTGTGGTTATGGGGGTGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915598339_915598345 2 Left 915598339 1:156907804-156907826 CCAAGGTGAGTGAGGGGGGTGAG 0: 1
1: 0
2: 3
3: 34
4: 307
Right 915598345 1:156907829-156907851 CTGTGGTTATGGGGGTGTCAAGG 0: 1
1: 0
2: 3
3: 18
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915598345 Original CRISPR CTGTGGTTATGGGGGTGTCA AGG Intronic
900436913 1:2635225-2635247 CTCTGGCTATGCGGGTGTCTGGG - Intergenic
901003926 1:6162599-6162621 ATGTGGTCGTGGTGGTGTCAGGG - Intronic
901878697 1:12181507-12181529 CGGGGGATTTGGGGGTGTCATGG - Intronic
903246924 1:22022983-22023005 CTGGGGTCATGGTGGTGACAGGG + Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904265697 1:29317513-29317535 CTGAGGTTATGTGGGTGGCAAGG + Intronic
904330934 1:29757452-29757474 CAGAGGTGATGGGCGTGTCATGG + Intergenic
904783964 1:32971763-32971785 CTGTGGTATTGGAGGTGCCAAGG - Intergenic
905037200 1:34925911-34925933 CTGGGTTTGTGGGGGTGTCCAGG - Intronic
906509272 1:46401561-46401583 CTGTGGGTGTGGGGATGGCATGG + Intronic
906776160 1:48531494-48531516 CTGTGGTGATGGGGAGTTCATGG + Intergenic
907291641 1:53417342-53417364 CTGTGATTCAGAGGGTGTCAAGG + Intergenic
908002901 1:59698443-59698465 CTTTGGTAATGGGGGTGTGGGGG - Intronic
911116571 1:94251782-94251804 CTGTTTTTATGGAGGAGTCAAGG - Intronic
911423160 1:97671760-97671782 CTGTGTTTGTGTGGGTGACAGGG + Intronic
912197039 1:107410162-107410184 CTGTGATAATCGGGGTCTCAGGG - Intronic
915598345 1:156907829-156907851 CTGTGGTTATGGGGGTGTCAAGG + Intronic
916040299 1:160955616-160955638 GTCTGGTGATGGGGGTGTCAGGG - Intergenic
918221689 1:182441378-182441400 CTATGGTTGGGTGGGTGTCATGG - Intergenic
920342226 1:205282684-205282706 GTGTGATGATGGGTGTGTCATGG - Intergenic
920691065 1:208146623-208146645 CAGTGGTGAGGGGAGTGTCAAGG + Intronic
923125092 1:231027766-231027788 CAGTGGGGATGAGGGTGTCATGG - Intronic
923376226 1:233366169-233366191 TTGTGGTTATTGGGGTGGGAAGG + Intronic
923924391 1:238608295-238608317 CTGTGGTTGGGGGTGTGTCTGGG + Intergenic
924659145 1:246000607-246000629 CTGTGTGTATGGTGGTGTCCAGG - Intronic
1062823004 10:548601-548623 CAAGGGTTATGGGGGTGACATGG + Intronic
1063450725 10:6148282-6148304 CTGTGGTTAGGTTGGTGCCATGG + Intronic
1068037933 10:51784142-51784164 CTGTGGAGATGGGGAAGTCAGGG - Intronic
1068653783 10:59553715-59553737 CTGTGTATATGTGTGTGTCAGGG - Intergenic
1069751173 10:70745879-70745901 CTGGGGTCATGGAGGTGGCAGGG + Intronic
1072664633 10:97384506-97384528 CTGAGGTTATGGAGTTCTCAGGG - Intronic
1073453094 10:103621073-103621095 CTGTGGATATGTGGGTGTCAGGG + Intronic
1074466927 10:113691740-113691762 CTGTTCTGATGGGGGTGGCAGGG + Intronic
1075068155 10:119303545-119303567 TAGTGGTTGTGGGGGAGTCACGG + Intronic
1075083508 10:119399104-119399126 CTGAGCTGATGGGGGTGTCTGGG - Intronic
1075186522 10:120263912-120263934 ATGTGGTTAGTGGGATGTCAGGG + Intergenic
1076320918 10:129580747-129580769 CTGTGGTTATGGGGCATCCATGG - Intronic
1076861199 10:133139239-133139261 CTGTGGTTGGGGGGGTCTCTGGG + Intergenic
1076909107 10:133378759-133378781 CAGTGGGTCTGGGGGTGCCACGG - Intergenic
