ID: 915602204

View in Genome Browser
Species Human (GRCh38)
Location 1:156929494-156929516
Sequence CAGAGGTGGTGGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1226
Summary {0: 1, 1: 0, 2: 9, 3: 123, 4: 1093}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915602192_915602204 19 Left 915602192 1:156929452-156929474 CCTGGGTGCTGGACGGACAGGGG 0: 1
1: 0
2: 1
3: 18
4: 253
Right 915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG 0: 1
1: 0
2: 9
3: 123
4: 1093

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915602204 Original CRISPR CAGAGGTGGTGGAGGGAAGA AGG Intronic
900149096 1:1170533-1170555 GAGAGGAGGAGGAGGGAGGAGGG - Intergenic
900476190 1:2877479-2877501 CAGAGATGGTGTTGAGAAGATGG + Intergenic
900483410 1:2910250-2910272 CAGAGCTGGTGGAGCCAGGAAGG - Intergenic
900484157 1:2913637-2913659 CAGGGGTGGTGGGAGGAAGGCGG - Intergenic
900565295 1:3329085-3329107 CAGAGGTGGTGAGTGGAAGAGGG - Intronic
900700796 1:4047538-4047560 CAGAGATGGGGAAGGGAGGAGGG + Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900760535 1:4467353-4467375 CAGAGGGGCTGCAGGGGAGAAGG + Intergenic
900940217 1:5793614-5793636 CAGTGGTGGTGGTGGCCAGATGG + Intergenic
900993464 1:6108288-6108310 GAGAGATGATAGAGGGAAGATGG + Intronic
901435190 1:9243190-9243212 CAGAGGGGGTGGTGGGAGGAGGG + Intronic
901451219 1:9338031-9338053 CAGCTGGGGTGCAGGGAAGAGGG + Intronic
901453811 1:9352076-9352098 GTGAGGGGGTGGAGGGAAGGTGG + Intronic
901706362 1:11076488-11076510 CAGTGGTGGTGGAGGAAAAACGG - Intronic
902044462 1:13514253-13514275 TGCAGGTGGGGGAGGGAAGAGGG - Intergenic
902204160 1:14855057-14855079 CAGAGGAGGTGGGTGGAAGGAGG + Intronic
902399778 1:16151557-16151579 CCAGGGTGGAGGAGGGAAGAGGG + Intronic
902705947 1:18204570-18204592 CAGAGGTGGAGGGGAGATGAAGG + Intronic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
902908894 1:19580446-19580468 CAGAGAGGATTGAGGGAAGATGG + Intergenic
903026143 1:20430962-20430984 GAGAGGAGGTGGAGAGGAGACGG - Intergenic
903140271 1:21335075-21335097 CAGAGGCAGTGGAGGGTGGAGGG - Intronic
903353305 1:22731035-22731057 CAGAGGGGGCGGAGAGAAAATGG + Intronic
903375247 1:22861711-22861733 CAGAGCTGGTTGAGGGTTGAGGG + Intronic
903589158 1:24441127-24441149 CAGTGCTGGTGGAGTGAAGCCGG - Intronic
903614199 1:24640413-24640435 CAGAGGTTGAGGTGGGAGGATGG + Intronic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904375384 1:30078281-30078303 CAGAGCTGGTGGTGGTAAAATGG + Intergenic
904478294 1:30778206-30778228 CACGGGTGCTGGAGGGAACAGGG + Intergenic
904746874 1:32716784-32716806 CAGAGCTGGGGGAGGGGACAGGG - Intergenic
904753531 1:32755311-32755333 CAGAGGAGGTGGAGTGAAGGGGG + Intronic
904771935 1:32885790-32885812 CAGAGGCTGGGGAGGGAGGAAGG + Intergenic
904938871 1:34151147-34151169 CAGAGGGGGAGAGGGGAAGAAGG - Intronic
905038260 1:34930685-34930707 AAAAGGTAGAGGAGGGAAGAGGG - Intergenic
905319851 1:37108119-37108141 AAGAGGTGGGAGAGGGGAGAGGG + Intergenic
905320605 1:37114242-37114264 GATGGTTGGTGGAGGGAAGAGGG - Intergenic
905394686 1:37659627-37659649 CTGAGGTGGAGGTGGGAGGACGG - Intergenic
905441680 1:38000140-38000162 CAGCGGGGGTGGGGGGATGAGGG - Intronic
905443044 1:38006425-38006447 AAGAGGTGGGGGAGGGAGGGAGG + Intergenic
905456870 1:38094420-38094442 CAGAGAAGGTGGAGAGGAGATGG + Intergenic
905764723 1:40590954-40590976 TAGATGTGGTGGGAGGAAGAAGG - Intergenic
905832903 1:41088277-41088299 TAGTGGTGGTGGAAGGAATAAGG + Intronic
905945880 1:41901121-41901143 AACAGGTGGTGGAGAGGAGAGGG + Intronic
906010916 1:42524696-42524718 CAGGGGTGGAGGAGAGGAGATGG + Intronic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906063614 1:42964085-42964107 CAGGGGTGGAGGGGGGTAGAGGG - Intergenic
906326155 1:44847405-44847427 GAGATGTGGAGGAGGGAAGTGGG + Intergenic
906326594 1:44850041-44850063 CAGGGGTGGTGGAGGGAAGGTGG + Intergenic
906372191 1:45263623-45263645 CATGGCTGGTTGAGGGAAGAAGG - Intronic
906519192 1:46457291-46457313 CAGAGGTGGTGGTAGGCAGCTGG - Intergenic
906714263 1:47955303-47955325 GAGAGGTGGTGGAAGGAGAAAGG - Intronic
907324437 1:53627756-53627778 GAGAGGAGGTGGAGGGGAGGAGG + Intronic
907494687 1:54836083-54836105 CAGAGGGGTTTGAGGGGAGAAGG - Intronic
907573277 1:55503654-55503676 CAGAGGTGGGGGAGAGAAAGAGG - Intergenic
908000145 1:59671522-59671544 CAGAGTAGGTGGAGGGAGGAAGG + Intronic
908032055 1:60011432-60011454 AAGAAGTGAGGGAGGGAAGAAGG - Intronic
908412031 1:63876427-63876449 TGGAGGTGGTTGGGGGAAGAGGG - Intronic
909278069 1:73714265-73714287 CAAAGGTGAGAGAGGGAAGAAGG + Intergenic
909337905 1:74497326-74497348 GAGAGGTGGTAGATGAAAGAGGG - Intronic
909821900 1:80074266-80074288 TAAAAGTGGTGGAGGGCAGATGG + Intergenic
910214358 1:84828003-84828025 AAGAGGGGGTGGAGGGGAGGAGG + Intronic
910351696 1:86306096-86306118 AAGAAGTGGTGGAGGGTAGAGGG - Intergenic
910542655 1:88378645-88378667 CTGAGGGGGAGGAGGGAACATGG - Intergenic
910830441 1:91455785-91455807 CAGCAGTGGTGGAGAAAAGAGGG - Intergenic
911843796 1:102721510-102721532 AAAAGGTGGTGGGGGGAAGTGGG + Intergenic
912000511 1:104828654-104828676 CAGAGGTGGAAAAGGGAACATGG - Intergenic
912346290 1:108966179-108966201 CAGAGGTGGGGGTGGGGGGATGG - Intergenic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
913444938 1:118941130-118941152 CGGAGGTGGTGGTGGGAGGTTGG - Intronic
915039926 1:152960088-152960110 CAGAGATGGTAGAGTGCAGAAGG - Intergenic
915047559 1:153031068-153031090 AACAGGTGGGTGAGGGAAGAGGG + Intergenic
915099398 1:153488092-153488114 CAGAGGCTGGGAAGGGAAGAGGG + Intergenic
915351409 1:155228912-155228934 CAGAGGTTGTGGAGAGAGGGTGG + Intergenic
915354193 1:155246092-155246114 CAGAGGTTGTGGAGAGAGGATGG + Intergenic
915490461 1:156247523-156247545 CAGAGCTGGTGGCAAGAAGAGGG - Intronic
915541206 1:156567391-156567413 CAGAGGTGAAGTAGGGAAGATGG - Intronic
915564820 1:156707451-156707473 CAGAGATGGTGGAAGGAAGCGGG + Intergenic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915625455 1:157111606-157111628 CAGAGGGAGGGGAGGGAACAGGG + Intergenic
915799443 1:158773667-158773689 ATGTGGTGGGGGAGGGAAGATGG - Intergenic
915911079 1:159915961-159915983 CAGAGGTGGTGGTGGGTGGCAGG - Intergenic
915923714 1:159999336-159999358 GAGAGGTTGAGGAGAGAAGAGGG - Intergenic
916210525 1:162356416-162356438 CAGAGGCAGTGGAGGGCAGGAGG + Intronic
916903684 1:169257573-169257595 CAGAGGGGGAGGAGCCAAGATGG - Intronic
917285812 1:173420321-173420343 GAGAGGTGGAGGAGAGAAAATGG - Intergenic
917448304 1:175125529-175125551 AAGAGGTGGGGGAGGGAAGAGGG - Intronic
917547142 1:175982862-175982884 CAGAGGTGGGGGATGGGAGTGGG + Intronic
917606147 1:176631927-176631949 CACAGGTGGAGGAGAGAAGAGGG + Intronic
917925046 1:179782354-179782376 CAGAGATGGGGAAGGGGAGAAGG + Intronic
919157295 1:193782584-193782606 CAGAGGCTGGGGAGGGTAGAGGG + Intergenic
919605889 1:199683370-199683392 CAGAGGTGGTGATGGGGAGTAGG + Intergenic
919756864 1:201071469-201071491 CATAGGTGGAGGAAGTAAGAAGG - Intronic
920048003 1:203146039-203146061 CAGAGGAGCTGGAAGGAGGAAGG - Intronic
920054389 1:203181855-203181877 CAGAAGTGGTGGGGGTAAGGTGG - Intronic
920304875 1:205012227-205012249 CAGAGGAAGTGGAGGAAAGGGGG + Intronic
920563838 1:206958417-206958439 CACAGGTGGAGGAAGGATGATGG + Exonic
920684036 1:208095575-208095597 CAGAGGAGGAGCAGGGAAGGGGG - Intronic
920841892 1:209562151-209562173 CACAGGGGGTGCAGGGAAGCTGG + Intergenic
921068844 1:211642561-211642583 CAGAGGTAGTGAAGGCAGGAGGG - Intergenic
921098976 1:211911957-211911979 CAGCTTTGGTGGAGGAAAGAAGG - Intergenic
921242077 1:213195000-213195022 TAGAGATGGTGGAGGAGAGAAGG + Intronic
921294727 1:213691107-213691129 CAGAGGAAGGGAAGGGAAGATGG - Intergenic
921317352 1:213905131-213905153 GAGAGGTGAGGGAGGGAAGAAGG + Intergenic
921482289 1:215677047-215677069 CAACGGTGAGGGAGGGAAGAGGG - Intronic
922050837 1:221989348-221989370 CAGATGAGGTGGAGGGCAGGTGG - Intergenic
922096567 1:222447920-222447942 CAGATGTGGTGGAAGGAAAAAGG - Intergenic
922408115 1:225339895-225339917 CAGAGGAGGAAGAGGGAAGCTGG - Intronic
922504144 1:226116728-226116750 CTGAGGTGCTGCAGGGAAAATGG + Intergenic
922517865 1:226222191-226222213 GAGAAGGGGTGGAAGGAAGATGG + Intergenic
922541574 1:226424155-226424177 CAGAGGTTGAGGTGGGAGGATGG + Intergenic
