ID: 915601207

View in Genome Browser
Species Human (GRCh38)
Location 1:156924265-156924287
Sequence CACTCGCGCCTCTGCTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915601207_915601217 18 Left 915601207 1:156924265-156924287 CCAACCCAGCAGAGGCGCGAGTG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 915601217 1:156924306-156924328 GCAGGCCGGCGCCTCCCCTCTGG 0: 1
1: 1
2: 2
3: 26
4: 209
915601207_915601218 21 Left 915601207 1:156924265-156924287 CCAACCCAGCAGAGGCGCGAGTG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 915601218 1:156924309-156924331 GGCCGGCGCCTCCCCTCTGGCGG 0: 1
1: 1
2: 0
3: 24
4: 185
915601207_915601213 0 Left 915601207 1:156924265-156924287 CCAACCCAGCAGAGGCGCGAGTG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 915601213 1:156924288-156924310 GCCGGAGAGGCAGAGTCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 194
915601207_915601215 4 Left 915601207 1:156924265-156924287 CCAACCCAGCAGAGGCGCGAGTG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 915601215 1:156924292-156924314 GAGAGGCAGAGTCCGCAGGCCGG 0: 1
1: 0
2: 0
3: 32
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915601207 Original CRISPR CACTCGCGCCTCTGCTGGGT TGG (reversed) Intronic
900095690 1:939263-939285 CAGCAGCGCCTCTGCTGGGGAGG - Exonic
900589149 1:3452079-3452101 CAGAGACGCCTCTGCTGGGTGGG - Intergenic
901047354 1:6405220-6405242 GGCTCCGGCCTCTGCTGGGTGGG - Intergenic
901209501 1:7516454-7516476 CACACGCCCCTCTGCTGGCTGGG + Intronic
902414107 1:16228955-16228977 CCCTTCCGCCTCTGGTGGGTGGG - Intergenic
902653806 1:17853888-17853910 CACAAGAGCTTCTGCTGGGTGGG + Intergenic
904941202 1:34165832-34165854 CACACGCCCCTCTCCTGGGATGG - Intronic
905313812 1:37068377-37068399 CACGGGTGCTTCTGCTGGGTTGG + Intergenic
908581800 1:65525068-65525090 CATTCGCGCATCTGGTGGGTGGG - Intronic
909513602 1:76482881-76482903 CACCCGGGCCTCTGGTGGGGTGG - Intronic
911724025 1:101222458-101222480 CAGTCCTGGCTCTGCTGGGTTGG - Intergenic
915601207 1:156924265-156924287 CACTCGCGCCTCTGCTGGGTTGG - Intronic
920600686 1:207321430-207321452 CACTCTCTCCACTGCTGGGTGGG - Intergenic
1064016833 10:11779424-11779446 CCCTTGCCCCTCTCCTGGGTTGG - Intergenic
1070653995 10:78258502-78258524 CACTTGAGCCTCAGCTGGGGTGG - Intergenic
1072582771 10:96753984-96754006 CACTCTCTCCTCTGTTCGGTGGG + Intergenic
1075857589 10:125643225-125643247 CACTAGCTCCTCTTCTGGGTAGG - Intronic
1077227972 11:1446649-1446671 CTCTGGAGCCTCTGCTGGGTGGG + Intronic
1077902149 11:6498092-6498114 CTCTGGCCCCTCTGCTGGGCTGG + Exonic
1080651078 11:34223179-34223201 CACTCGGTCCTCGGCTGTGTTGG - Intronic
1083625759 11:64071268-64071290 CACACAGGCCTGTGCTGGGTGGG - Intronic
1085413635 11:76306325-76306347 CACACTGGCCTCTGCTTGGTAGG + Intergenic