1077379015 11:2219543-2219565 CTGTGGGAATGGGGCTGCCAGGG - Intergenic
1077534983 11:3119729-3119751 CTGTGGCCCTGGGGGTGTCCAGG - Intronic
1078606764 11:12784072-12784094 CAGAGGTTATGGGAGTGACAAGG + Intronic
1080622476 11:33998071-33998093 CTGAGAGTATGGGGGTGGCAGGG + Intergenic
1082131947 11:48501073-48501095 GGTTTGTTATGGGGGTGTCATGG - Intergenic
1082244843 11:49910380-49910402 GGTTTGTTATGGGGGTGTCATGG + Intergenic
1083384431 11:62297054-62297076 CTGTGGTCAGGAGAGTGTCATGG + Intronic
1083636685 11:64124645-64124667 CTGTGGCTTTGGGGGTCTCCAGG - Intronic
1084089454 11:66870514-66870536 CAGTGGTTATGTGGGGGTGATGG - Intronic
1084657023 11:70525671-70525693 GTGTGTTTACGGGGGTGCCAGGG - Intronic
1087138273 11:94741162-94741184 CTGTGCTTTCGGGGGTGGCAGGG + Intronic
1090333587 11:125948591-125948613 CTGTGGTGGGGGGGCTGTCAGGG + Intergenic
1090560813 11:127930018-127930040 CTGGGGTTAAGGGGCTGTCCCGG - Intergenic
1091610479 12:2003898-2003920 CTGTGGCTATGGGGGAGGCAGGG - Intronic
1096194721 12:49642508-49642530 CTGTGCTCATGGCGGTGTCCAGG + Exonic
1100767275 12:97881141-97881163 TTGTGTTTATGGGGCTGCCATGG - Intergenic
1102506895 12:113389405-113389427 CTGTGCTTCTTGGGGTGGCAGGG + Exonic
1106194095 13:27478510-27478532 GTGTGTTTGTGGGTGTGTCAGGG - Intergenic
1111433869 13:88180830-88180852 CTGAGGGTGTGGGGGTGTGATGG - Intergenic
1114996355 14:28357244-28357266 CAGTGGTTATGTGAGTGTCAAGG + Intergenic
1118324679 14:64772976-64772998 ATGTGGTTATGGGGGGCACAGGG + Intronic
1118602838 14:67482523-67482545 CTGTAGTGATGGGGGTGGCTGGG - Intronic
1122525287 14:102378176-102378198 CTGTGGTTAGGGGGCTTTTATGG + Intronic
1122888593 14:104722604-104722626 CAGTGGGTCTGGGGGTGTCAAGG - Intergenic
1126178968 15:45766214-45766236 TTGTGGTCATGGAGGTATCAAGG - Intergenic
1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG + Intronic
1128231397 15:66037909-66037931 ATGTGGCCATGGGGATGTCAGGG - Intronic
1128469685 15:67941744-67941766 CTGTGGATATGGAGTGGTCAGGG + Intergenic
1128632681 15:69281975-69281997 CTGTGGGTGTGGGGTTATCAGGG - Intergenic
1128968527 15:72086006-72086028 CTGGGGGTAGGAGGGTGTCAAGG + Intronic
1129861054 15:78862030-78862052 CTGTAATAATGGGGGTGTCTGGG - Intronic
1132072848 15:98794929-98794951 CTGGGGTTGGGGAGGTGTCAAGG - Intronic
1132677956 16:1128483-1128505 CAGTGGGGATGGGGGTGTCCTGG - Intergenic
1132688787 16:1173097-1173119 TTGTGGATATTGGGGTGTCGAGG + Intronic
1136579516 16:31143103-31143125 CTGTTGGAATGGGGGTGTCGTGG - Intronic
1136922337 16:34343619-34343641 TTGTGGCTCTGGGGGTGACAAGG + Intergenic
1136982236 16:35068187-35068209 TTGTGGCTCTGGGGGTGACAAGG - Intergenic
1137377537 16:47965852-47965874 CTGTAGTGATGGGGGTGGGAGGG + Intergenic
1137761786 16:50946983-50947005 CTGTGGGGATGGGGGGCTCAGGG + Intergenic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1138186377 16:54980985-54981007 CTGTGGTCATGGGAAGGTCATGG + Intergenic
1139198120 16:64944697-64944719 CTGGGTTTCTGGGGGTGACAGGG - Exonic
1141137377 16:81474918-81474940 ATGTGGTTCTGGGGGTGGCCAGG + Intronic
1141991116 16:87610624-87610646 CTGTGGACATGAGGGTCTCACGG - Intronic