922773536 1:228203779-228203801 CAGAGGCTGGGGAGGGAAGCGGG + Exonic
922825850 1:228517921-228517943 AGGAGGAGGAGGAGGGAAGAAGG - Intergenic
922918494 1:229278700-229278722 CAGAGGTGGTTAAAGGAGGAAGG - Intronic
923035900 1:230285011-230285033 CACTGGTGGTGGAAGGCAGAGGG + Intergenic
923116011 1:230938525-230938547 CAGAGGAGGTAGAGGGAAACAGG - Intronic
923133412 1:231096766-231096788 CAGAGGTGGCTGAGGGGACAGGG + Intergenic
923154874 1:231269354-231269376 CAGATGGGGTGGTGGGTAGATGG + Intronic
923162203 1:231324177-231324199 CTGTGGTGGTGGGGGGAAGCGGG + Intergenic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
923237655 1:232049762-232049784 CAGAGGTTGTGGGGGGCAGGTGG + Intergenic
923568158 1:235092149-235092171 CAGTTGTGGTGGATGGGAGAAGG - Intergenic
924058352 1:240145357-240145379 CGGAGATGGAGGAGGGAGGATGG - Intronic
924184532 1:241474422-241474444 CAGGGTTGGTGGTGGGAAGGAGG - Intergenic
924458075 1:244234106-244234128 CAGAGGGGGTGGCGGCAGGAAGG - Intergenic
924552232 1:245089540-245089562 CAGATGTAGTGGAGAGGAGAGGG + Intronic
924608658 1:245556254-245556276 AAGAGGAGGAGGAGGGAGGAAGG - Intronic
1062858907 10:794609-794631 CAGAGGTGGGGTGGGGAGGAGGG - Intergenic
1062990198 10:1807503-1807525 CAGAGATGGTACAGGGAACATGG + Intergenic
1063188576 10:3671749-3671771 AAGAGGTGGTGGAGGGACCTCGG + Intergenic
1063503820 10:6579280-6579302 TGGAGAAGGTGGAGGGAAGAGGG - Intronic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1064114752 10:12568302-12568324 GAGAGGAGGTGGAGGGGAGGGGG - Intronic
1064125994 10:12660617-12660639 CAGAAATGGTAGAGGGAAGTGGG - Intronic
1064415026 10:15141700-15141722 AAAAGGTAGTGGAGTGAAGACGG + Intronic
1064476229 10:15691688-15691710 CAGAGGCTGGGGAGGGCAGAAGG + Intronic
1064627243 10:17273848-17273870 GAGAGGAGGAGGAGGGAAGAAGG - Intergenic
1065102588 10:22345576-22345598 CAGAGCTCGAGGAGGGCAGACGG + Exonic
1065130323 10:22613493-22613515 CAGAACTGATGGAGGGAAGATGG + Intronic
1065366677 10:24944067-24944089 CAGAGGTAGAGGAGGAAAGGGGG - Intronic
1065793025 10:29279022-29279044 CAGAGGTGGAGGAGGTAGAAGGG - Intergenic
1066080517 10:31927496-31927518 GGGAGGTGGTGGAGGAAGGAAGG - Intronic
1066277266 10:33881271-33881293 CAGAGGTGGTGGGGCAAAAATGG + Intergenic
1067024352 10:42830677-42830699 CAGAGGTGGTAAAGGTAAAATGG + Intronic
1067218505 10:44323709-44323731 CAGTGGTGGTGGAAGGAAAGAGG + Intergenic
1067448036 10:46364853-46364875 CAGAGCTGGAGAAGTGAAGAAGG - Intergenic
1067508848 10:46878348-46878370 GAGAGGAGGTGGAGGGGAGGGGG + Intergenic
1067582366 10:47453796-47453818 CTGAGGTGGAGGAGGGATGAGGG - Intergenic
1067636468 10:48003987-48004009 CAGAGCTGGAGAAGTGAAGAAGG + Intergenic
1067653401 10:48173502-48173524 GAGAGGAGGTGGAGGGGAGGGGG - Intronic
1067744537 10:48925695-48925717 CAGAGCTGATGGAGGGATGATGG + Intronic
1068585426 10:58792841-58792863 CAGGGGAGGGGGAGGGAAGGGGG - Intronic
1068710684 10:60130207-60130229 CAGAGCTGGGGGAGGGGAGTGGG - Intronic
1069074470 10:64023911-64023933 CAGAGGTGGTGGAGGTGGAAGGG + Intergenic
1069202468 10:65638140-65638162 CAGAGGTTGAGGAGAGAAAAGGG - Intergenic
1069613837 10:69793429-69793451 CAGTGGTGGGGGCGGGCAGAGGG + Intergenic
1069709192 10:70478369-70478391 CAGAGGGGGGCGAGGGAAGCCGG + Intergenic
1069771505 10:70903459-70903481 CAGAAGTGTTGCAGGGAAGGCGG - Intergenic
1069816259 10:71196437-71196459 CAGAGGTGGTGGACTGGACAGGG + Intergenic
1070109334 10:73467804-73467826 CAGGGCTGGTAGAGGGAGGAAGG + Intronic
1070133017 10:73667971-73667993 CAGAGCTGGAGAAGTGAAGAAGG + Intergenic
1070169209 10:73920094-73920116 CTGAGGTGGGAGAGGGCAGAGGG - Intronic
1070271016 10:74955024-74955046 CAGTGGTGGTAGAGGGGTGAGGG - Intronic
1070555082 10:77521327-77521349 TAGGGGTGGAGGATGGAAGATGG - Intronic
1070573987 10:77663321-77663343 CAGCTGTGGAGGAGGGGAGAAGG - Intergenic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1070782360 10:79145096-79145118 CAGAGGGGGAGGGGGAAAGAGGG - Intronic
1070923982 10:80205878-80205900 CGGTGGTGGTGGAGGGGGGAAGG + Intergenic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071203814 10:83251734-83251756 AAGAGGAGGAGGAGGGAGGAGGG + Intergenic
1071209623 10:83324082-83324104 CAGAGGTTGTGAAGGGTAGCTGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071292878 10:84200418-84200440 CAGAGAGGGTGCAGGAAAGAGGG - Intronic
1071511582 10:86265632-86265654 CATAGAGGTTGGAGGGAAGAGGG + Intronic
1071522642 10:86340699-86340721 TAGAAGGGGAGGAGGGAAGAAGG + Intronic
1071608646 10:87016063-87016085 CAGAGCTGGAGAAGTGAAGAAGG - Intergenic
1071852342 10:89586780-89586802 CAGAGGAGGTGGAAGAGAGAAGG + Intronic
1071954620 10:90744231-90744253 CAGAGGTGGTGGTGGCTAGTAGG - Intronic
1071987530 10:91067432-91067454 GAGAGGTGGTGGTGGCAGGATGG + Intergenic
1072313277 10:94177881-94177903 GAGAGGTAGTGAAGGGAGGAAGG - Intronic
1072324480 10:94284154-94284176 CAGAGGTGGTTTAGTGATGAAGG + Intronic
1072372902 10:94783402-94783424 AAGAGTAGGTGGATGGAAGAGGG + Intronic
1072388003 10:94951851-94951873 AAGAGTAGGTGGATGGAAGAGGG + Intronic
1072566991 10:96625022-96625044 GAGAGGTGATGGAGGTGAGACGG + Intronic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073025361 10:100483397-100483419 CAGAGGTTGAAGATGGAAGAGGG + Exonic
1073073861 10:100811130-100811152 GAGAGGTGGGGGAGGGAAGATGG + Intronic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073465460 10:103692481-103692503 CAGAGTTGGGGCAGGGAAGAAGG + Intronic
1073599215 10:104830502-104830524 CAGAGGTGGTGGAAGCAATGGGG - Intronic
1073724083 10:106209804-106209826 CATAGTTGGGGGTGGGAAGAAGG - Intergenic
1073791957 10:106949492-106949514 CAGAGGCTGTGTAGGGATGAGGG - Intronic
1074044588 10:109825814-109825836 CAGAGGGGGAGGAGCCAAGATGG + Intergenic
1074151037 10:110759994-110760016 CAGTGGTGGTGGGGGGCACAGGG + Intronic
1074165763 10:110872349-110872371 CAGAGGGGGAGGAGGGCTGAGGG - Intronic
1074311649 10:112327788-112327810 AAAAGGGGGAGGAGGGAAGAGGG + Intergenic
1074440680 10:113475042-113475064 CAGCAGTGGTGGAGGGAGGTGGG + Intergenic
1074704415 10:116118466-116118488 CAGTGGTTGAGGTGGGAAGAAGG - Intronic
1074747415 10:116548633-116548655 AGGAGGTGGTGGTGGGAAGAGGG + Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075516055 10:123109202-123109224 TAGAGGAGATGGAGGCAAGAAGG + Intergenic
1075553215 10:123409393-123409415 CCGAGGAGGTGGAGGGATGGTGG + Intergenic
1075627369 10:123972631-123972653 GAGAGGTGGAGGAGCGAAGAGGG + Intergenic
1075876560 10:125811382-125811404 GAGATGTGCGGGAGGGAAGATGG + Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076157683 10:128216087-128216109 CAGGGCAGGTGGAGGGCAGAGGG + Intergenic
1076445205 10:130509579-130509601 CAGAGCTGGGAGAGGGCAGAGGG + Intergenic
1076595775 10:131623552-131623574 CAGAGGTGGGGGAGAGAGGTGGG + Intergenic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1077136837 11:1004005-1004027 CAGAGGGGGTGGCGGGGAGGTGG + Intronic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077355343 11:2114271-2114293 GTGAGGTGGTGGAGGGTGGAGGG - Intergenic
1077532912 11:3105688-3105710 CAGAGGTGGGGCAGGGAGGTGGG - Intronic
1077602442 11:3582712-3582734 GAGAGCTGGAGGAGAGAAGAAGG - Intergenic
1077730108 11:4721440-4721462 CTGAAGTGGTGGAGGAGAGAGGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078302580 11:10147564-10147586 TAAGGGTGGAGGAGGGAAGAAGG + Intronic
1078642375 11:13108638-13108660 CAGGGCTTGTGGAGGGAAGAGGG + Intergenic
1078727512 11:13944849-13944871 CAGAAGAGTTAGAGGGAAGAAGG + Intergenic
1079001247 11:16758748-16758770 CAGAGGGGGTGGTGGGAACCAGG - Intergenic
1079023318 11:16925908-16925930 CTGAGGAGGGGGAGGGAAAAGGG + Intronic
1079308133 11:19342634-19342656 GAGAGGTGGGGGAGGGAGGGAGG + Intergenic
1079357410 11:19741421-19741443 CTGAAGTGGGGGAGGGAAGTGGG - Intronic
1079361225 11:19771963-19771985 CAAGGCTGGTGGAGGGGAGACGG + Intronic
1079390924 11:20021678-20021700 CAGAGGTGGGGGTGGGCAGTGGG - Intronic
1080402342 11:31947643-31947665 TAGAGGTGGTGGTGGGGACAGGG - Intronic
1080440446 11:32289410-32289432 CCGAGGTGGTTCAGGGGAGAAGG - Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1080715050 11:34792199-34792221 CAGAGGTCCTGGAGTGAAGGAGG - Intergenic
1081062515 11:38497917-38497939 CATAGATGGTGGAGGCAAGATGG - Intergenic
1081321576 11:41698087-41698109 CAGAGCTGCTGGAAGAAAGATGG + Intergenic
