ID: 915601510

View in Genome Browser
Species Human (GRCh38)
Location 1:156925492-156925514
Sequence CCTCACATCCATAAAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 127}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915601510_915601515 -10 Left 915601510 1:156925492-156925514 CCACCCACTTTATGGATGTGAGG 0: 1
1: 0
2: 0
3: 13
4: 127
Right 915601515 1:156925505-156925527 GGATGTGAGGCAGGAAGACCTGG 0: 1
1: 0
2: 7
3: 51
4: 510
915601510_915601523 28 Left 915601510 1:156925492-156925514 CCACCCACTTTATGGATGTGAGG 0: 1
1: 0
2: 0
3: 13
4: 127
Right 915601523 1:156925543-156925565 AGGTGGTACTGAGCTGAAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 206
915601510_915601520 11 Left 915601510 1:156925492-156925514 CCACCCACTTTATGGATGTGAGG 0: 1
1: 0
2: 0
3: 13
4: 127
Right 915601520 1:156925526-156925548 GGAAGACTGCCTGGAGGAGGTGG 0: 2
1: 33
2: 241
3: 634
4: 1555
915601510_915601519 8 Left 915601510 1:156925492-156925514 CCACCCACTTTATGGATGTGAGG 0: 1
1: 0
2: 0
3: 13
4: 127
Right 915601519 1:156925523-156925545 CCTGGAAGACTGCCTGGAGGAGG 0: 2
1: 10
2: 56
3: 312
4: 1298
915601510_915601517 5 Left 915601510 1:156925492-156925514 CCACCCACTTTATGGATGTGAGG 0: 1
1: 0
2: 0
3: 13
4: 127
Right 915601517 1:156925520-156925542 AGACCTGGAAGACTGCCTGGAGG 0: 1
1: 1
2: 6
3: 58
4: 381
915601510_915601516 2 Left 915601510 1:156925492-156925514 CCACCCACTTTATGGATGTGAGG 0: 1
1: 0
2: 0
3: 13
4: 127
Right 915601516 1:156925517-156925539 GGAAGACCTGGAAGACTGCCTGG 0: 1
1: 0
2: 5
3: 33
4: 271
915601510_915601522 25 Left 915601510 1:156925492-156925514 CCACCCACTTTATGGATGTGAGG 0: 1
1: 0
2: 0
3: 13
4: 127
Right 915601522 1:156925540-156925562 AGGAGGTGGTACTGAGCTGAAGG 0: 1
1: 0
2: 2
3: 25
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915601510 Original CRISPR CCTCACATCCATAAAGTGGG TGG (reversed) Intronic
908565641 1:65353199-65353221 CCTCAACTCCAGAAAGTGAGGGG - Intronic
910462465 1:87463114-87463136 CCTCACATCCATAAGGATGGTGG + Intergenic
915589313 1:156861566-156861588 CCTCATAACAAGAAAGTGGGCGG - Intronic
915601510 1:156925492-156925514 CCTCACATCCATAAAGTGGGTGG - Intronic
917756270 1:178101948-178101970 CAAAACATCCATAAAGTAGGAGG + Intronic
921294483 1:213689166-213689188 TCTAACATCCAGAAAGAGGGAGG - Intergenic
924906046 1:248453525-248453547 GCTCACCACCATAATGTGGGAGG - Exonic
924921844 1:248638512-248638534 GCTCACCACCATAATGTGGGAGG + Exonic
1063260713 10:4386330-4386352 CCACTCAACCATAAAGTGGAGGG - Intergenic
1065195901 10:23265224-23265246 CCTCATATCCACAGAGCGGGAGG - Intergenic
1067147987 10:43707343-43707365 TCTCACACCTAGAAAGTGGGAGG + Intergenic
1067606287 10:47666206-47666228 CCTCCCAACAAAAAAGTGGGAGG - Intergenic
1071621846 10:87127559-87127581 CCTCCCAACAAAAAAGTGGGAGG - Intronic
1071672175 10:87618918-87618940 CCTCAGAAACACAAAGTGGGAGG - Intergenic
1074110306 10:110417901-110417923 GCCCACAGCCATGAAGTGGGAGG - Intergenic
