ID: 915599592

View in Genome Browser
Species Human (GRCh38)
Location 1:156913924-156913946
Sequence GGGACCTGCCCAGCTTGCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 300}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915599582_915599592 10 Left 915599582 1:156913891-156913913 CCCTGAGCAGTGAGAACCCATAT 0: 1
1: 0
2: 0
3: 13
4: 134
Right 915599592 1:156913924-156913946 GGGACCTGCCCAGCTTGCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 300
915599583_915599592 9 Left 915599583 1:156913892-156913914 CCTGAGCAGTGAGAACCCATATG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 915599592 1:156913924-156913946 GGGACCTGCCCAGCTTGCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 300
915599581_915599592 22 Left 915599581 1:156913879-156913901 CCAGTGTGGCTTCCCTGAGCAGT 0: 1
1: 0
2: 0
3: 13
4: 288
Right 915599592 1:156913924-156913946 GGGACCTGCCCAGCTTGCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 300
915599587_915599592 -7 Left 915599587 1:156913908-156913930 CCATATGCCACCATCCGGGACCT 0: 1
1: 0
2: 1
3: 8
4: 62
Right 915599592 1:156913924-156913946 GGGACCTGCCCAGCTTGCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 300
915599586_915599592 -6 Left 915599586 1:156913907-156913929 CCCATATGCCACCATCCGGGACC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 915599592 1:156913924-156913946 GGGACCTGCCCAGCTTGCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915599592 Original CRISPR GGGACCTGCCCAGCTTGCCA GGG Exonic
900504637 1:3023213-3023235 GGGCCCTACCTAGCATGCCAGGG + Intergenic
900716629 1:4149125-4149147 GGGACCTGCTTAGCTGGCCTAGG - Intergenic
901438772 1:9264943-9264965 GCCACCTGCCCAGCGTGCCCTGG + Exonic
901629573 1:10641592-10641614 GGGACCTGCCCAGGTTCAGAGGG - Intronic
902134267 1:14291477-14291499 GGGACCTGCCGAGCCAGGCATGG + Intergenic
902286890 1:15412891-15412913 GGCACCTGCACTTCTTGCCAGGG + Intronic
902824849 1:18965852-18965874 GGGACCTGCCCTGATTCCCTTGG - Intergenic
902974826 1:20081072-20081094 AGGACGTGGCCAGGTTGCCAAGG - Intronic
903193030 1:21667447-21667469 GGGACCTTCCCAGCTTGCTTGGG - Intronic
903764585 1:25725968-25725990 GTGAGCTGCCCAGCTGGGCATGG + Intronic
905355482 1:37380857-37380879 GGGACCTGCCAAGTGTGGCACGG + Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
905824549 1:41018377-41018399 GGGAAGGGCCCAGCTTGGCAGGG - Intronic
907483117 1:54758272-54758294 ATGAACTGCCCTGCTTGCCAGGG - Exonic
908319320 1:62964942-62964964 GAGTCCTGCCAAGCTTGACATGG - Intergenic
909449008 1:75777919-75777941 GGGACCTGCCAAGCCAGGCACGG - Intronic
910802119 1:91157465-91157487 GGGACCAGGCCAGCTTGGCATGG - Intergenic
912410206 1:109476013-109476035 GAGACCTGTCCAGCTTGTCCAGG - Intronic
913207116 1:116549368-116549390 GGGACCTGCCCTGCTCTCCTGGG - Intronic
914007752 1:143747734-143747756 GGGAGCTGACCAAATTGCCAAGG + Intergenic
914990748 1:152497708-152497730 GGGACCTCTCCAGCTGGCGAAGG + Intergenic
915599592 1:156913924-156913946 GGGACCTGCCCAGCTTGCCAGGG + Exonic