1081338809 11:41902465-41902487 GAGAGGTGGTGGTTGGCAGATGG + Intergenic
1081641276 11:44755982-44756004 GAGAGATGGAGGAGGGAAGAGGG + Intronic
1081662493 11:44896618-44896640 CAGAGGTAGAGATGGGAAGATGG - Intronic
1081803502 11:45876076-45876098 CAGAGGAAATGGAGGAAAGAGGG - Intronic
1081976738 11:47240082-47240104 CCTAGGAGGTGGAGGGAAGGGGG + Exonic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1082956691 11:58877404-58877426 CAGAGGGAGTGGAGCCAAGATGG - Intronic
1083201990 11:61126226-61126248 CAGAGGTGATGCAGGGAGGTCGG - Intronic
1083261876 11:61527587-61527609 CAGAGGCCGAGGAGGGAAGCTGG - Intronic
1083651596 11:64207704-64207726 CAGAAGGGAGGGAGGGAAGAGGG - Intronic
1083757454 11:64799364-64799386 CAGAGGTGGGGCAGGGAGGTCGG - Intronic
1083891480 11:65597964-65597986 GAGGGGAGGTGCAGGGAAGAGGG - Exonic
1083999756 11:66289612-66289634 CGGAGGTGGTGGTGGGAGGCCGG + Intergenic
1084045132 11:66563927-66563949 CGGCGGTGGTGGACTGAAGAGGG - Exonic
1084364719 11:68690151-68690173 GGGAGGTGGTGGAGGGGAGGAGG + Intronic
1084642036 11:70431875-70431897 CAGAGGTGCTGGCGGGGAGCAGG - Intronic
1084668006 11:70586912-70586934 GTGAGGTGGGGGAGGGAAGAGGG - Intronic
1084737157 11:71112969-71112991 CTGGCGTGGTGGAGGGAAGCGGG - Intronic
1084785667 11:71440426-71440448 CAGACGGGGTGGAGGGTGGATGG + Intronic
1084949727 11:72657967-72657989 GAGGAGGGGTGGAGGGAAGAGGG + Intronic
1085143619 11:74171861-74171883 CAGGGAAGGTGGAGGGAAGTGGG + Intronic
1085351006 11:75797811-75797833 CAAGGGTGGGGGAGGGTAGAGGG + Intronic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1086052296 11:82607579-82607601 AAGAGGTGGGGGAAGAAAGATGG - Intergenic
1086175216 11:83883949-83883971 TAGAGCTGGTGGAGCCAAGATGG + Intronic
1086959999 11:92971692-92971714 GAAAGGTGGTTGAGGGAAGTAGG + Intronic
1087369311 11:97261629-97261651 CAGAGGTGCCCGAGGGAAGATGG - Intergenic
1087370750 11:97280283-97280305 CAGTGGTGGTGGTGGCCAGAGGG + Intergenic
1087809685 11:102596868-102596890 ACGAGGTGGTGGAGAGAAAAGGG - Intronic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088015881 11:105059304-105059326 CAGAGGTTGTGGCAGGAAGGAGG - Intronic
1088300218 11:108350250-108350272 GAGATGTGGTGGAGGGACAAGGG + Intronic
1088320994 11:108554548-108554570 TAAAGGTGGTGGAGGGATAATGG + Intronic
1088650078 11:111949774-111949796 CAGAGGTGATGGAAGGAGGAAGG - Intronic
1088675502 11:112188613-112188635 CAGAGATGATGGAAGGAGGAAGG - Intronic
1088747926 11:112820102-112820124 CAGAGGTGTGGGAAGTAAGAAGG - Intergenic
1088830754 11:113534538-113534560 CAGAGGTTGTGGGTAGAAGAAGG + Intergenic
1089054557 11:115575052-115575074 GAGGGGTGGTGGAGAGAAGATGG + Intergenic
1089454064 11:118615627-118615649 CAGAAGCGGGGGAGAGAAGAAGG + Intronic
1089576866 11:119450874-119450896 CAGACATGATGGAGGGCAGAAGG + Intergenic
1089742112 11:120591605-120591627 AGGCTGTGGTGGAGGGAAGAGGG - Intronic
1090053505 11:123401658-123401680 CAGGGGTGGGGGAAGGAAGACGG + Intergenic
1090080423 11:123608906-123608928 CTGAGGTGGCCGAGGGAAGGAGG - Intronic
1090421455 11:126578266-126578288 CAGAGAAGCTGGAGGGGAGAGGG - Intronic
1090449758 11:126796164-126796186 TAGAGGTCATGAAGGGAAGAAGG + Intronic
1090590581 11:128262685-128262707 CAGAGGTGGTGAAGAGAAACAGG + Intergenic
1090879988 11:130824984-130825006 CAGAGGAGGGGAATGGAAGAGGG - Intergenic
1090919906 11:131198381-131198403 CACATGTGGTGGAGGGAGGAAGG - Intergenic
1090972540 11:131655641-131655663 CAGAAGTGGTGGAGAAAGGACGG + Intronic
1090993378 11:131840899-131840921 CAGAGGTGGAGGATGACAGAAGG + Intronic
1091005598 11:131950379-131950401 CAGAGATAGTGGAGGTAAGATGG - Intronic
1091058557 11:132441091-132441113 CAGAGGTGGGGTAAGCAAGATGG + Intronic
1091251158 11:134145450-134145472 CAGTGGTGGTGGTGGGAGGTGGG + Intronic
1091555836 12:1572840-1572862 CAGTGGCGGTGGAGGGGGGATGG + Intronic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1091650830 12:2308001-2308023 CATGGGTGGAGGTGGGAAGAGGG - Intronic
1091744360 12:2981774-2981796 CAGGGGTGCTGGAGGGTAGTGGG + Intronic
1091916587 12:4274705-4274727 CCGGGGAGGTGGAGGGAGGAGGG + Intronic
1092428586 12:8392064-8392086 GAGAGCTGGAGGAGGGAGGAAGG - Intergenic
1092429668 12:8398208-8398230 GAGAGCTGGAGGAGGGAGGAAGG - Intergenic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1093549676 12:20392960-20392982 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
1093902414 12:24651058-24651080 CAGAGGTTGGGAAGGGAAGTGGG - Intergenic
1094093621 12:26678228-26678250 CAGGGATGGAGGAGGGAAGATGG - Intronic
1094197586 12:27765553-27765575 CAGAGGAGGTTCATGGAAGAAGG - Intronic
1094386504 12:29900231-29900253 AAGAGTTGGGGGTGGGAAGAGGG - Intergenic
1095818867 12:46455101-46455123 TGGAGGCAGTGGAGGGAAGATGG - Intergenic
1096557243 12:52410920-52410942 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1096716991 12:53497615-53497637 CTGAGGTGATGCTGGGAAGAAGG - Intronic
1096816893 12:54207469-54207491 CAGTGGAGGTGGGGGGAAGCAGG + Intergenic
1096843006 12:54390665-54390687 CAGAGGGGCTGGGGAGAAGAGGG - Intronic
1096870815 12:54590940-54590962 GAGAGGAGGGAGAGGGAAGAGGG + Intergenic
1097186960 12:57201162-57201184 CAGAGGTGGTGGTGGGCCGGTGG + Intronic
1097334601 12:58368205-58368227 CAGAGCTGTGGTAGGGAAGAGGG + Intergenic
1097811480 12:64023976-64023998 CAGAGGAGGTGGTAGGAGGAGGG + Intronic
1097918732 12:65048275-65048297 GAGAGGTGGGTGAGGGGAGAGGG + Intergenic
1097973320 12:65658445-65658467 TAGTGGTGGAGGTGGGAAGAAGG - Intergenic
1098364993 12:69693098-69693120 CAGAGGTGGGGGAGAGAAAGTGG - Intronic
1098450495 12:70613150-70613172 CAGTGGTGTTGGATGGATGAGGG + Intronic
1099438165 12:82668325-82668347 AAGAGGTGGTGGGGGGAAGGAGG - Intergenic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1100726517 12:97414569-97414591 CTGAGGTATTGGAGGGAGGAAGG - Intergenic
1100772926 12:97943177-97943199 CAAAGGAAGTGGAGGGAAGCTGG + Intergenic
1100930638 12:99605487-99605509 CAGAGGTTGGGAAGGGTAGAGGG - Intronic
1101242017 12:102848351-102848373 CTGAAGAGGTGGAGGGTAGACGG + Intronic
1101249665 12:102919595-102919617 CAGAGGTGGGGAAGGGTAGTAGG - Intronic
1101545285 12:105706655-105706677 CAGATGGGGAGGAGGGATGAGGG - Intergenic
1101909288 12:108850174-108850196 GGGAGCTGGGGGAGGGAAGATGG + Intronic
1102503149 12:113366779-113366801 GAGAGGAGGAGGAGGGAAGGAGG - Intronic
1102647749 12:114414692-114414714 CACAGGTGGAGGAGGGTGGAGGG - Intergenic
1102904254 12:116662278-116662300 CCGAGGTGGCAGAGAGAAGAGGG - Intergenic
1102929188 12:116849552-116849574 CAGAGGTGGTGGAGGGCAAGAGG - Exonic
1103198982 12:119070909-119070931 CAGAGGCAGTGGAGTAAAGACGG - Intronic
1103245479 12:119453293-119453315 AAAAGGAGGAGGAGGGAAGAGGG - Intronic
1103747138 12:123132674-123132696 CAGGGGTTGGGGAGGGGAGATGG - Intronic
1104053296 12:125210631-125210653 CAGGGGAGGTGGAGGGGACAGGG + Intronic
1104316227 12:127704394-127704416 AAGAGGAGGAGGAGGGAGGAGGG + Intergenic
1104782805 12:131432634-131432656 AAGAGGAGGAGGAGGGAAGTAGG + Intergenic
1105273824 13:18903456-18903478 CAAAGGTGGTTGAGAAAAGAAGG - Intergenic
1105649994 13:22366632-22366654 CAGAGGTGGGAGAGGGTAGGGGG + Intergenic
1106012303 13:25836591-25836613 CAGAAGTGGAGGAGGGCAGTGGG - Intronic
1106346659 13:28886099-28886121 CAGAGTTGCTGGTGGGGAGAGGG + Intronic
1106476331 13:30101643-30101665 CGGAGGTGGTGGGGGGTGGAGGG - Intergenic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1106842711 13:33702255-33702277 CAGAAGCGGTGAAGGGAAGAGGG - Intergenic
1107255746 13:38424962-38424984 CAAAGCTGGGGCAGGGAAGAAGG + Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1107634310 13:42377015-42377037 CAAAGGGGGTGGGGGGAGGAAGG - Intergenic
1107851667 13:44577415-44577437 CGGAGGAGGAGGAGGGAAGATGG + Intergenic
1108502971 13:51084829-51084851 CAGAGGAGATGGTGGTAAGATGG + Intergenic
1108552782 13:51563245-51563267 CAGAGGTTGTGGAGAGAAGGGGG + Intergenic
1108677638 13:52751002-52751024 CAGAGATGTTGGAGGGGTGAGGG - Intergenic
1108892990 13:55285176-55285198 CAGAGGCGGTGAAAGGTAGAGGG + Intergenic
1109415991 13:62041162-62041184 CAGAGGTGGTGGTGGTAATGGGG + Intergenic
1110306000 13:73987603-73987625 CAGACGTGGGAGAGGGGAGAGGG + Intronic
1110346291 13:74451476-74451498 CAGAAGTGGGGCAGAGAAGATGG + Intergenic