1075090959 10:119444018-119444040 CCTCACATCCAGCCTGTGGGGGG + Intronic
1079074447 11:17375095-17375117 CCTCACATAAATAATGTGGCAGG + Exonic
1080315712 11:30945868-30945890 CCACCCATCCATTAGGTGGGTGG + Intronic
1083947327 11:65931440-65931462 CCTGTCATCCAGGAAGTGGGAGG - Intergenic
1084563139 11:69915159-69915181 CCTCACTTACACAAACTGGGTGG + Intergenic
1085546482 11:77323030-77323052 CCTCATATCCATGAATTGGGAGG + Exonic
1086251135 11:84815761-84815783 GCTCACATCTATTAACTGGGAGG + Intronic
1091790932 12:3271766-3271788 TCTCACAGCCATAAAGGGAGAGG - Intronic
1092076058 12:5674507-5674529 TCTCACATACAGAAAGTGGCTGG + Intronic
1093094358 12:14955772-14955794 ACACACATCCATAAAATAGGAGG - Intronic
1093925943 12:24908484-24908506 CCTCACCCTCCTAAAGTGGGGGG - Intronic
1094226348 12:28050622-28050644 CCCCACATCCCTAGGGTGGGAGG + Intergenic
1094609530 12:31979890-31979912 ACTGACCTCCATAAAGTGGTGGG - Intronic
1100573856 12:95870800-95870822 CCCTACATCCATAAAGTAGTAGG + Intronic
1100758339 12:97777100-97777122 CCTGACATTCCTAAGGTGGGCGG - Intergenic
1101438931 12:104688350-104688372 CTTCCCATCTATAAAATGGGTGG - Intronic
1102705638 12:114877989-114878011 CCTCACATCAATAAAGTTCAAGG - Intergenic
1102716330 12:114976202-114976224 CTTCCCATCTGTAAAGTGGGAGG - Intergenic
1104561431 12:129848818-129848840 CAACACATCCCTGAAGTGGGAGG + Intronic
1106452324 13:29894377-29894399 CCTTACATGCAGAAAGTGGCTGG - Intergenic
1106509785 13:30402884-30402906 CATCCCATCCAGAAGGTGGGTGG + Intergenic
1109209788 13:59521706-59521728 CCCCAACTCCATAATGTGGGTGG + Intergenic
1112339526 13:98541507-98541529 CATCAGAGCCAGAAAGTGGGAGG + Intronic
1114587184 14:23825772-23825794 TCTGACACCCATAATGTGGGTGG + Intergenic
1119151420 14:72363234-72363256 ATTCACATCCATGAAGTGGATGG + Intronic
1120354811 14:83418225-83418247 TCTCACATTCATGGAGTGGGTGG - Intergenic
1124470392 15:29979177-29979199 ACTACCATCCATAATGTGGGTGG - Intergenic
1125351594 15:38773293-38773315 CCTCTCATCAATAAAATGGGAGG - Intergenic
1129032521 15:72629303-72629325 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129407291 15:75328051-75328073 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129470477 15:75750914-75750936 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG + Intergenic
1129841064 15:78743767-78743789 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1133849357 16:9487628-9487650 GCTAACATGCATAAAGTGTGAGG - Intergenic
1134476374 16:14577582-14577604 CCTCACCTTCACAAAGTGGTGGG + Intronic
1135840065 16:25868165-25868187 CCTCACTTCCTTCAGGTGGGAGG - Intronic
1135976825 16:27113877-27113899 CCACACCTCCATAAAGAGGGAGG + Intergenic
1140716351 16:77728841-77728863 CCTGAAAACTATAAAGTGGGTGG - Intronic
1142233991 16:88912857-88912879 CCCCTCATCCATTAAGTGGGAGG + Intronic
1142898241 17:2995937-2995959 CTTCTCATCTATAAAATGGGGGG + Intronic
1145216973 17:21060157-21060179 CCACAGAGCCATAAAGGGGGAGG + Intergenic
1145879137 17:28341278-28341300 CATCACATCCCTAAAGGAGGAGG + Exonic
