ID: 915599586

View in Genome Browser
Species Human (GRCh38)
Location 1:156913907-156913929
Sequence GGTCCCGGATGGTGGCATAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915599586_915599594 -4 Left 915599586 1:156913907-156913929 CCCATATGCCACCATCCGGGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 915599594 1:156913926-156913948 GACCTGCCCAGCTTGCCAGGGGG 0: 1
1: 0
2: 1
3: 18
4: 153
915599586_915599598 3 Left 915599586 1:156913907-156913929 CCCATATGCCACCATCCGGGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 915599598 1:156913933-156913955 CCAGCTTGCCAGGGGGCCCCCGG 0: 1
1: 0
2: 0
3: 38
4: 324
915599586_915599602 19 Left 915599586 1:156913907-156913929 CCCATATGCCACCATCCGGGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 915599602 1:156913949-156913971 CCCCCGGGAGAGCAGCTACATGG 0: 1
1: 0
2: 3
3: 10
4: 152
915599586_915599591 -7 Left 915599586 1:156913907-156913929 CCCATATGCCACCATCCGGGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 915599591 1:156913923-156913945 CGGGACCTGCCCAGCTTGCCAGG 0: 1
1: 0
2: 2
3: 18
4: 196
915599586_915599592 -6 Left 915599586 1:156913907-156913929 CCCATATGCCACCATCCGGGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 915599592 1:156913924-156913946 GGGACCTGCCCAGCTTGCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 300
915599586_915599593 -5 Left 915599586 1:156913907-156913929 CCCATATGCCACCATCCGGGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 915599593 1:156913925-156913947 GGACCTGCCCAGCTTGCCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 204
915599586_915599606 29 Left 915599586 1:156913907-156913929 CCCATATGCCACCATCCGGGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 915599606 1:156913959-156913981 AGCAGCTACATGGAGATGAAAGG 0: 1
1: 0
2: 2
3: 14
4: 223
915599586_915599599 4 Left 915599586 1:156913907-156913929 CCCATATGCCACCATCCGGGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 915599599 1:156913934-156913956 CAGCTTGCCAGGGGGCCCCCGGG 0: 1
1: 0
2: 2
3: 25
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915599586 Original CRISPR GGTCCCGGATGGTGGCATAT GGG (reversed) Exonic
902990031 1:20180848-20180870 GGACCCAGATGGTGGCGTCTAGG - Intergenic
903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG + Intronic
904094295 1:27965629-27965651 GGTCACGGAAGGTGGCATGCTGG + Intronic
904482901 1:30805323-30805345 GGTCCGGGAGGGTGGCACAGGGG + Intergenic
910141665 1:84032979-84033001 GGTACCTGATGCTGGCATATTGG - Intergenic
910588348 1:88902674-88902696 GGTCTCTGCTGGTGGCAAATTGG - Intergenic
914343570 1:146779688-146779710 GGCCCAGGATGGTGCCAAATAGG + Intergenic
915599586 1:156913907-156913929 GGTCCCGGATGGTGGCATATGGG - Exonic
923316154 1:232782003-232782025 GGTCAGGGATGGTGGCCTTTGGG + Intergenic
1067768846 10:49109180-49109202 GTTACCAGATGGTGGCATTTTGG - Intronic
1068118146 10:52757199-52757221 GGTCACTGATGGAGGCAAATTGG + Intergenic
1073205933 10:101769338-101769360 GGTCCAAGGTGGGGGCATATTGG - Intergenic
1085316243 11:75546816-75546838 GGGGCAGGAGGGTGGCATATGGG + Intergenic
1094646356 12:32328336-32328358 GGTCCCGGATTATGGCATTAAGG - Exonic
1096160086 12:49368894-49368916 GGTCTTGGATGGTAGCATTTAGG + Intronic
1110715542 13:78699416-78699438 GGGCCAGGATGGTGGCATTCTGG + Intergenic
1116866214 14:50033755-50033777 GGAGCCGGATGGTGGCAGCTTGG + Intergenic
1118848389 14:69565629-69565651 GTTCCCGAATGCTGGCATTTTGG + Intergenic