916197728 1:162240425-162240447 GGGCCCTGCTGAGCTTGCCTGGG - Intronic
918045954 1:180941177-180941199 GGGACTTGCCCAGCTTGGGCCGG - Exonic
919063929 1:192668753-192668775 GGGACCTGCCAAGCCAGGCACGG + Intergenic
920588805 1:207196286-207196308 GGGACCTGCCAAGCCAGCCATGG - Intergenic
922433656 1:225581889-225581911 GGGATCTCCCTATCTTGCCAAGG + Intronic
922699478 1:227750525-227750547 GGGCCAGTCCCAGCTTGCCAGGG - Intronic
923250719 1:232177422-232177444 GGGACCTTTCCAGCTAGACATGG + Intergenic
923506340 1:234609417-234609439 GTGACCTGCCCCGCATGCCCTGG - Exonic
924812902 1:247418812-247418834 GGTACCTGGCCAGCTTGCAGCGG - Exonic
1063148820 10:3319386-3319408 GGGACCTGAGCTGGTTGCCATGG + Intergenic
1064518654 10:16177386-16177408 GGGACCTGCCAAGCCAGGCATGG + Intergenic
1065157021 10:22880979-22881001 GGGACCTGCCAAGCCAGGCATGG - Intergenic
1065799116 10:29334976-29334998 GAGACCTGCCGAGCCTGACACGG - Intergenic
1066243910 10:33563495-33563517 GGGACCTGACCAACTTGCACAGG + Intergenic
1069002932 10:63285614-63285636 GGGATCTCCCCAGGTTGCCCAGG - Intronic
1070853442 10:79585922-79585944 GGGACCTGGGCAGCTTGACTAGG - Intergenic
1071066731 10:81644759-81644781 GGGACCAGCCCAGCCAGGCATGG + Intergenic
1075639925 10:124057064-124057086 GGGACCTTCCCAGCAAGGCAGGG + Intronic
1075724660 10:124605129-124605151 GGGGCCTGGCCAGCTTCACAGGG - Intronic
1076508719 10:130997416-130997438 GGGACCAACCCAGCCTCCCAGGG + Intergenic
1076590964 10:131581763-131581785 GGGACCTGCCGAGCTGGGCATGG + Intergenic
1076748237 10:132525180-132525202 GGCACCTGCCCAGCTCGCTTTGG - Intergenic
1076816340 10:132916817-132916839 GGGGCAGGCCCAGCTTGCAAAGG - Intronic
1077424015 11:2466073-2466095 GGGACCTGCCCATCCACCCAGGG + Intronic
1077458050 11:2692704-2692726 GGGACCTGCCTACCCTCCCAGGG - Intronic
1078283825 11:9930950-9930972 GGGACCAGCCAAGCCTGGCATGG - Intronic
1079391424 11:20025124-20025146 GTGACCTGCCCAAGGTGCCAGGG - Intronic
1079605536 11:22360900-22360922 GTGACCTACCCAGCATGTCATGG + Exonic
1081615963 11:44591380-44591402 GGGACCAGCCAAGCTTGCCCAGG + Intronic
1083609383 11:63997929-63997951 GGGACTTGCCCAGGGTCCCAGGG + Exonic
1084296239 11:68214486-68214508 GGGAGCTGCGAAGCTTGCCTGGG + Intergenic
1086916042 11:92531352-92531374 GGGAACTGCACAGCTTCCCTGGG - Intronic
1087461714 11:98455300-98455322 GGCACCTGCCAAGGTTGCCGGGG - Intergenic
1088830176 11:113530203-113530225 GGGACCAGCTAGGCTTGCCAGGG - Intergenic
1090458656 11:126870586-126870608 GGGGCCTGCCAAGCCTGGCATGG - Intronic
1092650441 12:10629505-10629527 GGGACCTGCTCAGCTTTCTCTGG - Exonic
1094558013 12:31522359-31522381 GGGATCAGCCCAGCTTTCAAAGG - Intronic
1095706455 12:45242366-45242388 GGGACCTGCCAAGCCAGGCATGG + Intronic
1095939075 12:47714006-47714028 GAGACCTGACCTTCTTGCCATGG - Intronic
1096881262 12:54674322-54674344 GGGATCTTGCCATCTTGCCAAGG - Intergenic
1098176036 12:67792424-67792446 GGGACCTGCCAAGCCAGGCACGG + Intergenic
1100652384 12:96604769-96604791 GGGACCTGCCAAGCCAGGCATGG + Intronic
1100739148 12:97571897-97571919 GAGCCCTGCTCAGCTAGCCAAGG - Intergenic