1147450067 17:40498923-40498945 CTTCACATCCAGAAAGATGGTGG + Intronic
1148085874 17:44993551-44993573 CCTCACAACAATATAGTGGCAGG + Intergenic
1148772110 17:50073379-50073401 CTCCTCATCTATAAAGTGGGGGG + Intronic
1149583592 17:57768813-57768835 CCTCACAGCCATACAGCGAGAGG + Intergenic
1153071432 18:1110088-1110110 CCTCCCACCTATAAAATGGGAGG - Intergenic
1158665383 18:59428068-59428090 CATTACCTCCATAATGTGGGTGG + Intergenic
1161273751 19:3404369-3404391 CCTCACATCCCTGGAGTGGCTGG + Intronic
1162248838 19:9425702-9425724 ACTCCCATCCCTAAATTGGGTGG + Intronic
1163741461 19:19016272-19016294 GCTCACACCTATAAGGTGGGTGG - Intronic
1164880645 19:31730027-31730049 CTTCCCATCTATAAAGTGGGTGG + Intergenic
926128437 2:10285899-10285921 CCTCACAGCCCTCGAGTGGGCGG - Intergenic
928167593 2:28982029-28982051 CCACACAGCCAGAAAGAGGGGGG - Intronic
929432033 2:41895349-41895371 CCTCATTTCCATATAGAGGGTGG - Intergenic
930022927 2:47012338-47012360 CCTGATATCCATCATGTGGGAGG - Intronic
932569793 2:72932589-72932611 CCTCTCATGCATAATCTGGGAGG - Intronic
932877862 2:75472418-75472440 ACTCACATCCTTTAAGTGGAAGG - Intronic
936606607 2:113963882-113963904 CTTCACCTCTATAAAGTGGGAGG + Intergenic
938510821 2:131941460-131941482 CTTCACAACAATAAAATGGGTGG - Intergenic
941417504 2:165240232-165240254 CCTCACATCCATACTGGGGGAGG - Intronic
943166940 2:184340894-184340916 CCTCACATCCAAAATTTGGATGG + Intergenic
945923763 2:215782753-215782775 CCTCTCAGCCATTAACTGGGTGG + Intergenic
946460327 2:219863173-219863195 CCCCACAACTAGAAAGTGGGAGG + Intergenic
949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG + Intergenic
1168859908 20:1038654-1038676 CTTCACATCTGTGAAGTGGGGGG - Intergenic
1169249191 20:4047116-4047138 TTTCTCATCCATAAAATGGGTGG + Intergenic
1169543908 20:6631073-6631095 ATTCACAGCCATAATGTGGGAGG + Intergenic
1172744556 20:37196628-37196650 CCTCACCTTCATAAAGTGTTAGG + Intronic
1179722921 21:43325539-43325561 CCTCTCATCTGTAAAGTGGGTGG + Intergenic
1183429466 22:37757005-37757027 CCTCACATCCATCCTGTGAGAGG + Intronic
1183688792 22:39376641-39376663 CTTCCCATCCATAAAATGAGAGG + Intronic
1185155608 22:49191784-49191806 CCTCACACCCAGAACCTGGGTGG - Intergenic
950651452 3:14409820-14409842 GTCCTCATCCATAAAGTGGGTGG - Intronic
953591709 3:44262923-44262945 CCTCACATGCAAAATGAGGGTGG - Intronic
954207535 3:49071426-49071448 CCAAACACCCACAAAGTGGGTGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
957051134 3:75413092-75413114 CTACACATCCTCAAAGTGGGCGG - Intergenic
960166706 3:114410846-114410868 CCTCTCCTCCAGAAAATGGGCGG - Intronic
963336322 3:143977816-143977838 CCTCAAGTCCAAAAAGGGGGTGG + Intronic
965984339 3:174733873-174733895 CACCACATCCAGAAAGTGAGAGG - Intronic
966086926 3:176079493-176079515 CCCCACATCCACTAAGTGGCTGG - Intergenic
967183582 3:186927506-186927528 CCTCACATGTATAGACTGGGAGG + Intergenic
967936850 3:194735660-194735682 CATCAAAAACATAAAGTGGGAGG - Intergenic