1110768509 13:79307609-79307631 TAGAGGTGGTGTAAGGAACATGG + Intergenic
1111690365 13:91556070-91556092 CAGAAGTGGTGGAAGGGATAGGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111831189 13:93331864-93331886 CAGAGGTTGGGGAGAGTAGAGGG - Intronic
1111876381 13:93902220-93902242 CAGAGGCTGAGGAGGGGAGAGGG - Intronic
1111916786 13:94369284-94369306 CAGAGATGATTGAGGGAAAATGG + Intronic
1112181972 13:97091921-97091943 CAGAGGCTGGGGAGGGAAGGAGG + Intergenic
1112229165 13:97570301-97570323 GAGGGGTGGTGGCGGGTAGAGGG + Intergenic
1112821251 13:103338805-103338827 CTGGCGTGGTGGAGGGATGAAGG - Intergenic
1113126535 13:106985333-106985355 AGGGGGTGGTGGTGGGAAGAAGG - Intergenic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1114355782 14:21906570-21906592 CAGAGGTGAGGTAGGGGAGATGG - Intergenic
1114367514 14:22046161-22046183 GAGAGATGGTGGAGTGGAGAGGG + Intergenic
1114551522 14:23535181-23535203 CAGAGGTGGAGGAGGCAGCAGGG + Exonic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1115136564 14:30116295-30116317 CAGGGTTGGTGGGGGGAAGGAGG - Intronic
1115243288 14:31270353-31270375 CTCTGCTGGTGGAGGGAAGAGGG - Intergenic
1115268417 14:31525860-31525882 CAGTGGTGGAGTCGGGAAGAGGG - Intronic
1115945311 14:38653217-38653239 AAGAGATGGAGGAAGGAAGACGG - Intergenic
1116250683 14:42479212-42479234 CACACGTGGTGGAAGGCAGAAGG - Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116292274 14:43059371-43059393 CAGAGGGGTTGGAGGGCAGCAGG + Intergenic
1116352275 14:43878235-43878257 CAGAGGTGGTGCAGGTAAGGTGG + Intergenic
1116430083 14:44836127-44836149 CCGGGGTGGGGGAGGGCAGAGGG - Intergenic
1116546138 14:46167264-46167286 GAGAGGGGGTGGAGCCAAGATGG - Intergenic
1116595139 14:46832338-46832360 TAGAGATGGTGGAAGGGAGAGGG - Intergenic
1116933748 14:50716280-50716302 CAGAGGTGGATGTGGGCAGATGG - Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1118410384 14:65471176-65471198 CACAGTTGGTAGAGGGCAGAGGG - Intronic
1118888086 14:69883287-69883309 CAGAGGCTGAGGAAGGAAGAGGG - Intronic
1119233445 14:72999480-72999502 CAGAGGCTGAGGTGGGAAGATGG + Intronic
1119660253 14:76446030-76446052 CAATGGCGGGGGAGGGAAGAGGG + Intronic
1119771465 14:77222661-77222683 AAGGGCTGGTGGAGGGAAGCAGG - Intronic
1120464569 14:84840171-84840193 CAGAGATGGAGGAGGTAAGGTGG - Intergenic
1121122167 14:91382980-91383002 CAGAGTTGGAGGATGGAAGGAGG - Intronic
1121334947 14:93071713-93071735 CAGAGTTTGTGGAGGAAAAAAGG - Intronic
1121665875 14:95671744-95671766 CAGAGGAGGAGGAGGACAGAGGG + Intergenic
1122487243 14:102089359-102089381 AAGAAGTTGTGGAAGGAAGAAGG - Intronic
1122516865 14:102314867-102314889 CAGGGGTGCAGGAGGGCAGAGGG + Intergenic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1122877991 14:104677617-104677639 CCGAGGTGGGGCAGGGAGGAGGG + Intergenic
1122925649 14:104898261-104898283 AGGAGGCGGTGGAGGGCAGATGG + Intergenic
1122958446 14:105083544-105083566 GAGAGATGGTGGATGGAAGATGG - Intergenic
1123037017 14:105475642-105475664 TGCAGGTGGTGGCGGGAAGAGGG + Intronic
1124093810 15:26630020-26630042 CAGAGGTCGTGGAGGGTTGCGGG - Intronic
1124243798 15:28053330-28053352 AGGAGGTGTGGGAGGGAAGAGGG + Intronic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1124580889 15:30954011-30954033 CAGGGGTGGGGCAGGGAAGCAGG - Intronic
1124914090 15:33951412-33951434 AAGGGGTGGGGGAGGGAGGAGGG + Intronic
1125551102 15:40545505-40545527 CAGAGGAGGTGGAGAGAATGGGG + Intronic
1125971892 15:43918455-43918477 CAGAAAAGGAGGAGGGAAGAAGG - Intronic
1126698281 15:51343901-51343923 CATAGGAGGTGGGGGGATGAGGG - Intronic
1127404953 15:58633915-58633937 AAGAGGGGGTAGAGGAAAGAAGG + Intronic
1127711102 15:61598946-61598968 GAGAAGGGGTGGGGGGAAGACGG + Intergenic
1128473810 15:67979730-67979752 CAGAGGTGATGGAAGAAAGTTGG - Intergenic
1128518307 15:68358099-68358121 TACAGGTCATGGAGGGAAGATGG - Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128575590 15:68772333-68772355 CAGATTCAGTGGAGGGAAGATGG - Intergenic
1128627258 15:69222329-69222351 CAGGGGTGGTGGAGGCACCACGG + Intronic
1128677822 15:69624691-69624713 GAGAGGAGAGGGAGGGAAGATGG - Intergenic
1128744411 15:70103451-70103473 CAGAAGTTGTGGTGGGCAGAGGG + Intergenic
1129123978 15:73422095-73422117 AAGTGGTGGTGGAGGTGAGAAGG + Intergenic
1129200156 15:73993876-73993898 CTGAGGTGGTGGGGGCAGGAGGG - Intronic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129737038 15:77972301-77972323 CCCAGGAGGTGGAAGGAAGAGGG + Intergenic
1129769090 15:78192354-78192376 CAGAGGTGGTGTAGAGAAGTGGG - Intronic
1129849042 15:78781334-78781356 CCCAGGAGGTGGAAGGAAGAGGG - Intronic
1129915555 15:79266894-79266916 CAGAGGTGGTACAGGGACAATGG - Intergenic
1130009203 15:80135050-80135072 CAGAGGTGGAGAAGGTAAAAGGG - Intronic
1130091863 15:80827903-80827925 CAGAGATGGGGAAGGGGAGATGG - Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130838752 15:87677685-87677707 CAGAGAAGGTGTAGGAAAGAAGG - Intergenic
1130857734 15:87856092-87856114 AAGAGGCAGTGGAAGGAAGAAGG - Intergenic
1131030645 15:89183729-89183751 CAGAGGTAGGGAAGGGAGGAGGG - Intronic
1131361181 15:91792068-91792090 CAAAGGGGATGGAGGGAGGAGGG - Intergenic
1131577426 15:93605842-93605864 TGGAGGTGGTGGTGGGAGGATGG + Intergenic
1131615863 15:94016823-94016845 CCGAGGTGGAGGAGGGTGGAAGG + Intergenic
1132284712 15:100654509-100654531 GGGAGGCGGCGGAGGGAAGAAGG - Intergenic
1132291306 15:100705628-100705650 CAGCTGTGTGGGAGGGAAGAGGG + Intergenic
1132666456 16:1083278-1083300 CAGAGTGGGTGTGGGGAAGACGG + Intergenic
1132804008 16:1767398-1767420 CATAGGTGGTACAGGGGAGATGG - Intronic
1132833486 16:1941223-1941245 CAGGGGTGGGGGAGGGACGGGGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133030470 16:3008451-3008473 CAGACGTGGTGGATGGGGGAGGG + Intergenic
1133770357 16:8863999-8864021 CACAGCTGGGGGAGGGAGGAAGG + Intronic
1133840826 16:9407745-9407767 CAGAGGTGGTGGAGGGAGAGAGG + Intergenic
1133998193 16:10763131-10763153 CAGGGGTGGTAGAGGGAGGCCGG + Intronic
1134297940 16:12963119-12963141 CAGAGGTGCCTGAGGGAAGCAGG + Intronic
1134300361 16:12985277-12985299 AAGAGGTGTTGGATGGGAGAGGG + Intronic
1134340936 16:13345251-13345273 CAGAGGTGGAGGATGGGAGGAGG - Intergenic
1134523322 16:14928123-14928145 GAGAGGAGGAGGAGGGGAGAGGG - Intronic
1135481890 16:22827488-22827510 CAGTGGTGGTGGAGAGAGAAAGG + Intronic
1135568162 16:23528040-23528062 CTCACGTGGTGGAGGGACGAGGG - Intronic
1135739278 16:24959619-24959641 CAGAGGTGGCAGAGGCAAGAAGG + Intronic
1135937263 16:26791968-26791990 CAGAAGAGGTGAAGGGATGAAGG - Intergenic
1135942439 16:26834264-26834286 GGGAGGAGGAGGAGGGAAGAAGG + Intergenic
1136004090 16:27316433-27316455 CAGATGGGGTGGGTGGAAGAGGG - Intronic
1136539879 16:30923455-30923477 TGGAGGTGGTGGAGGAAGGAGGG + Intronic
1136632650 16:31497991-31498013 GAGAGGTGGTGACAGGAAGATGG + Intronic
1137500932 16:49011149-49011171 CAGAGGTTGGTGGGGGAAGAGGG + Intergenic
1137557137 16:49477610-49477632 AAGAGGAGGAGGAGGGAAGAAGG + Intergenic
1137598758 16:49742324-49742346 CAGATGAGAGGGAGGGAAGAGGG + Intronic
1137669683 16:50271960-50271982 CAGCGGTGGTGGGGGAAACAGGG - Intronic
1138722268 16:59096416-59096438 CACAGGGGGTGGAGCCAAGATGG + Intergenic
1138856647 16:60701679-60701701 CAGAAGTGGTGGAGGGTTAATGG - Intergenic
1139021709 16:62758334-62758356 TAGAGGTTGTGGTGGGAACATGG - Intergenic
1139481776 16:67234637-67234659 CAGATGTGGAGGACTGAAGAGGG - Intronic
1139548596 16:67661235-67661257 CAGCAGTGGAGGAAGGAAGACGG - Intronic
1140230456 16:73113240-73113262 CAGAGGAAGTGAAGGGAGGAAGG + Intergenic
1140449450 16:75058706-75058728 CAGACTAGGTGGAGGGTAGATGG + Intronic
1140552679 16:75884311-75884333 CTGAGGTGGAGGAGCGAACAGGG + Intergenic
1140596907 16:76426436-76426458 AAGAGGTGGAGGAGAGGAGAAGG + Intronic
1140692616 16:77498833-77498855 CAGAGGCGGGGGAGGAAGGAAGG + Intergenic
1140847102 16:78901415-78901437 CAGAAGTGGTTGTGGGGAGAGGG - Intronic
1140939502 16:79708185-79708207 CACAGGTGGGGCTGGGAAGAGGG - Intergenic
1141181595 16:81756593-81756615 CAGAGGTGGTGGGGGAAAGAAGG + Intronic
1141236364 16:82221462-82221484 CAGAGGCTGGGGAGGGAAGGAGG - Intergenic
1141447638 16:84072301-84072323 AAGGGCTGGTGGAAGGAAGAAGG + Intronic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141814954 16:86403561-86403583 CAGTGGTGGTGGAAGGCAAAAGG + Intergenic