1142736768 17:1905884-1905906 CTGTGTGTATGGGGGTGTGCTGG + Intergenic
1143589799 17:7875821-7875843 CTGTGGTTGTGCAGGTTTCAGGG - Intronic
1144191458 17:12850496-12850518 CAGGGGTCATGGGGATGTCAAGG + Intronic
1146791623 17:35753822-35753844 CTGTGGCCATGGGGGTGGTAGGG - Intronic
1146820825 17:35982645-35982667 CTCTGTTTATGGAGGTGACAAGG + Intergenic
1147708033 17:42441552-42441574 CTGGGGTGTTGGGGGTGGCAGGG - Intergenic
1151899323 17:77001540-77001562 CTGTAGAGATGGGGGTCTCAGGG - Intergenic
1152210445 17:79000450-79000472 CGGGGGGTATGGGAGTGTCAGGG - Intronic
1152441632 17:80313407-80313429 CTGTGGTGATGGAGGTGTGGAGG + Intronic
1156112118 18:33740713-33740735 CTGGGTTTATGGGGATTTCAAGG + Intronic
1156264879 18:35478703-35478725 GTGTGGACATGAGGGTGTCAGGG - Intronic
1159955507 18:74515903-74515925 CTGTAGAACTGGGGGTGTCAAGG - Intronic
1160586463 18:79916051-79916073 CTGTGGGTATGGGAGCGCCATGG - Intronic
1160827916 19:1089310-1089332 CTGGGGGTCTGGGGGTGTCCTGG + Intronic
1160970107 19:1764256-1764278 GTGGGGGCATGGGGGTGTCAGGG - Intronic
1161644454 19:5444536-5444558 CTGTGGGGATGGGGGTGGCAGGG - Intergenic
1162239235 19:9335455-9335477 CTGGGGGTATGGGGGAGACAGGG - Intronic
1162740879 19:12772913-12772935 CTGGGGAGAAGGGGGTGTCAGGG + Intronic
1163013683 19:14440917-14440939 CTGTGGTGGTGGGGGTGACAAGG + Intronic
1163490468 19:17614693-17614715 CTGGGGTGATGGGGGTCTCCAGG - Intronic
1165198014 19:34121319-34121341 CTGTGTGTATGGGGCTGTTAGGG - Intergenic
1166071365 19:40390055-40390077 CTGGGGGTTTGGGGGTGCCAGGG - Exonic
1166200566 19:41234893-41234915 GTGTGGTTATGGGGGTTTTGTGG + Intronic
1166986919 19:46666176-46666198 TTGTGGTTATGGGGAAGTCAAGG + Intergenic
1167104187 19:47420648-47420670 CTCTTGTTTTGGGGGTGGCAGGG - Intergenic
1168296233 19:55378449-55378471 CTGCGCTCATGGGGGTGTCCTGG + Intergenic
925999289 2:9317280-9317302 CTGTGATTGTGAGGGTGTGAGGG - Intronic
926751045 2:16198799-16198821 CTGGGGTAATGGGGGAGGCATGG + Intergenic
926765910 2:16322620-16322642 CTGTGGTTATGGGCACGGCAGGG - Intergenic
928610428 2:32986984-32987006 TTGTGGCGATGGGGGTGTGATGG + Intronic
929375444 2:41281486-41281508 CTGTGGTTATAGAAGTGTTAGGG + Intergenic
929381160 2:41355811-41355833 CTGTGGTTATGCTGATTTCATGG - Intergenic
930186245 2:48415100-48415122 CTGTTGATATGGGGGAGGCAGGG + Intergenic
938020064 2:127899013-127899035 CAGTAGTTTTAGGGGTGTCAAGG - Intergenic
940105088 2:150090399-150090421 CTGTGGTTGTGGGAGTGAAAAGG - Intergenic
942521108 2:176805135-176805157 AGGTGGTTATGGGGGATTCAAGG + Intergenic
943298191 2:186164321-186164343 CTGTGGTGGTGGGGTTGTTAGGG - Intergenic
943786567 2:191884042-191884064 GAGTGGAGATGGGGGTGTCAGGG - Intergenic
945996420 2:216440572-216440594 CTGTGTTTATGAAGGTGTCTTGG + Intronic
946103650 2:217350885-217350907 CTGTGCTGGTGGGGGTGTCAAGG + Intronic
948047396 2:234954309-234954331 TTGTTGTTGTGGGGGTGGCATGG - Intronic
1169169604 20:3454208-3454230 CAGTGGTTATGGGGGTGAGGAGG - Intergenic
1169258173 20:4114803-4114825 CTGTGGTGTTGGGGGTGGGAGGG - Intergenic
1170527006 20:17248958-17248980 CTGTGGCTCAGGGGGTGCCAGGG - Intronic
1172501794 20:35432936-35432958 CTGTGAGTATGGGGGTAGCAGGG + Intergenic