969252629 4:5979480-5979502 ACACACATTCAGAAAGTGGGTGG + Intronic
969596388 4:8151608-8151630 CCTCACACCCAAACAGTGGGCGG + Intronic
971258230 4:25032416-25032438 GTTCCCATCCATAAAATGGGAGG - Intergenic
972115760 4:35631686-35631708 ACTAACATCGAAAAAGTGGGTGG + Intergenic
976908072 4:90264256-90264278 CCTCACTTTCATAAATTGAGTGG + Intronic
977898486 4:102391959-102391981 CCTTACCTCCATTAAGTGGGTGG + Intronic
981016316 4:139978020-139978042 CCTCCCATCAGTAAAGTGAGAGG - Intronic
983539914 4:168898267-168898289 CCTATCATCCAAAAAGAGGGGGG - Intronic
985556060 5:558558-558580 ACTCACACCCTTAAAGTGGCAGG - Intergenic
986010814 5:3713438-3713460 CCTCACATCTAAAATGTGGGTGG - Intergenic
989791066 5:45402481-45402503 CCTCACAACAAAAAATTGGGAGG + Intronic
990976221 5:61564189-61564211 CCTTTCATCTATAAAGTGAGAGG - Intergenic
992907692 5:81362484-81362506 CCACACGTCCATGAAGTTGGAGG + Intronic
993187346 5:84636440-84636462 CCTAACATCCATAGGGTGGGTGG - Intergenic
997683218 5:135770750-135770772 CCTAATATCCATAATGTGAGAGG + Intergenic
1006933672 6:37702774-37702796 CTTCACATCTATAAAATGGAGGG - Intergenic
1009228290 6:61036918-61036940 CCTAATATCCAGAAAGTGAGAGG - Intergenic
1014257203 6:119173251-119173273 GTTCTCATCCATAAAATGGGAGG - Intergenic
1017039182 6:150294225-150294247 CCTCACCTCCATTACCTGGGAGG + Intergenic
1019541518 7:1553792-1553814 CCTCCCATGTATAAAGTGAGGGG + Intronic
1025665313 7:63580173-63580195 CCTCACATCGATAATCTAGGAGG + Intergenic
1027237091 7:76304430-76304452 ACTCACATCCATAAAGACAGAGG + Intergenic
1032116801 7:129124499-129124521 TCTCACATCCATATAGGGGTAGG - Intergenic
1033147997 7:138887600-138887622 CCTCTCTTCTGTAAAGTGGGAGG - Intronic
1036724154 8:11204313-11204335 CCTCAAAACTTTAAAGTGGGGGG + Intergenic
1040522922 8:48193336-48193358 GGGCACATCCAGAAAGTGGGGGG - Intergenic
1045924611 8:107570176-107570198 CCTAATATCCAAAAAGTGAGAGG + Intergenic
1048360011 8:133689609-133689631 CCTCAGATTTGTAAAGTGGGGGG + Intergenic
1048443645 8:134477818-134477840 CCTCACCTCCTTAGAATGGGAGG + Exonic
1049443241 8:142618694-142618716 CTTTCCATCCGTAAAGTGGGTGG + Intergenic
1057745604 9:97748577-97748599 CTCCACATCCATAAAATGAGAGG - Intergenic
1060929335 9:127479109-127479131 CCTCACATGCCTCAGGTGGGTGG + Intronic
1060929574 9:127480243-127480265 CTTCCCATCTATAAAGTGAGTGG + Intronic
1185552057 X:990330-990352 CATGACATCCATAGAGTGCGTGG - Intergenic
1185811857 X:3118023-3118045 CCTCAGATGGATAAAGTAGGTGG - Intergenic
1186058666 X:5679958-5679980 CCTCACATTCCTAAAGTGTTGGG - Intergenic
1187189865 X:17023851-17023873 GCTCACACCCATAGATTGGGTGG - Intronic
1200181083 X:154151074-154151096 CCTCACATCCATATACTGAAGGG + Intronic
1200186728 X:154188188-154188210 CCTCACATCCATATACTGAAGGG + Intergenic
1200192379 X:154225326-154225348 CCTCACATCCATATACTGAAGGG + Intronic
1200198134 X:154263130-154263152 CCTCACATCCATATACTGAAGGG + Intronic
1201269436 Y:12240334-12240356 CCTCAGATGGATAAAGTAGGTGG + Intergenic