1141828519 16:86497098-86497120 TAGAGGAGGTGGGGGGGAGAAGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142188291 16:88705302-88705324 CTGAGGTGGTGGAGTGGAGGGGG - Intronic
1142262415 16:89049190-89049212 CAGGGGTGGTGAGGGCAAGAAGG - Intergenic
1142270747 16:89088211-89088233 GAGTGGTGGTGGTGGGAGGAAGG - Intergenic
1142961857 17:3556499-3556521 CATAGGTGGGGGCAGGAAGACGG + Intronic
1143023658 17:3929138-3929160 CAGACCTGGGGGACGGAAGAGGG - Intronic
1143025051 17:3936586-3936608 CACAGCTGGCGGAGGGAGGAGGG - Intronic
1143370651 17:6436891-6436913 AGGAGGAGGAGGAGGGAAGAGGG + Intergenic
1143391422 17:6561262-6561284 AAGAGGAGGAGGAGGGGAGAAGG - Intergenic
1143427869 17:6854273-6854295 CAGAGGTGTTGCAGGGGACACGG + Intergenic
1143539097 17:7558940-7558962 CAGTGGTGCAGAAGGGAAGAAGG - Exonic
1143724672 17:8836954-8836976 GGGAGGAGGTGGAGGTAAGAGGG + Intronic
1143768272 17:9151553-9151575 CACAGGTGGTGGTGGGGAGGGGG + Intronic
1144026010 17:11276298-11276320 CAAAGGTGGCGGAGGGGAGGTGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144514824 17:15910036-15910058 CACAGGTGGTTGAGGGAAATGGG + Intergenic
1146178148 17:30679698-30679720 CAGAGGAGGGGGAGGACAGAGGG + Intergenic
1146296733 17:31655973-31655995 CAGAGGCGGGGTGGGGAAGATGG - Intergenic
1146441295 17:32897326-32897348 GAGAGGGGAGGGAGGGAAGAAGG - Intergenic
1146472150 17:33133216-33133238 CAAAGGTGGGGAAGGGAAGAGGG + Intronic
1146547777 17:33754106-33754128 GAGAGGTGGTGCAGGGAGGCTGG - Intronic
1146561845 17:33877132-33877154 ATGAGGTGGTGGAGCCAAGATGG + Intronic
1146667639 17:34715606-34715628 TGGAGGTGGAGGAGGGCAGAGGG - Intergenic
1146913793 17:36665264-36665286 CAGAGGTGGGGAAGGGAAGGGGG - Intergenic
1146938243 17:36825878-36825900 GAGAGCTGGAGGAAGGAAGAGGG + Intergenic
1146957684 17:36946323-36946345 CAGAGGTGGTGGCTTTAAGATGG - Intergenic
1147166472 17:38596189-38596211 CAGAGGAGCTGGAGAGAGGAGGG + Intronic
1147192472 17:38746157-38746179 GAGAGGTGGGAGAGGGAGGAAGG - Intronic
1147535829 17:41322901-41322923 CAGACATAGAGGAGGGAAGATGG - Intergenic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1148102190 17:45099047-45099069 CAGAAGGGGAGGAGGGAGGAGGG + Intronic
1148748623 17:49932027-49932049 GAGAAGTGGAGGAGGGCAGACGG + Intergenic
1148864217 17:50620155-50620177 CTTAGGGGGTGGAGGGAAGGAGG + Intronic
1148878033 17:50704134-50704156 TTGAGGTGGTAGAGGGATGAGGG + Intronic
1149247364 17:54726476-54726498 CAGAGGTTGGGGAGGGTAGTGGG + Intergenic
1149259129 17:54859813-54859835 CAGAGGTGGAGGAGGTTAAAGGG + Intergenic
1149334183 17:55618441-55618463 CAGAGGTGGGGGAGACTAGATGG - Intergenic
1150122434 17:62615432-62615454 ATGGGGTGGGGGAGGGAAGAAGG + Intronic
1150535680 17:66037346-66037368 GAGAGGTGGTCACGGGAAGAAGG - Intronic
1150653827 17:67026883-67026905 GAAAGGAGGTGGGGGGAAGAAGG - Intronic
1150864590 17:68836297-68836319 CAGAGGTATGGGAGGGTAGAGGG + Intergenic
1150927627 17:69550285-69550307 CAGAGGTGGCTGATGGATGAGGG - Intergenic
1150947615 17:69765406-69765428 GAGAGGGAGGGGAGGGAAGAAGG - Intergenic
1150947688 17:69765606-69765628 GAGAAGAGGGGGAGGGAAGAGGG - Intergenic
1151027845 17:70700051-70700073 CAGATGTGATGGAGGGAAAATGG - Intergenic
1151346755 17:73507154-73507176 CAGAGGTGGTGTTGGGCACAGGG - Intronic
1151411447 17:73932982-73933004 GAGAGGGGGGAGAGGGAAGAGGG - Intergenic
1151496644 17:74462030-74462052 TAGAGGTGGTGGTGGGAAGAGGG - Intergenic
1151577391 17:74959627-74959649 CAGAGGTGGTGGGGACAAAAGGG - Intronic
1151612114 17:75182939-75182961 CAGCGGTGGACGAGGGGAGAGGG + Intergenic
1152163694 17:78686713-78686735 CAAAGGCAGGGGAGGGAAGATGG + Intronic
1152245141 17:79181566-79181588 CACAGGTGGTCCTGGGAAGATGG + Intronic
1152323149 17:79619794-79619816 CAGGGCTGGAGGAGGGGAGATGG - Intergenic
1152379063 17:79933073-79933095 CACAGGTGGCGGAGGGGTGAAGG + Exonic
1152379676 17:79935880-79935902 CAAAAGTGCTGGAGGAAAGATGG + Exonic
1153285102 18:3449791-3449813 CGGGGGTGGAGGAGGGAAGGAGG + Intronic
1153378092 18:4404114-4404136 AAGGTGTGGTGAAGGGAAGATGG + Intronic
1154026864 18:10716188-10716210 CAGAGGTGGAGGAGAGAAGGTGG - Intronic
1154137656 18:11794561-11794583 GCCAGGTGTTGGAGGGAAGAGGG + Intronic
1154193840 18:12252057-12252079 GAGAGGTGGGAGAGGGCAGAGGG - Intergenic
1154354482 18:13614733-13614755 CGGCGGTGGTGGCAGGAAGACGG - Intronic
1154465531 18:14640696-14640718 CAAAGGTGGTTGAGAAAAGAAGG - Intergenic
1155235620 18:23816257-23816279 CAGATGTGGCAGAGGAAAGAAGG + Intronic
1155472490 18:26205449-26205471 AAGAGGAGGAGGAGGAAAGAAGG + Intergenic
1156221317 18:35055237-35055259 CAGAGCTGTTGGAGGGAGCATGG - Intronic
1156495670 18:37523845-37523867 CAGAGGTGAAGGTGGGAGGAGGG + Intronic
1156586299 18:38434697-38434719 CAGAGGTGGTGGGGTGGAAATGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157326319 18:46671433-46671455 CAGATGTGGAGGTGGGCAGAGGG + Intronic
1157622791 18:49025902-49025924 CAGAGGCCGTGGAGGCCAGAGGG - Intergenic
1157686080 18:49643954-49643976 CAGAGCTGGGGGAGGGAAAATGG - Intergenic
1157722677 18:49937337-49937359 CAGGGGTGGTGGCAGGAACAGGG + Exonic
1158514920 18:58123103-58123125 CAGAGGTGGTGGAGGATGTAAGG - Intronic
1158580910 18:58681958-58681980 CAGCAGTGGTGGAGGGCAGGAGG + Intronic
1159355927 18:67337417-67337439 CAGAAGTGGTGGAGGGTAGAAGG + Intergenic
1159926704 18:74276062-74276084 CAGAGGAGGTGGAGGATAGTGGG - Intronic
1159927388 18:74281462-74281484 GACAGGAGGTGGAGGGAGGAGGG + Intronic
1160448628 18:78946982-78947004 GGGAGGAGGAGGAGGGAAGAGGG + Intergenic
1160468871 18:79108187-79108209 CAGGGATGCTGGAGGGAAGGAGG + Intronic
1160975516 19:1790503-1790525 CAGAGGAGGGAGGGGGAAGAGGG - Intronic
1161208287 19:3053607-3053629 CAGGGGAGGAGGAGGGAAGCCGG + Exonic
1161222208 19:3122953-3122975 CAGAAGTGGTGTGGGGAAGCCGG - Exonic
1161427274 19:4210452-4210474 GAGAGATGGAGGAGGGAAGGTGG - Intronic
1161465964 19:4430637-4430659 CAGAGGTGAGGGAGTGAAGGGGG + Exonic
1161977591 19:7615104-7615126 CAGGCTGGGTGGAGGGAAGATGG + Intronic
1162003621 19:7763722-7763744 CAGAGGTGGGGGTTGGAAGCTGG + Intronic
1162067146 19:8132826-8132848 AAGAGGAGGAGGAGGGAAAAGGG - Intronic
1162315910 19:9937706-9937728 CAGAGGTGGAGGAGGGGGGCGGG + Intergenic
1162318272 19:9954490-9954512 CTCAGGAGGTGGAGGCAAGAGGG + Intergenic
1162756424 19:12863286-12863308 CAGAGGAGGAGGAGAGAAGGGGG + Intronic
1162878759 19:13641130-13641152 CCGTAGTGGTGGAGGGAAGTAGG - Intergenic
1163236677 19:16034088-16034110 CAGAGGTGGGGGAGGGGTGAGGG + Intergenic
1163458708 19:17423879-17423901 CAGAGTTGGGAGAGGGAAGTAGG - Intronic
1163779570 19:19239439-19239461 GAGAGGAGGGGGAGGGAGGATGG - Intronic
1164250127 19:23468686-23468708 AAGAGGAGAAGGAGGGAAGAAGG - Intergenic
1164412967 19:28020987-28021009 CAGCTCTGGTGGAGGGAAGAGGG - Intergenic
1164517464 19:28948406-28948428 CAGCTCTGGTGGAAGGAAGAGGG - Intergenic
1164686216 19:30168392-30168414 CAGGGGGCGTGTAGGGAAGAGGG - Intergenic
1164690514 19:30207548-30207570 CAGAGGAGGTGGAGCGGAAAGGG + Intergenic
1164735875 19:30540523-30540545 CTGAGGTGCTGTAGGGATGAAGG - Intronic
1165135077 19:33662676-33662698 AGGAGGTGGTGAAGGGAGGAGGG + Intronic
1165151940 19:33766197-33766219 TAGAGGTGGAGGAGGGGAGAAGG - Intronic
1165176511 19:33934377-33934399 CAGAGGTGGCCAAGGGAAGGTGG + Intergenic
1165282615 19:34810038-34810060 CGGGGGTGGTGGAGGGGAGAAGG - Intergenic
1165554315 19:36616974-36616996 CAGAGGTGGTGAGAGGAGGAAGG + Intronic
1165574989 19:36807943-36807965 CCCAAGTGGTGAAGGGAAGATGG - Intergenic
1165599868 19:37044950-37044972 CCCAAGTGGTGAAGGGAAGATGG + Intronic
1165831028 19:38730369-38730391 CAGAGGTGGAGGTGGGCTGATGG + Exonic
1165915700 19:39257995-39258017 GAAAGATGGTGGAGGGAGGAAGG - Intergenic
1166642631 19:44507076-44507098 GGGAGGTGGTGTGGGGAAGAAGG - Intronic
1166647659 19:44544076-44544098 CTGAGTTGGTGGAGAGTAGATGG - Intergenic
1166975629 19:46603515-46603537 ATGAGGTGGGGGAGGGAAGAGGG - Intronic
1167106758 19:47434753-47434775 CAGAGCTGCTGGAGGGGTGAGGG - Intronic
1167148067 19:47694468-47694490 CAGAGGAGGTGGAGGATGGAGGG - Exonic
1167234590 19:48306269-48306291 CAGAGGTGGAGGAGAGGATAAGG + Exonic
1167934692 19:52896864-52896886 GAGACGTGGTGGAAGGAGGAGGG - Intronic