1118950623 14:70433644-70433666 GGTCTCTGCTGGTGGCAAATTGG + Intergenic
1121877920 14:97470999-97471021 GGTAAGGGATGGTGGCATCTTGG + Intergenic
1121886637 14:97548928-97548950 TGTCCTGGCTGGTGGAATATTGG + Intergenic
1129115273 15:73362103-73362125 GGTCCCGCATGCTGGCTTTTGGG - Intronic
1135223627 16:20636706-20636728 GGGCCAGGATGGGGGCAGATGGG + Intronic
1136142401 16:28295878-28295900 GGCCCCCGATGCTGGCATCTGGG + Intronic
1139990421 16:70935646-70935668 GGCCCAGGATGGTGCCAAATAGG - Intronic
1140141190 16:72259474-72259496 GAGCCCAGATGGTGGCATTTGGG + Intergenic
1140754578 16:78056009-78056031 AGTCCCGGGTGGTGGCTTGTGGG + Intronic
1141706021 16:85665145-85665167 GGTCCTGGGTGGTGGCAGGTGGG - Intronic
1142184671 16:88688832-88688854 GGTGTCGGATGGAGGCAGATGGG - Intergenic
929111473 2:38408595-38408617 GCTCCCCGATGTTGGCATAGGGG - Intergenic
934942858 2:98515002-98515024 GTTCCCGGAGAGTGGCACATAGG + Intronic
936646244 2:114376043-114376065 GGTCTCGGCTGCTGGCAGATTGG + Intergenic
937094540 2:119226794-119226816 TGGCCCGGATGCTGGCACATGGG - Intronic
937447443 2:121970882-121970904 TGTTCAGGATGGTGGCACATGGG + Intergenic
937528127 2:122795987-122796009 CTTTCTGGATGGTGGCATATTGG + Intergenic
1176071200 20:63227266-63227288 GGTCCTGGGTGGGGGCTTATGGG + Intergenic
1182545822 22:31075922-31075944 GGTCCCCCATGGTCTCATATTGG - Intronic
952792463 3:37211106-37211128 GGTCAGGGATGGTGGCATTTTGG + Intergenic
961391445 3:126554714-126554736 GGTCCCGTGTGGTGGCATGCTGG - Intronic
963889735 3:150620309-150620331 GGTACCCGATGGTGGCATTGTGG + Intronic
970629415 4:17924429-17924451 GGTCCCGGCTTCTGGCAAATTGG - Intronic
976301216 4:83517205-83517227 GGTCTCTGCTGCTGGCATATTGG + Intronic
978424162 4:108564983-108565005 GGTTCAGGCTTGTGGCATATGGG - Intergenic
983790796 4:171794971-171794993 GGTCCCAGAGGGAGGAATATTGG - Intergenic
986165318 5:5267703-5267725 GGCCCAGGATGGGGGCATAGTGG + Intronic
986552529 5:8974292-8974314 GCTCCCTGGTGGTGGCATACAGG + Intergenic
998593356 5:143501394-143501416 GGGCCTGGATGCTGGCAGATGGG - Intergenic
1001554406 5:172626173-172626195 GGTGGAGGATGGTGGCAGATGGG + Intergenic
1002053930 5:176587674-176587696 GTTCCCAGAAGGTGGCATGTGGG + Intronic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1007611163 6:43150023-43150045 GGTCCTGGGTGTTGGCATAATGG + Intronic
1007653623 6:43438693-43438715 TGTCTCGGATGGTGGCAAACTGG - Exonic
1011136532 6:84106474-84106496 GGTCTCTGCTGCTGGCATATTGG + Intergenic
1011922707 6:92600931-92600953 GATCCTGGATGTTGGTATATAGG - Intergenic
1016886192 6:148961938-148961960 GGTCCCTGATGGTAGCATGGTGG + Intronic
1020040150 7:4995727-4995749 GGTCACGGAAGGTGGCATGCTGG + Intronic
1023758630 7:43443771-43443793 GGTCCTGCAGGGTGGCATAAGGG - Intronic
1028631380 7:92938160-92938182 GTTCCCTGTTGGTGACATATAGG - Intergenic
1036717876 8:11143737-11143759 GGTCCTGGATGGTGGCTAAAGGG + Intronic
1043617157 8:82140327-82140349 GGTCCAGGATGGTGGTTTAGGGG + Intergenic
1048347211 8:133585245-133585267 GATCATGGATGGTGTCATATAGG + Intergenic
1186726384 X:12363564-12363586 GGTCTCTGATGGTGGCTTAGGGG - Intronic
1188972959 X:36639575-36639597 GGTCCTGGCTGGTGCCATTTAGG - Intergenic
1193053619 X:77126692-77126714 GGTCTCTGATGCTGGCAAATTGG - Intergenic
1194834077 X:98659720-98659742 GGTCTCGGCTGCTGGCAAATTGG - Intergenic
1197244919 X:124158077-124158099 GGTCTCTGATGCTGGCAAATTGG + Intronic
1199595828 X:149505120-149505142 GGTCCGGGGTGGCGGCATTTCGG + Intronic