1101005349 12:100396333-100396355 GTGACCTACCCAGCCTGCCATGG + Exonic
1101952452 12:109187221-109187243 GGGCCCTGCCCAGGATGCCCTGG + Intronic
1102730837 12:115107850-115107872 GAGACCTGCCCAAGTTGGCAGGG + Intergenic
1102923434 12:116809562-116809584 GGGAACTGACCATCTTGGCATGG - Intronic
1104163435 12:126203145-126203167 GGGACCTCACGAGCTGGCCAGGG + Intergenic
1104401215 12:128477870-128477892 GGTGCCTGCCCAGCTGGCCATGG - Intronic
1104407116 12:128527040-128527062 CGGATCTTCCTAGCTTGCCAGGG - Intronic
1104721774 12:131048456-131048478 GGGGCCTGCCCATCTTTCCCGGG + Intronic
1104855492 12:131900578-131900600 GGATCCTGCCCAGCATGCCCTGG + Intronic
1105899058 13:24741169-24741191 GGAGCATGCCCAGCTCGCCAGGG - Intergenic
1106139473 13:26999753-26999775 GGGGCCTGGCCATCTTCCCAAGG - Intergenic
1106816865 13:33418289-33418311 GGGACCTGCCAAGCCAGGCATGG - Intergenic
1107835219 13:44407500-44407522 AGTGTCTGCCCAGCTTGCCAGGG + Intergenic
1108170333 13:47735110-47735132 GGGACCTGCCGAGCCAGGCATGG - Intergenic
1109110888 13:58318123-58318145 GGGACCCGAGCAGGTTGCCATGG + Intergenic
1110071547 13:71184612-71184634 GGGACCTGCCAAGCTAGGCATGG - Intergenic
1112412058 13:99173111-99173133 GGGACCCGCCCAGCCAGGCACGG + Intergenic
1112557060 13:100478466-100478488 GGGACCTCCCCAGGTACCCAGGG - Intronic
1112571166 13:100594884-100594906 GGGACCTGCCCTACCTGCCTAGG - Intergenic
1113506055 13:110816689-110816711 GGGACCTGCCAAGCCTGTAAGGG - Intergenic
1117307209 14:54488689-54488711 TGGACCCGCCCAGCGGGCCATGG - Intronic
1118322654 14:64762433-64762455 GGGAGGTGCTCAGGTTGCCAAGG + Intronic
1118379371 14:65205046-65205068 GGGACCGGCCCACCCTGACATGG - Intergenic
1118450048 14:65892378-65892400 GGGACCTGCCAAGCCAGGCATGG - Intergenic
1118490403 14:66253720-66253742 GGGACCTGACCAGGTTACTAGGG - Intergenic
1118559889 14:67067746-67067768 GGGACCTGCCAAGCCAGGCATGG + Intronic
1118752863 14:68819302-68819324 GGGAACTGCCTAGCTAGGCATGG - Intergenic
1119364570 14:74080632-74080654 GGGGCCTCCCTATCTTGCCAGGG + Intronic
1119437143 14:74605016-74605038 GAGCCCGGCCCAGCCTGCCAAGG - Intronic
1119743288 14:77027721-77027743 GCGACCTGCCCCGCATGCCCTGG - Exonic
1120405548 14:84090519-84090541 GGGTCCTGCCCAGCTATGCAAGG - Intergenic
1121105707 14:91278126-91278148 GGGACCTGGCCACTTTGCCCCGG - Exonic
1122720123 14:103716807-103716829 GGGGCCTTCCCAGTTGGCCAAGG - Intronic
1122780572 14:104141712-104141734 GGGTCGGGCCCAGCCTGCCAGGG + Intronic
1123415176 15:20090014-20090036 AGGACCTGGCCAGCTGGCCTGGG - Intergenic
1123524518 15:21097128-21097150 AGGACCTGGCCAGCTGGCCTGGG - Intergenic
1124203474 15:27698104-27698126 GGGAGCTGCCCATTTTGCCTGGG - Intergenic
1124808266 15:32907819-32907841 CGACCCTGCCCAGCTTTCCAGGG - Intronic
1126074512 15:44896329-44896351 GGGACCTGCCGAGCCAGGCACGG + Intergenic
1126110405 15:45171790-45171812 GGGACCTCCCCAGCTTGGTTGGG + Intronic
1127053899 15:55112882-55112904 GGGTCCTGTCCAGCTGGCAAAGG - Intergenic
1127070672 15:55285871-55285893 TGGCCCTGCCCAGTTTGCCCAGG + Intronic