1089499726 11:118925180-118925202 TCCTCGCGCCTCTGCTGGCCTGG + Intronic
1090228508 11:125085583-125085605 CTCTGGGGCCTCTGCTGGCTGGG + Exonic
1097036802 12:56129504-56129526 GACTGGCACCTCTGCTGGGAGGG - Intronic
1099934298 12:89107362-89107384 CACTGTAGCCTCTGCTGCGTGGG + Intergenic
1103290646 12:119843425-119843447 CAGTCTTGCCTCTGCTGTGTGGG - Intronic
1104557610 12:129815515-129815537 CAGTCGGGCCCCTGCAGGGTGGG - Intronic
1104633381 12:130423354-130423376 ATCTCGCACCTCTCCTGGGTGGG + Intronic
1106458617 13:29948919-29948941 CACTCGCTCCTCTGCTGGTGGGG - Intergenic
1113935246 13:113990503-113990525 GACTCTGGCCTCTGCTGTGTCGG + Intronic
1126837305 15:52679628-52679650 CAGGCGCGCCTCTGCCGGCTGGG - Intronic
1128636490 15:69305698-69305720 CTCTCCCTCCTCTGCTTGGTGGG - Intronic
1130295049 15:82640969-82640991 CACTCTTACCTCTGCTGTGTTGG - Intronic
1132676952 16:1124863-1124885 CACTCAGGACCCTGCTGGGTGGG - Intergenic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132862483 16:2078405-2078427 CAGGCCGGCCTCTGCTGGGTGGG + Intronic
1135662072 16:24305631-24305653 CACTGGGGCCTGTCCTGGGTGGG + Intronic
1141445100 16:84052532-84052554 CACCCTCGCCTTTGCTGTGTGGG + Intergenic
1143097894 17:4488226-4488248 CTCTCGTGCCTCTGCTGGAGGGG + Intergenic
1148354973 17:46969484-46969506 CTCTGGCCCCTCTGCAGGGTGGG - Intronic
1152078200 17:78171323-78171345 CACTCGGGCCTTGGCAGGGTGGG - Intronic
1152659292 17:81535006-81535028 CCCTCACGCCTCTCCTGGGTAGG - Intronic
1152716388 17:81902644-81902666 CGCTCGCACCTCTGCAGGTTTGG - Exonic
1157582255 18:48780539-48780561 CACACGCACCTCTGCCGCGTCGG + Intronic
1163032391 19:14553190-14553212 CGCTCGGGGCTCTGCTGGATGGG + Intronic
1163269014 19:16238644-16238666 GACTGGGGCCTCTGCTGTGTTGG + Intronic
1168561698 19:57389981-57390003 CACTCCCGCCTCTCCGTGGTGGG - Exonic
925696311 2:6583534-6583556 CACTCCCTCCTCTGCTGGCGTGG - Intergenic
926075281 2:9937968-9937990 CACTGGTGCTTCTGCTGGCTGGG + Intergenic
931161314 2:59694156-59694178 GACTCAGGCCTCTGCTGGGGTGG + Intergenic
933131712 2:78681109-78681131 CATTGGCTCCTGTGCTGGGTAGG - Intergenic
934532147 2:95098672-95098694 CACTGGGGCCTGTGGTGGGTTGG + Intronic
937802152 2:126092494-126092516 CACTGGAGCCTCAGCTGGGGTGG - Intergenic
941066071 2:160904276-160904298 CACTTAGGCCTCTGCAGGGTAGG + Intergenic
948208790 2:236177749-236177771 CGCGAGCGCCTCTACTGGGTGGG + Intergenic
948965056 2:241372753-241372775 CTCTCTTGCCTCTGCTGGGTGGG + Intronic
949050126 2:241893331-241893353 CACTGGGGCCTCGGCTGGCTGGG - Intergenic
1171420795 20:25016190-25016212 CACTTGAACCTCAGCTGGGTGGG - Intronic
1174386095 20:50189451-50189473 CTTGCCCGCCTCTGCTGGGTAGG - Intergenic
1180064676 21:45406186-45406208 CCCCCGGGCCTCTGCTGGGCTGG - Intronic
1180181249 21:46119580-46119602 CCCTCGTCCCTCTGCTGCGTCGG - Intronic