1172520369 20:35561986-35562008 CTGTGGCCATAGGGCTGTCAGGG - Intergenic
1173418971 20:42883803-42883825 GTGTGCATATGGGGGTGTAAGGG - Intronic
1174453033 20:50631321-50631343 CTGGAGTTATGGGGGTCCCAGGG + Intronic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1176144828 20:63560952-63560974 CTCTGGGTCTAGGGGTGTCAGGG - Intronic
1178223464 21:30687495-30687517 CTTTGTTTATGGGGTTGTCCTGG + Intergenic
1181985552 22:26797917-26797939 CTGTGTCTATCGGGGTGTCTTGG - Intergenic
1182061185 22:27398996-27399018 GTGTTGGTTTGGGGGTGTCAGGG - Intergenic
1183958960 22:41399444-41399466 CTGTGATGAAGGGGGTGTCTGGG - Intergenic
949801820 3:7912495-7912517 CTCTGGTTTTGGGGGTGATAGGG - Intergenic
950758469 3:15198384-15198406 CTGGAGTTATGGGGGTGACAAGG - Intergenic
952857560 3:37784813-37784835 CTGTGTTTATGTGGGTGCCTGGG + Intronic
953231446 3:41068722-41068744 CTGGGGAGATGGGGGTGTCCTGG + Intergenic
953768410 3:45761207-45761229 GGGGGGTTATGGGGGTGTGAAGG - Intronic
954258415 3:49421964-49421986 TAGAGGTCATGGGGGTGTCATGG - Intronic
954901440 3:54023481-54023503 CTGGGGTTAAGATGGTGTCAAGG + Intergenic
955731842 3:61995594-61995616 GTGTGGGTATGGGGGTGTGTAGG + Intronic
959952302 3:112193602-112193624 CTCTGGGTATGGGGATGGCATGG + Intronic
961894461 3:130155741-130155763 CTCTGGTTTTGGGGTTGTCCTGG + Intergenic
964603132 3:158525860-158525882 CTGTGGTTGTCTGGGGGTCAGGG + Intronic
969323236 4:6425686-6425708 CTGTGGTGATGGGGATGGCAGGG - Intronic
969748313 4:9091328-9091350 CTCTGGTTATGGGGTTGCCCTGG - Intergenic
970374546 4:15443564-15443586 ATGTGTTTAAGGGGGTGTGATGG + Exonic
975111612 4:70634627-70634649 GTGTGTATATGGGGGTGGCATGG - Intronic
977675776 4:99745213-99745235 GTGTGGTTGTGTGGGTGTCAAGG - Intergenic
978174796 4:105716918-105716940 GTTTGGTTATGGGGGTGTGAAGG + Intronic
978254368 4:106675850-106675872 CTGTGGTTAGGTGGGGGTCTGGG + Intergenic
980092301 4:128455482-128455504 CAGAGGGTATGAGGGTGTCAAGG - Intergenic
982505166 4:156207992-156208014 ATGAGTTTATGAGGGTGTCAAGG + Intergenic
983074784 4:163312739-163312761 CTGTGTGTATGGGGGTGGCAAGG - Intergenic
985041732 4:185897621-185897643 CAGTAGTTATGGTTGTGTCAGGG - Intronic
985685174 5:1278055-1278077 CTGGGGTCCTGGGGGTGCCAGGG + Intronic
987797499 5:22648303-22648325 CTGTGGTCTTGAGGATGTCAAGG - Intronic
989272932 5:39553935-39553957 CTTTGGTAAAGCGGGTGTCATGG + Intergenic
999499226 5:152130171-152130193 CTGTGGTTATTGTGGTGGGAGGG - Intergenic
999750093 5:154621728-154621750 CTCTGCTTCTGGGGGTATCATGG + Intergenic
1000715328 5:164636493-164636515 CTGTGGTTATTGGGATGTCCTGG + Intergenic
1001667069 5:173442042-173442064 CTGTGGTGGTGGTGGTGTTATGG - Intergenic
1002132501 5:177090241-177090263 ATGTGGCTGTGTGGGTGTCAAGG + Intronic
1004108780 6:12693684-12693706 CTGGCATTATGGGAGTGTCAGGG + Intergenic
1006294304 6:33163185-33163207 CTGTGTGTAGGGGGGTTTCAGGG - Exonic
1006516707 6:34549535-34549557 CTGTGGTTCGGGAGCTGTCAGGG - Intronic
1007628452 6:43259596-43259618 CTGGGGTTGTGGGGGAGTCTGGG - Exonic
1008306870 6:49913944-49913966 CTCTGGTTGAGGGGTTGTCACGG - Intergenic
1013149743 6:107432942-107432964 TTGTGGTTATTGGGGTGGTAGGG - Intronic