1127955419 15:63848661-63848683 TTGACCTGCACAGCTTCCCATGG + Intergenic
1128306817 15:66604198-66604220 TTGACCTGCCCACCTTGCCTGGG - Intronic
1128761147 15:70216785-70216807 GGAACCTGCCCTTCATGCCATGG + Intergenic
1129264453 15:74386458-74386480 GGGACATACCCAGCTTACAATGG - Intergenic
1129604308 15:77017364-77017386 GGCACTTGCCCTGCTTGCCCTGG - Intronic
1132206071 15:99987051-99987073 GGGGCCTGCCCACCTCCCCAAGG + Intronic
1132664404 16:1074983-1075005 GGGATCTGCTCAGCCTGACATGG - Intergenic
1134862819 16:17575667-17575689 AGGCCCTGCCCAGCCTGACATGG + Intergenic
1134866235 16:17609674-17609696 GGGACCTTCCCAACTGACCAGGG + Intergenic
1135986905 16:27190530-27190552 TGGAGCTGCCCACCCTGCCACGG + Intergenic
1136348927 16:29694751-29694773 GGGGCCTGCCCCGCTGACCAAGG - Exonic
1138586103 16:57971321-57971343 GGGACCTGCCCGGCTTACCAGGG + Intergenic
1140473477 16:75227322-75227344 GGCCCCTGCCCAGCTGGCCTGGG + Intergenic
1141660585 16:85439147-85439169 GGGACGTGCCCTGCCTGCCCTGG + Intergenic
1142256141 16:89014748-89014770 GGGACCTGCCCCGCTGGACCGGG + Intergenic
1142288117 16:89179695-89179717 AGGACTCGCCCACCTTGCCAGGG + Intronic
1142302575 16:89267082-89267104 GGGGCGTGCACAGCTGGCCACGG + Intergenic
1142851821 17:2708078-2708100 AGGAGGTGCCCAGCTGGCCAGGG + Intronic
1143722174 17:8820494-8820516 GAGACCTGCCCATCTGGCCCTGG + Intronic
1144772976 17:17770000-17770022 GGGCCCTGCCCAGGGTGACAGGG + Intronic
1147388540 17:40095761-40095783 GTGAGCTGCCCAGCTTGTCATGG + Exonic
1150006966 17:61475992-61476014 GGGACTTGCCCACGTTCCCACGG + Intronic
1150520791 17:65865531-65865553 GGGTCCTGCCCAGCTGTGCAAGG - Intronic
1152245201 17:79181806-79181828 GGGACCTTCCGAGCTGGCCCAGG - Intronic
1152379413 17:79934671-79934693 GGGACCTGCCCAGCCAGCCTTGG + Exonic
1153092024 18:1357927-1357949 GAGAAGTGGCCAGCTTGCCAAGG + Intergenic
1153419306 18:4886310-4886332 GGGACCTGCCAAGCCAGGCATGG + Intergenic
1155191458 18:23434550-23434572 GCGATCTGCCCACCTTGCCTTGG - Intronic
1157434580 18:47657709-47657731 CTGTCCTGCCCAGCTTTCCATGG + Intergenic
1159667676 18:71182590-71182612 GGTACCTGCCCATTTTGGCAAGG + Intergenic
1160408825 18:78660897-78660919 GGGACCTTCTCAACTGGCCATGG - Intergenic
1160554059 18:79714777-79714799 GCGGCCTGCCCAGGGTGCCACGG + Exonic
1160765565 19:806089-806111 GGGACGGGCCCTGCTTGCCGAGG + Intronic
1160798428 19:956228-956250 GGGACAGGACGAGCTTGCCAGGG - Intronic
1161306605 19:3572553-3572575 GGGCCCCGCCCCGGTTGCCATGG - Intronic
1161390840 19:4019444-4019466 GGGAGCCACCCAGCTGGCCAGGG - Intronic
1162078529 19:8205199-8205221 GTCCCCTGCCCAGCTTCCCAGGG - Intronic
1162302179 19:9850220-9850242 GGGACCAGCCCAGATTGCGGGGG + Intergenic
1162409603 19:10497462-10497484 GGGCACTGCCCTGCTTGCCTAGG + Intronic
1162415751 19:10536069-10536091 GGGTCCTTCCTAGCTTCCCATGG + Intergenic
1163380235 19:16961365-16961387 GGGACCCGCCCAGCCAGGCATGG - Intronic
1164061364 19:21678203-21678225 GGGAACTGCCCCGCATGCCGAGG - Intergenic
1164065291 19:21709509-21709531 GGGAACTGCCCCGCATGCCAAGG + Intergenic