1167980773 19:53273072-53273094 CAGAGGTGCTGGAGGCATGGAGG + Intergenic
1168020709 19:53606832-53606854 CAGATGGGGAAGAGGGAAGAGGG - Intergenic
1168127393 19:54293374-54293396 AGCAGGTGCTGGAGGGAAGAGGG + Intergenic
1168172964 19:54601474-54601496 AGCAGGTGCTGGAGGGAAGAGGG - Intronic
1168271826 19:55254346-55254368 CAGAGCTGGTGGAGGGAGAGCGG - Intronic
925056863 2:863063-863085 AAGAGAAGGTGGAGGGAGGAAGG - Intergenic
925060153 2:884761-884783 CAGTGGTGGTGCTGGGAAGATGG + Intergenic
925222879 2:2156670-2156692 CAGAGGTGAAGGAAGGAAGGAGG + Intronic
925391674 2:3499389-3499411 GAGAGGAGGTGGAGGGTACATGG - Intronic
925948307 2:8887253-8887275 AGGGGGTGGTGGAGGGAAGGAGG - Intronic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926400402 2:12490698-12490720 CAGAGGAGGAGGAGAGAAGTGGG - Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
926676546 2:15627900-15627922 GAGATCTGGGGGAGGGAAGAAGG - Intronic
926697724 2:15782454-15782476 CAGGGGTGGGAGAGGGAGGATGG - Intergenic
927183787 2:20467742-20467764 CAGAGCTGGTGGGAGGAGGAAGG + Intergenic
927188088 2:20496994-20497016 CAGAGGTGGTGGAGAGCACGGGG + Intergenic
927441212 2:23119348-23119370 CACAGATGGTGGAGGGAGGCTGG + Intergenic
927486548 2:23492040-23492062 CAGAGGAACTGGAGGGAAAAAGG - Intronic
927506916 2:23620756-23620778 CAGAGGTGGGAGAGGGAGGCAGG + Intronic
927517264 2:23679780-23679802 CAGAGGGTGTGGGAGGAAGAGGG + Intronic
927557890 2:24049029-24049051 CAGAGCTGGGGGAGGGAGGGAGG - Intronic
927654335 2:24932782-24932804 CAGAGGTGGCAGATGGAAGGAGG + Intergenic
927720036 2:25376661-25376683 CAGAGGTGGGTGAGGGATGCTGG + Intergenic
928200109 2:29242521-29242543 CAGATGTGGTTGAGGGGAGCGGG - Intronic
928535190 2:32233119-32233141 GAGGGGTGGGGGAGGGAGGAAGG + Intronic
929505508 2:42525099-42525121 CACAGGTGGGGGAGGGGGGAGGG - Intronic
929562210 2:42963014-42963036 CAGGGAGGGAGGAGGGAAGAGGG - Intergenic
929781925 2:44962585-44962607 CAGAGGTGGGGGTAGGAAGGAGG - Intergenic
929791046 2:45023439-45023461 CAGGGCTGGTGGAGGGATGCTGG - Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929895957 2:45960996-45961018 CAGAGGGGCTGGAAGCAAGAGGG + Intronic
930064510 2:47317407-47317429 ATGAGATGGTGGAGGGAGGAAGG - Intergenic
930087305 2:47506851-47506873 TAGGGGTGGTGCAGGGGAGAGGG + Intronic
930395165 2:50813769-50813791 AAGAGATTGTGGCGGGAAGATGG - Intronic
931267545 2:60673870-60673892 AAGAGTTAGTGGAGGGAAAATGG + Intergenic
931581924 2:63785271-63785293 CAGAGGGGGAGAAGGGAGGAAGG - Intronic
932016588 2:68034314-68034336 CAGAGGTGGGAGTGGGGAGAGGG + Intergenic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
932246738 2:70202757-70202779 CAGAGCTGGTGGAGGTAATTCGG + Intronic
932265190 2:70361633-70361655 CAAAGGTGGAGGAAGGAAAAAGG - Intergenic
932561605 2:72876757-72876779 TAGAGGAGGGGGAGGGAAGTTGG - Intergenic
932637737 2:73407146-73407168 CTGAGGTGGTGCAGGGCACATGG + Intronic
932702098 2:73999155-73999177 TAGAGCTGGTAGAGGGTAGAGGG - Intronic
932770857 2:74500051-74500073 CAGGGGTGGGGTGGGGAAGAGGG - Intronic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
933518406 2:83335946-83335968 TAGGGATGGTGGAGGGGAGAAGG - Intergenic
933711597 2:85330170-85330192 CAGAGGCTGGGAAGGGAAGATGG + Intergenic
933758259 2:85657546-85657568 CAGAGGCTGTGGGGAGAAGATGG + Intronic
934560670 2:95311715-95311737 CAGAGGTGGTGGTGGCAAAAGGG - Intronic
935039772 2:99415064-99415086 CGGAGGTGGGGGAGGGAGGCAGG + Intronic
935106120 2:100045149-100045171 CAGAGGTGGGGAAGGGGAGGAGG + Intronic
935844957 2:107155671-107155693 TGGAGGTGGAGGAGGGAGGAGGG - Intergenic
936009550 2:108916703-108916725 CCGAGGAGGTGGGGGCAAGATGG + Intronic
936069736 2:109358051-109358073 CAGGGGTGGTGGAGGAGGGAGGG - Intronic
936090313 2:109497947-109497969 AAGAGGTGGAGGATGGCAGAAGG + Intronic
936600529 2:113890355-113890377 CTGAGGCGGAGGAAGGAAGATGG + Intronic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937305609 2:120868710-120868732 GAGAAATGGTCGAGGGAAGAGGG + Intronic
938081992 2:128374964-128374986 CACAGGTGGTGCAGGGGAGGTGG + Intergenic
938777990 2:134559019-134559041 CAGAGGAGGTGGAACTAAGAGGG - Intronic
938792974 2:134692951-134692973 CTGAGGTGCTGGAAGAAAGATGG - Intronic
938949183 2:136241517-136241539 CAGACTTGGTGGAGGTGAGAAGG - Intergenic
939602250 2:144207439-144207461 TAGAGGTACTGGAGGCAAGATGG + Intronic
939606625 2:144262695-144262717 GAAAGGTAGGGGAGGGAAGAGGG + Intronic
939680785 2:145129515-145129537 CAGAGGTGGAGGAGGTTGGAGGG - Intergenic
939767458 2:146268849-146268871 GAAAGGTGGTGGAGGGGAAAAGG + Intergenic
940573729 2:155472626-155472648 CAGAGGGGGAGGAGCCAAGATGG - Intergenic
940962391 2:159799882-159799904 CAGGGGTTGGGGTGGGAAGAAGG + Intronic
941596289 2:167480839-167480861 CAGAGCAGGTTCAGGGAAGACGG + Intergenic
942301095 2:174563330-174563352 GAGAGGTTGAGGAGGGATGATGG + Intronic
942454688 2:176129846-176129868 AAGAGGTGGCGGCGGGCAGAGGG + Exonic
942759898 2:179385753-179385775 CAGAGGGGGAGGAGCCAAGATGG + Intergenic
942992717 2:182221108-182221130 AGGAGGTGGTGGAGGAAAGGAGG - Intronic
943046460 2:182867000-182867022 CAGAGGGGTTGGGGGGAAGGAGG + Exonic
943309929 2:186312989-186313011 CAGAGGGGGCGGAGCCAAGATGG + Intergenic
944169588 2:196760061-196760083 CACAGGAGGTGGTGGGGAGAGGG - Intronic
945269171 2:207921663-207921685 TAGAGGTGGGGAAGGGTAGAGGG - Intronic
945711570 2:213303527-213303549 CAGAGGCTGGGGAGGGGAGAGGG - Intronic
945805372 2:214483959-214483981 TAGAGTTTCTGGAGGGAAGATGG - Intronic
945997540 2:216450744-216450766 CAGGGGTGGTTGTGAGAAGAGGG + Intronic
946026187 2:216673255-216673277 CAGAGGTGGTGGTGGGGAGATGG + Exonic
946033711 2:216725205-216725227 CATAGGTGTGGGAGGCAAGAAGG - Intergenic
946085323 2:217164580-217164602 CAGAACTGGGGGAGTGAAGATGG + Intergenic
946698161 2:222383130-222383152 CAGGAGTGGTAGAGGCAAGAAGG - Intergenic
946899106 2:224355309-224355331 AGGAGGAGGAGGAGGGAAGAAGG - Intergenic
947534642 2:230933189-230933211 CAGAGAGGGCGGAGGGAAGGGGG - Intronic
947808997 2:232988166-232988188 CAGTGGTGGGGGAGGGAGCAGGG - Intronic
947922666 2:233891692-233891714 CAGGGGAGGTAGAGGGCAGAAGG + Intergenic
948047930 2:234957931-234957953 CAGACCTGTTGGGGGGAAGATGG - Intronic
948049937 2:234972463-234972485 TAGAGATGGAGGAGGGAGGAGGG + Intronic
948383098 2:237564465-237564487 CACAGGTGGAGGAAGGAGGAGGG + Intergenic
948458681 2:238118898-238118920 CGGAGGAGGTGGATGGAGGAGGG + Intronic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
948647824 2:239419257-239419279 CAGAGATGCTGGAGGGGAGATGG + Intergenic
1168835464 20:874427-874449 CAGAGGTGGTGGTGGCAGAAGGG + Intronic
1169405932 20:5321261-5321283 GAGAGGCGGTGGTGGGAGGAAGG + Intergenic
1169770208 20:9191741-9191763 TGGAGGTGCTGGAGGGGAGAAGG - Intronic
1169791364 20:9413863-9413885 GAGGGGTGGAGGAGGGAGGATGG - Intronic
1169955444 20:11097753-11097775 AAGATGAGGTGGAAGGAAGAAGG - Intergenic
1169956925 20:11114012-11114034 CAGATGGGGTGGAGCAAAGAAGG - Intergenic
1170276250 20:14593382-14593404 GTGAGGTGAGGGAGGGAAGAAGG + Intronic
1170327345 20:15171296-15171318 CAGTGGTGGAGGAGGAGAGATGG - Intronic
1170752051 20:19158224-19158246 GAGAGGTGGGGGAGGAGAGAGGG - Intergenic
1171298712 20:24040906-24040928 TAGAGGTGGAGGAGGGTACAGGG - Intergenic
1171337245 20:24395415-24395437 CAGAGGTGGTGGGGGTCAGGGGG + Intergenic
1171781046 20:29417987-29418009 CAGCAGTGGGGGAGAGAAGAAGG - Intergenic
1172374811 20:34429911-34429933 TAGAGGAATTGGAGGGAAGAAGG + Intronic
1172473749 20:35221560-35221582 GAAAGGAGGTGAAGGGAAGAGGG + Intergenic
1172690431 20:36785943-36785965 AGGAGGTGGTGGAGAGAAGGAGG + Exonic
1172747351 20:37222238-37222260 CAGTGGAGGAGGAGGGACGATGG - Intronic
1172780264 20:37432632-37432654 CAGAGATGGGGGTGGGAACAAGG - Intergenic
1172789217 20:37490980-37491002 CAGAGAGTGTAGAGGGAAGATGG - Intergenic
1172956406 20:38762652-38762674 TAGAGTTGGTGGAGGGATGACGG + Intronic
1173062059 20:39672096-39672118 CAGAAGAGGTGGAGGAGAGAGGG - Intergenic
1173226272 20:41164019-41164041 CAGGGCTGGGGGAGGGAAGATGG + Intronic
1173230945 20:41197073-41197095 CAGGGCTGATGGAGAGAAGAAGG + Intronic
1173262743 20:41451240-41451262 CACAGGTGGTGGTGGTAGGAAGG + Intronic
1173648579 20:44649045-44649067 CAGAGGTAGTTTAGGAAAGATGG + Intronic