1013367602 6:109447363-109447385 GTGTTGGGATGGGGGTGTCAGGG + Exonic
1016452371 6:144196233-144196255 CTATGGGTATGGGAGTGGCAAGG + Intergenic
1017769938 6:157637194-157637216 CTGTGGCTTTGGAGGTGGCATGG + Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1022779465 7:33564228-33564250 CTATGGTGATGAGGGTGCCATGG - Intronic
1025160312 7:56653708-56653730 CTGTGGGTGTGGCGGTTTCAAGG - Intergenic
1025260125 7:57413081-57413103 CTATGGTCCTGGGGGTGTCCAGG + Intergenic
1025755227 7:64331984-64332006 CTGTGGGTGTGGTGGTTTCAGGG + Intronic
1026178972 7:68022137-68022159 CTGTGGGTCTGTGGGTGTCCAGG - Intergenic
1027235334 7:76294582-76294604 CAGTGGTGATGGGGGTGGCATGG + Intergenic
1027764267 7:82320416-82320438 CTGTGGTTTTGAGGGAGACAGGG + Intronic
1029510661 7:100992825-100992847 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511150 7:100996074-100996096 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511344 7:100997331-100997353 CTGAGGTTGTGGGGGTGCGAGGG - Exonic
1029511878 7:101000745-101000767 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029512370 7:101003994-101004016 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1030751006 7:113232686-113232708 TTGTGGTTGTGGGTGGGTCAGGG + Intergenic
1031555447 7:123169776-123169798 CTCTGTTCATAGGGGTGTCAAGG + Intronic
1031863645 7:127013135-127013157 CTGTGTTTATAGGGATATCAGGG - Intronic
1037556726 8:20032187-20032209 TGGTGGTTATGAGGGTGACATGG - Intergenic
1040370494 8:46767023-46767045 CTTTGTTTTTGGGGTTGTCAAGG - Intergenic
1042114064 8:65412473-65412495 CTGAGGGCATGAGGGTGTCAGGG - Intergenic
1042452707 8:68967392-68967414 CTGTTGCTATGGGAATGTCAAGG - Intergenic
1045710949 8:104983253-104983275 GTGTGTCTATGGGGGTGGCAGGG + Intronic
1049756724 8:144314102-144314124 CTGCGGGGGTGGGGGTGTCAAGG - Intronic
1051515158 9:17922539-17922561 CTGTGGTTATGTGGGTGAGGGGG - Intergenic
1056548178 9:87630109-87630131 CTGTGGCTTAGGGTGTGTCATGG - Intronic
1057910758 9:99018392-99018414 CTGTGCTCATGGGAGTGTGAGGG + Intronic
1058645438 9:107127548-107127570 CTGTGGTGCTGGGGGTTGCAGGG + Intergenic
1058916393 9:109570252-109570274 CTTTGAGTATGTGGGTGTCATGG - Intergenic
1059397940 9:114050375-114050397 CTGTGGTTGTGGGGGTGTGGGGG + Exonic
1060695528 9:125706501-125706523 CTTTGTTTATGGGAGTGGCAAGG - Intronic
1060927893 9:127468013-127468035 CTGTGGTTATGGGAGTGCAGTGG + Intronic
1061570320 9:131474061-131474083 CTGGGGCTATGGGGGTGGCAGGG - Intronic
1062287343 9:135779028-135779050 CTGTGGTTGTGGGGGTTTCAGGG - Intronic
1062287419 9:135779264-135779286 ATGTGGCTGTGGGGGTCTCAGGG - Intronic
1187916040 X:24152652-24152674 CTGTGGTTGTTGAGGTGTTAAGG + Intronic
1189943770 X:46155693-46155715 ATGTGAGTATGGGGGTGTCTTGG - Intergenic
1190049232 X:47137268-47137290 ATCTGGTAAGGGGGGTGTCAGGG - Intergenic
1196080944 X:111630337-111630359 CTGTGTGTGTGGGGGAGTCAGGG + Intergenic
1197265535 X:124365841-124365863 TTTTGCTTCTGGGGGTGTCAAGG + Intronic
1201771557 Y:17621421-17621443 CTGGGGTTGTGGGGGGGGCAGGG - Intergenic
1201829998 Y:18284565-18284587 CTGGGGTTGTGGGGGGGGCAGGG + Intergenic