1165463464 19:35958402-35958424 GGGCCCTGGCCAGCTGGACAAGG + Intergenic
1165486956 19:36102005-36102027 GGGACCTGCGCATCCTGACAGGG - Exonic
1166179665 19:41098859-41098881 GGGACCTGCCGAGCCAGGCATGG - Intergenic
1166247317 19:41538354-41538376 GGCACCTGCCAAGGTTGCCAGGG + Intergenic
1167262064 19:48464327-48464349 AGGACGTGCCGAGCTGGCCAGGG + Exonic
1167724531 19:51201268-51201290 GGGACCAGCACAGCCTGGCAGGG - Intergenic
1167834115 19:52052533-52052555 AGGACCTGCGCAGCTGGCCCTGG - Intronic
928462646 2:31489413-31489435 GGGACCTGCCCGGCCAGGCATGG - Intergenic
929979276 2:46663743-46663765 GGTACCTGGCCAGGATGCCAGGG + Intergenic
930682881 2:54276205-54276227 GGGTCTTGCACAGCTTGCTAAGG - Intronic
933184153 2:79260121-79260143 TGAAGCTGGCCAGCTTGCCATGG + Intronic
933699388 2:85243836-85243858 GGGAGCTGCCCTGCTAGCCACGG + Intronic
934576761 2:95406867-95406889 AGGATCTGCCCAGCCTGCCCGGG + Intronic
934638980 2:96015035-96015057 AGGATCTGCCCAGCCTGCCCGGG + Intergenic
934794668 2:97090377-97090399 AGGATCTGCCCAGCCTGCCCGGG - Intronic
935088447 2:99870637-99870659 GGAACTTGCCCAGCCTGCCAGGG - Intronic
942952035 2:181731974-181731996 GGGACCTGCCAAGCCAGGCATGG - Intergenic
943820656 2:192315699-192315721 GGGACCTGCCCACTCTGCCCAGG + Intergenic
946389938 2:219409132-219409154 GGGACTTGCCCAGGTAGCCCAGG + Intergenic
948897404 2:240933861-240933883 GGGCCCTGCCCACCCAGCCACGG - Intronic
1168812257 20:711694-711716 GAGGCCTGCCCATCTTCCCAGGG - Intergenic
1169861685 20:10159387-10159409 GGGACCTGCCGAGCCAGGCACGG - Intergenic
1170186175 20:13593552-13593574 GGGACCTGCCGAGCCAGGCATGG - Intronic
1172363559 20:34331990-34332012 GGGACCTGCCCCGTCTGCCTAGG - Intergenic
1172435976 20:34929204-34929226 AAGACCTGCCCACCTTACCAGGG - Intronic
1172995411 20:39066696-39066718 AGCACCTGCCCTGGTTGCCAGGG + Intergenic
1173256133 20:41395405-41395427 TGGACCAGCCCAGCTTGAAAAGG + Intergenic
1174081628 20:47974155-47974177 GGGAGCTGCCCAACCAGCCAGGG - Intergenic
1175575114 20:60055235-60055257 GTGACCTGCCCTGCTGGCCCAGG - Intergenic
1175689284 20:61054067-61054089 GGGGCCTTCCCAGGTGGCCACGG + Intergenic
1175840213 20:62021926-62021948 TGGACCTGCCCTGCTCCCCAGGG - Intronic
1176298790 21:5088699-5088721 GGCACCCTCCCAGCCTGCCAGGG - Intergenic
1176384885 21:6134312-6134334 CGCACCTGCCCAGAATGCCATGG - Intergenic
1177678949 21:24338942-24338964 AGGAGCTGCCCAGGTAGCCAAGG - Intergenic
1178882719 21:36461710-36461732 GGGAGCTGCCCGGCTGGCCTAGG - Exonic
1179738587 21:43403940-43403962 CGCACCTGCCCAGAATGCCATGG + Intergenic
1179858236 21:44173250-44173272 GGCACCCTCCCAGCCTGCCAGGG + Intergenic
1179917695 21:44488384-44488406 GGCACCTGCCAAGGTCGCCAGGG + Intergenic
1181312940 22:21955304-21955326 TGGCCCTGCCCACCTAGCCAGGG - Intergenic
1181346048 22:22221376-22221398 TGGCCCTGCCCACCTAGCCAGGG - Intergenic
1181639763 22:24190338-24190360 AGTACCTGCCCAGCCCGCCAAGG - Intergenic
1181695841 22:24592499-24592521 GGGCCCCTCCCATCTTGCCAGGG + Intronic