1173810294 20:45951263-45951285 CAGAGGTTGGAGAGGGAAGCAGG - Intronic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174535090 20:51245210-51245232 CATAGGTGGTTGGGGGAAGAAGG + Intergenic
1174625136 20:51907886-51907908 CAGAGGTTGTGGTAGGAGGATGG + Intergenic
1175014538 20:55775210-55775232 GGAGGGTGGTGGAGGGAAGAGGG + Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175530692 20:59672734-59672756 GAGAGATGGTGGAGGGAAGGAGG - Intronic
1175534874 20:59702582-59702604 CAGAGGTGGGGGACAGATGATGG - Intronic
1175605096 20:60306259-60306281 CAGATAAGGTGGAGGGAAGGAGG + Intergenic
1175828828 20:61951115-61951137 CAGGGCTGGGGGAGGGGAGAGGG - Intergenic
1175828847 20:61951150-61951172 CAGGGCTGGGGGAGGGGAGAGGG - Intergenic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1175990260 20:62785250-62785272 CAGAGGTGGGGGATGGAGGGTGG + Intergenic
1176062873 20:63179898-63179920 CTGGGGTGGGGGTGGGAAGATGG - Intergenic
1176093040 20:63327403-63327425 CAGACGTGGTGGAGGGGAGGTGG + Intronic
1176201974 20:63865181-63865203 CACTGGTGGGGGCGGGAAGAAGG + Intergenic
1176252141 20:64130425-64130447 CAGAAGTGGTGGAGGCTGGAGGG + Intergenic
1176298735 21:5088511-5088533 CTGGGGTGGTGAAGGGGAGAGGG - Intergenic
1176349936 21:5785136-5785158 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1176356750 21:5905720-5905742 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1176544257 21:8183206-8183228 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1176563208 21:8366251-8366273 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1176659663 21:9622466-9622488 TGGAGTTGGTGGAGGGGAGATGG + Intergenic
1176716659 21:10356194-10356216 CAGATTTGGTGGGGGGATGAAGG - Intergenic
1176809008 21:13517708-13517730 CAAAGGTGGTTGAGAAAAGAAGG + Intergenic
1177651006 21:23962015-23962037 CGGGGGTGGTGGTGGCAAGAAGG + Intergenic
1177815954 21:25976926-25976948 CATATATGGTGGAAGGAAGAAGG - Intronic
1177877929 21:26657421-26657443 CAGAGGTGGAGGAGGTAGAAGGG - Intergenic
1178797521 21:35758630-35758652 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
1178901963 21:36605641-36605663 GAGAGCTGGTGGAGGGGAGTAGG + Intergenic
1179026532 21:37683446-37683468 CAGAGGAGGAGGAGGGGAGAAGG - Intronic
1179373405 21:40827966-40827988 CAGAGGAATTGGATGGAAGAAGG + Intronic
1179713351 21:43275409-43275431 CAGAGCAGATGGAGGGAGGAGGG - Intergenic
1179858291 21:44173438-44173460 CTGGGGTGGTGAAGGGGAGAGGG + Intergenic
1180041240 21:45281395-45281417 CAGAGGTTGTGGAGGGAGCTAGG - Intronic
1180046611 21:45309162-45309184 CAGAGCTGGAGGAGGCAGGAAGG + Intergenic
1180614601 22:17119493-17119515 CGGAGGTGGTGGAGGGGCGGAGG + Exonic
1181022887 22:20112789-20112811 CAGAGGCTGTGGGGGGAAAAGGG + Exonic
1181371777 22:22424746-22424768 CAGAGATGTGGGAGGGGAGAGGG - Intergenic
1181483395 22:23215574-23215596 CAGATATGGTTCAGGGAAGATGG + Intronic
1181720536 22:24771033-24771055 CAGGGGTGGTGAAGGGTACAGGG - Intronic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1182254802 22:29030733-29030755 CAGGGCTGGTGGAGGGGAGGAGG + Intronic
1183272064 22:36868497-36868519 CAGAGGAGGTGGGAGGAAGGAGG + Intronic
1183298226 22:37044466-37044488 GAGACGGGGTGGAGGGTAGAAGG + Intergenic
1183316343 22:37139052-37139074 CAGAGGAGGTGGAAGGAAGGAGG + Intronic
1183385440 22:37511487-37511509 CAGAGTGGGAGGAGGAAAGAAGG + Intronic
1183436960 22:37802010-37802032 CACAGGTGGTGCAGTGAACAGGG + Intergenic
1183440315 22:37819179-37819201 GAGCGGAGGTGGAGGGAAGGAGG - Intergenic
1183441574 22:37825749-37825771 AAGAGGTGGTGGAGGAAGCAGGG - Intergenic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1183576939 22:38697192-38697214 AAGAGGTGAGGGAGAGAAGATGG - Intronic
1184153772 22:42653616-42653638 CAGAGCAGGTTGAGGGAAGTTGG + Intergenic
1184389946 22:44197599-44197621 CATAAGTGGTGGAGGCAGGAGGG - Intronic
1184593781 22:45502602-45502624 GAGAGGGGGTGGGGGGAGGAGGG + Intronic
1184765313 22:46569204-46569226 CAGAGGCTGGGGAGGGAGGATGG + Intergenic
1185166137 22:49263469-49263491 CAGGGGTGGTGGAGGGGACGGGG - Intergenic
1185324351 22:50218398-50218420 CAGGGCTGGCGGAGGGCAGAAGG + Exonic
1203249126 22_KI270733v1_random:99444-99466 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
949382827 3:3465011-3465033 GGGAGATGGGGGAGGGAAGAGGG + Intergenic
950153196 3:10704045-10704067 CAGAGGGAGTGAGGGGAAGATGG - Intronic
950175936 3:10874444-10874466 CAGAGGGGGTAAAGGAAAGAAGG - Intronic
950260029 3:11536815-11536837 CACAGCTGCTGAAGGGAAGATGG - Intronic
950398164 3:12750003-12750025 CCGGGGTAGTGGAGGGAGGAGGG + Intronic
950448317 3:13051187-13051209 CAGAGGTGAAGGATGGAGGAGGG - Intronic
950542851 3:13622455-13622477 CAGAGCTGGTGGATGGAGGATGG + Intronic
950703355 3:14765673-14765695 CAGAGCAGGTGCAGGGAAGCTGG + Intronic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
951607712 3:24454351-24454373 CAGAGCTGGAGGAGGGAATGAGG + Intronic
951710676 3:25582666-25582688 GAGAGGTGCTGGAGGCAGGAAGG - Intronic
951719173 3:25679715-25679737 CAGAGGAGGGGGAGAGAGGAGGG + Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952858778 3:37795002-37795024 CAGGTGTGGGGGAGGGAGGAGGG - Intronic
952894525 3:38068976-38068998 CAGATATGGGAGAGGGAAGAGGG + Intronic
953041358 3:39257553-39257575 CAGAGGTTAGGGAGGCAAGAAGG + Intergenic
953154837 3:40360315-40360337 CAGATGTTGGGGATGGAAGAGGG + Intergenic
953336397 3:42098037-42098059 GAGAGATGGAGGAGAGAAGAGGG - Intronic
953459793 3:43073109-43073131 CAGAGGTGGTGTTGGTTAGAGGG + Intergenic
953705833 3:45229504-45229526 CAGAGCAGGTGAAGAGAAGAAGG - Intergenic
954110449 3:48430105-48430127 CAGAGGTGGGGGCCGGAAGGAGG - Intergenic
954195430 3:48994053-48994075 CAGATGTGTGAGAGGGAAGAGGG + Intronic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
954524679 3:51259560-51259582 CAGATGTCTTGGTGGGAAGAGGG + Intronic
954845778 3:53554500-53554522 CAAAGGTGGTGGCACGAAGAAGG - Intronic
954948339 3:54446401-54446423 CACAGGTGGTGAAGGGCAGAGGG + Intronic
954983382 3:54767026-54767048 GGGAGGTGGTGCAGAGAAGATGG - Intronic
955598671 3:60620639-60620661 CAGAGGAGGGGGAGGGAAAGAGG + Intronic
955778821 3:62462336-62462358 GAGAGGAGCTGGAGGGAGGAGGG - Intronic
956276705 3:67509953-67509975 GAGAGATGGAGGTGGGAAGAAGG + Intronic
956724634 3:72146675-72146697 CAGAGGTGGGCAACGGAAGACGG + Intergenic
957867030 3:86039078-86039100 CAGAGGGGGTGGAGCCAAGATGG + Intronic
958833251 3:99114963-99114985 CAGAGGGGCTGGAGCTAAGATGG + Intergenic
959539704 3:107524611-107524633 CAGAGGGGGGGGGGGGGAGAGGG + Intronic
959755280 3:109890018-109890040 GATAGGGGGTGGAGGGTAGAAGG - Intergenic
959903455 3:111685015-111685037 TAGAGGTGGTGGAAGGAAGCAGG + Intronic
960536569 3:118822077-118822099 GAGAGGTGGGGGTGGGAAGGAGG - Intergenic
960662912 3:120080301-120080323 GGGAGGAGGGGGAGGGAAGAAGG + Intronic
961153452 3:124659062-124659084 CTGAAGTGGTGGAGAGAATAAGG + Intronic
961365201 3:126395148-126395170 CAGATGGGGTGGATGGTAGATGG - Intronic
961391257 3:126553461-126553483 CAGGGGTGGTGGGGGGCAGAAGG + Intronic
961430083 3:126875212-126875234 CAGAGCAGGAAGAGGGAAGAAGG + Intronic
961470811 3:127110380-127110402 CAGAGATGGGTGAGGGAAGAAGG + Intergenic
961563697 3:127748364-127748386 CAGAGGTGGGAGAGGGAGGAGGG + Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961635946 3:128332704-128332726 CAGAGGTGGTGCTGGGGAGCTGG + Intronic
962841683 3:139238445-139238467 CACAGGGGGAGGAGAGAAGACGG - Intronic
962958512 3:140288665-140288687 CAGTGGTGTTGGTGGGAAGCAGG - Intronic
963108432 3:141665681-141665703 GAAAGGAGGGGGAGGGAAGAAGG + Intergenic
963337748 3:143996603-143996625 AGGAGGTGGTGGAGGGACCAGGG + Intronic
963742938 3:149097892-149097914 GAGAGGTGGGGGAGGGAGGAGGG + Intergenic
963765796 3:149334845-149334867 CAGAGGTGGTAAAAGGAAGCTGG + Intergenic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
963847768 3:150177439-150177461 AAGAGGAGGTGTATGGAAGAGGG + Intergenic
964148310 3:153493172-153493194 CAGAGGCTGTGAAGGGTAGAAGG + Intronic
964362483 3:155913111-155913133 CAGAGGAAGTGGTAGGAAGAGGG - Intronic
964603142 3:158526186-158526208 CAGAGGTGGGGTAGGGAGGATGG - Intronic
964646973 3:158968957-158968979 GAGATGGGGTGAAGGGAAGAAGG + Intronic
965528595 3:169747818-169747840 TAGGGGTGGTGGAGGGAAGGGGG - Intergenic