1180243737 21:46531258-46531280 CACTCACGGCTCTCCTGAGTGGG + Intronic
1183742962 22:39678593-39678615 CACTGGGGGCTCTGCAGGGTGGG - Intronic
952341537 3:32451524-32451546 CCCTCACAACTCTGCTGGGTGGG - Intronic
969935852 4:10680352-10680374 CACTGGGGCCTGTGGTGGGTTGG + Intronic
976991791 4:91376905-91376927 CACTGGGGCCTGTCCTGGGTGGG - Intronic
982438341 4:155402902-155402924 CACAAGGGCCTCTGCTGAGTAGG - Intergenic
988758506 5:34286836-34286858 CAATCTCGCCTCAGCTGTGTAGG + Intergenic
995188973 5:109300525-109300547 GACTCACACCTCTTCTGGGTGGG + Intergenic
995598418 5:113771737-113771759 CACCCTAGCCTCTGCTTGGTTGG - Intergenic
998388901 5:141774340-141774362 TGTTCGCGGCTCTGCTGGGTGGG - Intergenic
999298003 5:150472642-150472664 CACTCTTGCCTTTGCTGGGAAGG - Intergenic
1000625773 5:163536470-163536492 TACTGGCGCCTGTGGTGGGTGGG - Intergenic
1003874885 6:10426360-10426382 CGCTCGGGCCTCTGCCGGGAGGG + Intergenic
1005841873 6:29749010-29749032 CCTTCGCGGCTCCGCTGGGTTGG - Intergenic
1006752566 6:36387810-36387832 CACTTGCGCCGCTGCGGGCTAGG + Intergenic
1008356323 6:50558116-50558138 CACTTGCTTCTCTGCTGGCTTGG + Intergenic
1011212398 6:84968274-84968296 CACTCCCCCATCAGCTGGGTCGG + Intergenic
1023882725 7:44329667-44329689 CACCCCCCCCTCTGCTGGCTGGG + Intronic
1023894158 7:44418200-44418222 CATTCCTGCCTCGGCTGGGTAGG - Intronic
1026937109 7:74263915-74263937 TCCACGCCCCTCTGCTGGGTAGG + Intergenic
1032463997 7:132132146-132132168 CACACACGACACTGCTGGGTAGG - Intronic
1034959175 7:155353734-155353756 CACTTGAGCCTCTCCTGTGTGGG - Intergenic
1035844720 8:2850786-2850808 CACTCGTGCCTGTGCTGCTTGGG + Intergenic
1036771192 8:11579270-11579292 CACTCTCCCCACTGCTGGGAGGG + Intergenic
1040707599 8:50148556-50148578 CACTGGGGCCTGTTCTGGGTTGG - Intronic
1041197084 8:55410972-55410994 CACTCGTGCCTCTGCCAGGAAGG + Intronic
1041451448 8:58010718-58010740 CACTCCCAGCTCTGCTGGTTTGG + Intronic
1044667094 8:94641869-94641891 CCCTCGCTCCCCTGCTGGGGCGG - Intronic
1055630668 9:78220274-78220296 CACTCTGGCGTCTGCTGAGTAGG + Intergenic
1060592768 9:124829390-124829412 CACTCCAGCCTCGGGTGGGTGGG - Intergenic
1061850289 9:133410911-133410933 CACTCACGCCCTTGCTGTGTTGG - Intronic
1061943178 9:133893839-133893861 GACTCTCGCCGCTGCTGTGTGGG - Intronic
1186048002 X:5557040-5557062 CACTGACTCCTCTGCTGGGTTGG - Intergenic
1187247818 X:17568821-17568843 CACTGGGGCCTCTGTGGGGTGGG - Intronic
1195998866 X:110759911-110759933 CACCAGCACCTCTGCTGGGTTGG + Intronic
1196482848 X:116170030-116170052 CACTCTTGCTTCTGCTGGATTGG + Intergenic
1198648057 X:138831045-138831067 CACTTGGGCCACAGCTGGGTTGG - Intronic
1199377147 X:147126669-147126691 CACTGGCGCCTGTCCGGGGTTGG - Intergenic
1200142961 X:153910829-153910851 CACTCGCCCATCTGCAGGGGAGG - Exonic
1201699485 Y:16864740-16864762 CACTGGCGCCTGTTGTGGGTGGG + Intergenic