1181917940 22:26295888-26295910 GAGACCTTCCCTGATTGCCAAGG - Intronic
1182070660 22:27461523-27461545 GGGTCCTGGCCACCTTGCCTGGG + Intergenic
1183159231 22:36100296-36100318 TGGACGTGCCCAGCCTGCTAAGG - Intergenic
1184084545 22:42252029-42252051 GTGATCTGCCCACCTTGGCAGGG - Intronic
1184362002 22:44024402-44024424 GGGTGCCGCCCAGCTTGCCCAGG - Intronic
949873174 3:8606601-8606623 TGGACCTGCCCACGTTGTCAGGG - Intergenic
950206972 3:11088380-11088402 GGAAACTGCCCGGCTTGCCCAGG + Intergenic
950473255 3:13199442-13199464 GCGAGCTGCCCAGCTTGGAAAGG - Intergenic
950499650 3:13355541-13355563 GGGGCCTGGCCAGGCTGCCATGG - Intronic
950727092 3:14923586-14923608 GGGGCCGGCTCAGCTTCCCAAGG - Intronic
951130184 3:19033441-19033463 GGGATCTAGCCATCTTGCCAAGG - Intergenic
952158770 3:30672221-30672243 GGGAGCTGCCCAGCTTGCGCAGG - Exonic
954537739 3:51374070-51374092 GGGAACAGGCCAGCTTGCAATGG - Intronic
956163697 3:66380654-66380676 GGGTCCTGCCCCGAGTGCCAAGG - Exonic
956183805 3:66544056-66544078 GGGACCTGAGCAGGTTACCAGGG + Intergenic
956373255 3:68586936-68586958 GGGACCTGCTGAGCTAGGCACGG + Intergenic
957917869 3:86709159-86709181 GGGACCTGCCGAGCCCGGCATGG + Intergenic
959045290 3:101467034-101467056 GGGACCTGCCGAGCCAGGCACGG - Intronic
959170838 3:102842074-102842096 GGGACCGGCCCAGCCAGGCACGG + Intergenic
960787696 3:121392194-121392216 GGGACCTGCCAAGCCAGGCATGG + Intronic
961328403 3:126125083-126125105 AGGACCTTCCCAGCATGCCTGGG + Intronic
962137134 3:132746966-132746988 GGGACCTGCCAAGCCAGGCATGG + Intergenic
962513477 3:136126321-136126343 GGGACCTGCCGAGCCAGGCACGG - Intronic
963040600 3:141066846-141066868 GTGGCCTGCCCAGCTTCCCTAGG - Intronic
963063895 3:141247127-141247149 GGCACCTGCCCAGCTGACCCAGG + Intronic
963990338 3:151646100-151646122 GGGATCTGCAGAGCTTGGCACGG - Intergenic
965138075 3:164800542-164800564 AGGACCTTCCCAGCTTCCTAGGG - Intergenic
965660884 3:171040632-171040654 GGGATCTTTCCAGGTTGCCAAGG + Intergenic
966351791 3:179038911-179038933 GGGACCTGCCAAGCCAGGCACGG - Intronic
968522484 4:1040218-1040240 GGCACCTCCCCAGCCTGGCAGGG + Intergenic
969514989 4:7642163-7642185 AGGACCTGGCCTCCTTGCCAAGG + Intronic
969609320 4:8218162-8218184 GGGACCTGCTCAGGTTGCTGGGG + Intronic
969644840 4:8421794-8421816 GGGACCTACCACCCTTGCCAGGG + Intronic
969676265 4:8616118-8616140 GCGAGCTGCCCAGCCTTCCAAGG - Intronic
972492563 4:39601753-39601775 GGGATCTCCCCAGGTTGCCCAGG - Intronic
975219457 4:71797482-71797504 GGGACCTGCCGAGCCAGGCAGGG + Intronic
975744645 4:77464394-77464416 GGGACCTGCCAAGCCAGGCATGG + Intergenic
975751109 4:77524512-77524534 GGGACCTGCCAAGCCAGGCATGG + Intronic
976398100 4:84579566-84579588 GGAATGTCCCCAGCTTGCCAGGG - Intergenic
977771721 4:100868596-100868618 GGGACCTGCCGAGCCAGGCACGG + Intronic
979516576 4:121616549-121616571 GGGACCTGCCGAGCCAGGCACGG - Intergenic
980037824 4:127905295-127905317 GGGACCTGCCAAGCCAGGCATGG + Intergenic
981512680 4:145574668-145574690 GGGACCTGCCAAGCCAGGCATGG - Intergenic
983949096 4:173619028-173619050 GGGACCTGCCGAGCCAGGCATGG + Intergenic
984102217 4:175499739-175499761 GGGACCTGCCCAGGCCCCCAAGG + Intergenic
984127080 4:175824661-175824683 GCGAGGTGCCCAGCTTTCCAGGG + Intronic
985367369 4:189245814-189245836 GGGACCTGCCGAGCCAGGCACGG + Intergenic
985634809 5:1030817-1030839 GGGAGCTGCCCACCCTGCCTTGG + Intronic
985682803 5:1265302-1265324 GGGAGCTGCGCAGCTGGCCGAGG - Intronic
986152135 5:5138575-5138597 GGGACCTGAGCCGGTTGCCACGG - Intergenic
988093314 5:26569564-26569586 GGGGCCTTCCCAGGTTCCCAAGG + Intergenic
989815250 5:45728882-45728904 GGAACTTCCCTAGCTTGCCATGG - Intergenic
994210648 5:97084795-97084817 GGGACCTGAGCAGGTTGCCTGGG + Intergenic
995764514 5:115601622-115601644 AGGACCTCTCCAGCTTTCCACGG - Intronic
997571929 5:134936227-134936249 GGAACCTGCACAGCAAGCCAGGG - Intronic
997668115 5:135648576-135648598 GGGACCTGCCCAGGCTCACATGG - Intergenic
999730103 5:154470559-154470581 GGGACTTGCCCAGCATCTCAGGG - Intergenic
999737470 5:154523454-154523476 GGGGGCTCCCCAGCTAGCCAAGG + Intergenic
1000574760 5:162964481-162964503 GGGACCTGCCGAGCCAGGCACGG + Intergenic
1002465447 5:179406062-179406084 GGGACCTGTCCAGCTTCCCCAGG - Intergenic
1003221590 6:4165283-4165305 GGGCCCTGCCAGGCTTGCCTGGG + Intergenic
1003496556 6:6668478-6668500 GGGACCTGCCGAGCCAGGCACGG - Intergenic
1006421290 6:33935707-33935729 GGGAGCTGCCCTCCTGGCCAGGG + Intergenic
1006434636 6:34019857-34019879 GGGACCTGCCCTGATGCCCATGG - Intronic
1006603505 6:35241212-35241234 TGTACCTGCCCAGCAGGCCAGGG + Exonic
1007421103 6:41720314-41720336 GGGATATCCCCAGCCTGCCATGG + Intronic
1007693624 6:43718240-43718262 CCGGCCTGCCCAGCTTGCCCCGG + Intergenic
1009988120 6:70806300-70806322 GGGACCTGCCAAGCCAGGCACGG + Intronic
1010961513 6:82151243-82151265 GGGACCTGCCAAGCTAGGCATGG - Intergenic
1011277060 6:85642311-85642333 GGGACCTGCACAGCGCGCCACGG - Intronic
1012033475 6:94102097-94102119 GTGATCTGCCCACCTTGCCTTGG - Intergenic
1012088883 6:94866268-94866290 GGGAGCTGCCCAGCATGGCAGGG + Intergenic
1015124199 6:129734684-129734706 AGGACCTTACCAGCTTGACATGG + Intergenic
1015803430 6:137084247-137084269 GGGTCCTGCCCAGGCTGCCCTGG + Intergenic
1016584912 6:145673626-145673648 GGGACCCGCCGAGCTAGGCACGG - Intronic
1017959580 6:159210107-159210129 GGCACATGCACATCTTGCCAGGG + Intronic
1018199296 6:161380261-161380283 GGGACCTGGCCAGTTCTCCACGG - Intronic
1021005799 7:15393240-15393262 GGGACCTGCCCTTCTTGGAAAGG + Intronic
1021100108 7:16578232-16578254 GTGATCTGCCCGCCTTGCCAAGG - Intronic
1021282699 7:18740062-18740084 GGGACCTGCCAAGCCAGGCACGG + Intronic
1021755213 7:23844872-23844894 GGGACCTGCCGAGCCAGGCATGG - Intergenic
1022473442 7:30695298-30695320 GGGAGCTGCCCAGGAGGCCAAGG - Intronic
1023271218 7:38464878-38464900 GTGACCTGTCTACCTTGCCAGGG - Intronic
1023283025 7:38591144-38591166 GGGAACTGGAGAGCTTGCCATGG - Intronic
1024075462 7:45815720-45815742 GGAAACTGCCCAGCTTTCCCCGG + Intergenic
1024264780 7:47598225-47598247 GGCACCTGCCAAGTTTGCCGGGG + Intergenic
1024591273 7:50887177-50887199 GGGACCTGCCGAGCCAGGCATGG - Intergenic
1027123127 7:75536584-75536606 GGCACATGAACAGCTTGCCAGGG - Exonic
1028340930 7:89719029-89719051 GGGACCTGCCAAGCCAGGCATGG - Intergenic
1028396037 7:90369611-90369633 GGGACCTGCTCAGCCAGGCACGG + Intronic
1029734003 7:102455569-102455591 GGGGCCAGCCCAGCCTGTCAGGG + Exonic
1031980791 7:128123035-128123057 CGGACCTGCCCTGCTTTCTAAGG + Intergenic
1034467524 7:151238624-151238646 GGGCCGTGCCCAGCTGGCTATGG + Exonic
1034970974 7:155418909-155418931 GGGACGTGCCCAGCTCCACAGGG - Intergenic
1039680951 8:39735681-39735703 GGGACCTGCCGAGCCAGGCATGG - Intergenic
1039823434 8:41153846-41153868 GGGACATGAAGAGCTTGCCATGG - Intergenic
1039832372 8:41225327-41225349 GGGACCTGCCGAGCCAGGCACGG - Intergenic
1042781364 8:72494616-72494638 TGGAACTGCCCAGCTATCCAGGG - Intergenic
1044615627 8:94137432-94137454 GGGACCTGCCAAGCCAGGCACGG + Intronic
1047494448 8:125399554-125399576 GGGACCTGCCCAGGGTCACACGG - Intergenic
1049291862 8:141807568-141807590 GGGGACTGCCCTGCCTGCCATGG - Intergenic
1049795150 8:144493789-144493811 GGAACCTGCCCAGAGTCCCATGG + Intronic
1050237060 9:3593069-3593091 TAGACCTGCCCAGCTTCCGAAGG - Intergenic
1050386993 9:5101232-5101254 GGGACCTGCCAAGCCAGACATGG - Intronic
1056771519 9:89481197-89481219 GGGACGTGCCCACCTGGCCTTGG + Intronic
1057401351 9:94726420-94726442 GGGGCCTCCCCAGGTTGCCCAGG + Intergenic
1058536419 9:105964944-105964966 GAGTCCTGCCCATCTTGCCCAGG + Intergenic
1059231022 9:112721718-112721740 GTGACCTGCCCACCTTGGCCCGG + Intergenic
1059392044 9:114005511-114005533 GGGTCAGGCCCAGCTGGCCAGGG + Intronic
1060207861 9:121693189-121693211 GGGACCTGCCCAGCGTCACCAGG - Intronic
1060431135 9:123552276-123552298 GGGTTCTGCCCATCTTCCCAGGG + Intronic
1060979293 9:127783455-127783477 GGGCCCTGCCCATCTGGCCTAGG - Intergenic
1062549560 9:137079711-137079733 GGGACCTGCCCTGGTGCCCAGGG + Intronic
1185689330 X:2140214-2140236 GGGACCTCTTCAGCTAGCCATGG - Intergenic
1186866429 X:13724951-13724973 GGGACCTGCCGAGCCAGGCATGG - Intronic
1187445759 X:19359521-19359543 GGATGCTGCCCAGTTTGCCACGG + Exonic
1189596044 X:42566548-42566570 GGTACCTGACCATCTTACCAAGG + Intergenic
1189978468 X:46486183-46486205 GGGACCTGCCGAGCCAGGCATGG + Intronic
1191002379 X:55674170-55674192 GGGACCTGCCAAGCCAGGCATGG + Intergenic
1191886566 X:65894472-65894494 GGGACCTGCCGAGCCAGGCATGG + Intergenic
1192371857 X:70520929-70520951 GGGACCTGCCGAGCCAGGCACGG + Intergenic
1192406414 X:70890555-70890577 GGGACCTGCCAAGCCAGGCATGG - Intronic
1192949139 X:75997920-75997942 GGGACCTGCCAAGCCAGGCATGG + Intergenic
1193640965 X:84009148-84009170 GGGACCTGCCGAGCCAGGCACGG - Intergenic
1194994662 X:100578598-100578620 AGGAGCTGGCCAGCTGGCCAGGG - Intergenic
1195787269 X:108540687-108540709 GTGATCTGCCCACCTTGGCAGGG + Intronic
1196094515 X:111784771-111784793 GGGACCTGCCAAGCCAGGCACGG - Intronic
1196963761 X:121032701-121032723 GGGATCTTCCCAGCTTGCAGAGG + Intergenic
1199695215 X:150339148-150339170 GTGACCTGTGCTGCTTGCCAGGG - Intergenic