965759469 3:172060339-172060361 TAGTGGTGGTGGTGGGCAGAGGG + Intronic
966144271 3:176791760-176791782 CAGAGGCTGAGGCGGGAAGATGG + Intergenic
966168059 3:177043947-177043969 AAAAGGTAGGGGAGGGAAGAGGG - Intronic
966400580 3:179543220-179543242 CAGAGGTTGGGAAGGGTAGAGGG - Intergenic
966695867 3:182790551-182790573 GAGAGATGGTGGAGCAAAGAGGG - Intergenic
966921292 3:184613296-184613318 CAGAGGTTCTGGAGGGAATGAGG - Intronic
967459776 3:189732252-189732274 CAGGGGTGGTGGAGGGGAGTTGG - Intronic
967870352 3:194224232-194224254 CAGAGGAGGTGGAGGTAGGGGGG - Intergenic
967962822 3:194939406-194939428 CAGGGGAGGTAGAGGGGAGACGG + Intergenic
967976943 3:195040822-195040844 CACAGGTGTTGGAGGGGACAGGG - Intergenic
968086941 3:195878045-195878067 AAAGGGTGGTGGAGGGAAGCTGG + Intronic
968663153 4:1807054-1807076 CAGAGGTGGCTGTGCGAAGAGGG + Intronic
969186668 4:5479515-5479537 CAGTGGAGGTGGAGTGGAGATGG + Intronic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
969564539 4:7970328-7970350 CAAAGGTGCTGGTGGGCAGAGGG + Intronic
970411174 4:15809252-15809274 GGGAGGTGGTGGAGGGAATCAGG + Intronic
971489371 4:27194837-27194859 CAGAGTGGGTGAAGGGGAGATGG + Intergenic
971845268 4:31910983-31911005 CAGAGGTGGAGAAAGGTAGAGGG - Intergenic
972581960 4:40403093-40403115 AAGAGGTGGGGGAGATAAGACGG - Intergenic
972594010 4:40514414-40514436 CAGGGATGGTGAGGGGAAGACGG - Intronic
972603643 4:40594159-40594181 CAGTGCTGGTGGAGGAAACAGGG - Intronic
972734892 4:41830810-41830832 CAGAGGTGGGTGTGGGAGGAAGG + Intergenic
973913947 4:55613839-55613861 CAGGGGTGGTGGAGGCAACCGGG - Intronic
973960588 4:56105971-56105993 CAGAGCTTGGGGATGGAAGAAGG - Intergenic
973966222 4:56164642-56164664 CAGAGGTTGGGGACGGAGGATGG + Intergenic
974699886 4:65427618-65427640 CAAAGGTGGAAAAGGGAAGAGGG + Intronic
975810890 4:78168434-78168456 CAGGGGTGCTGCAGGGAAGTGGG - Intronic
975827175 4:78331984-78332006 CAGAGGTGATGGGGGGAACATGG + Intronic
975895365 4:79083793-79083815 CAGATGGGATGGAGGGAGGACGG - Intergenic
976201569 4:82584763-82584785 CAGAGGTGGTGGAGGGGAGGGGG - Intergenic
976869518 4:89774183-89774205 CAGAGGTGGAGCTGGGAAGCTGG - Intronic
977029573 4:91864441-91864463 CATAGGGGGTGGAGCCAAGATGG - Intergenic
977220884 4:94336437-94336459 CAGATGTTGTGGAGTGAAGCTGG + Intronic
977226574 4:94398894-94398916 CAGAAATGGAGGAGGGAAGAGGG - Intergenic
977355226 4:95937982-95938004 AGGAGGTTGGGGAGGGAAGAGGG + Intergenic
977429761 4:96916596-96916618 CAGACGGGGTGGAGGGCGGATGG + Intergenic
977537396 4:98270773-98270795 CAGAGGTGGAGGAGGTAAAAGGG - Intronic
977620911 4:99136059-99136081 CAGGGGTGGTTGTGTGAAGATGG + Intronic
978384923 4:108168987-108169009 TAGAGGCGGGGGAGGGGAGAGGG - Intergenic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
979145826 4:117246575-117246597 CAGAGGAGGCAGAGGGAACAGGG + Intergenic
980281208 4:130722651-130722673 TAGTGCAGGTGGAGGGAAGAGGG - Intergenic
980448755 4:132944405-132944427 CAGAGGAGGAGGAGCCAAGATGG + Intergenic
981280938 4:142957799-142957821 CAGAGGAGATGGAGGGCGGATGG - Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981636052 4:146880556-146880578 AAGATGTTGTGCAGGGAAGAGGG - Intronic
981691644 4:147515359-147515381 CTGTGGTGGTGGGGGGAAGGGGG + Intronic
982081351 4:151793331-151793353 CAGAGGAAGTGGATCGAAGAAGG + Intergenic
982090600 4:151876816-151876838 CAGAGTTTCTGGAGGAAAGATGG - Intergenic
982176814 4:152713443-152713465 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
982241956 4:153308839-153308861 CAGAGGTGGGGCAGGGGAGAGGG - Intronic
982693954 4:158579060-158579082 CAGAGATGCTGGAGAGAAGAGGG + Intronic
982710688 4:158755949-158755971 GAGAGGAGGGGGAGGGAAGAGGG - Intergenic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
983562549 4:169115688-169115710 CAGGGGTGGTGGCGGGGAAATGG - Intronic
983711789 4:170726199-170726221 GTGAGGTGGTGGAAGGAAGGTGG + Intergenic
983850153 4:172570278-172570300 GAGAGGTGGAGGATGGGAGAAGG + Intronic
984067752 4:175070107-175070129 CAGAGATGGGGCAAGGAAGAGGG + Intergenic
984287389 4:177749569-177749591 CAGAGGTGGGTGAGGGTAGAGGG - Intronic
984534947 4:180962821-180962843 GAGAGGTGGAGCAGGTAAGAGGG + Intergenic
984616823 4:181907577-181907599 GAGACGTGGAGAAGGGAAGAGGG + Intergenic
984824278 4:183910499-183910521 CAGGGCTGGGGGAGGGGAGAGGG - Intronic
985020476 4:185683737-185683759 TAGAGGTGGTGAACGGAAGTGGG + Intronic
985415707 4:189733949-189733971 TGGAGTTGGTGGAGGGGAGATGG - Intergenic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
985432413 4:189893940-189893962 CAGAGGGGGTGGGGGGGAGGCGG + Intergenic
985675640 5:1230042-1230064 TGGAGGTGGGGGAGGGAAAAGGG + Intronic
985874842 5:2586784-2586806 CATAGGTGGTGGAGAGTGGAGGG + Intergenic
986009049 5:3695443-3695465 TGGGGGAGGTGGAGGGAAGAAGG - Intergenic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
987373909 5:17217452-17217474 TGGAGGGGGTGGAGGGGAGACGG + Intronic
987569498 5:19638009-19638031 CAGAAGTTGTGAAGAGAAGATGG - Intronic
987650667 5:20736442-20736464 AAGAGGTGATGGAGAGAGGAAGG - Intergenic
987865419 5:23529459-23529481 CAGGGGTGGTGCAGAGAAGAAGG + Intergenic
987875880 5:23680663-23680685 AGGAGATGGAGGAGGGAAGAGGG + Intergenic
988852356 5:35192358-35192380 AAGAGGTGGGGGAGAGAGGAGGG - Intronic
989098045 5:37799006-37799028 CAGAGAAGATGGAGGGCAGAGGG + Intergenic
989234720 5:39133402-39133424 CGGAGGTGTTGGAGGAAAGAAGG + Intronic
989809652 5:45658437-45658459 CAGAGGGGGAGGAGCCAAGATGG + Intronic
990367036 5:55081484-55081506 CAGCGGGGGTGGAGCCAAGATGG - Intergenic
990510669 5:56486631-56486653 CAGAGGTGGTAGAAGCCAGAAGG + Intergenic
990522083 5:56589900-56589922 CACAGGAGGGTGAGGGAAGAGGG + Intronic
990626124 5:57613310-57613332 AGGAGGTGGGGGAGGCAAGAAGG + Intergenic
990980465 5:61598295-61598317 CACAGGTGGTGGCGGGAGCAGGG + Intergenic
991304633 5:65164014-65164036 CAGAGGGGGAGGAGCCAAGATGG + Intronic
992118371 5:73564913-73564935 AAGAGGTGGTGGTGAGAAAAAGG + Intronic
992521453 5:77556071-77556093 CAAAGGTGGTGGGGAAAAGATGG + Intronic
993131164 5:83900080-83900102 TAGTGGTGGTGGTGGGAGGATGG - Intergenic
994245608 5:97472027-97472049 CAATGGTGGTGCAGGCAAGAGGG + Intergenic
994544443 5:101146130-101146152 AGGATGTGGTGCAGGGAAGAGGG - Intergenic
994664345 5:102689555-102689577 AAAAGGTGGTGGAGCCAAGATGG - Intergenic
995289560 5:110435605-110435627 CAGAGGTAGTGAAGGGTAGAGGG - Intronic
995442737 5:112209987-112210009 CAGAGGAGGAGAAGGAAAGATGG + Intronic
996404773 5:123094328-123094350 CAGAGGAGGCGCAGGGCAGAAGG - Intronic
996682505 5:126243114-126243136 CAGAGATAGTGGAGGCCAGAAGG - Intergenic
996760529 5:126982293-126982315 CAGACATGGTATAGGGAAGATGG - Intronic
996798358 5:127375632-127375654 CAGAGCTAGAGCAGGGAAGAGGG - Intronic
996950608 5:129120824-129120846 CACATGTAGTGGTGGGAAGAAGG - Intergenic
997208954 5:132066600-132066622 GAGAGGTGCTGGAGGAAATAGGG + Intergenic
997297214 5:132776127-132776149 CAGGGCTGTTGGAGGGAAGGGGG - Intronic
998240791 5:140442412-140442434 CACACGTGGGGGAGGGAGGAGGG + Intronic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
999367352 5:151031764-151031786 CAGAGGCCGTGGTGGGAGGAGGG - Intronic
1000393670 5:160750588-160750610 CAGTGATGGTGGAGGGAAAGAGG - Intronic
1000828568 5:166075771-166075793 GAAAGGGGGAGGAGGGAAGAAGG + Intergenic
1000908493 5:166993021-166993043 CAGGAGTGGGGGAGGGGAGAGGG - Intergenic
1001682490 5:173569267-173569289 GGGAGGGGGTAGAGGGAAGAAGG + Intergenic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001923200 5:175616917-175616939 CAGTGGTGATGGAGGGACAAGGG + Intergenic
1001962841 5:175890640-175890662 CACAGGTGCAGGAGGGAGGAGGG - Intergenic
1002000500 5:176194105-176194127 CAGAGCTGGAGGAGGAATGAGGG + Intergenic
1002253836 5:177944876-177944898 CAGAGCTGGAGGAGGAATGAGGG - Intergenic
1002297860 5:178241357-178241379 CAGAGGGGATGTGGGGAAGAGGG + Intronic
1002355651 5:178626993-178627015 CAGCGGCCGAGGAGGGAAGACGG - Exonic
1002457275 5:179352588-179352610 CAAAGGTGGTGGAGGGTGGAAGG + Intergenic
1002466826 5:179412392-179412414 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002466927 5:179412622-179412644 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002517117 5:179766823-179766845 CCGAGGTAGTTGTGGGAAGAGGG + Intronic
1003358556 6:5399598-5399620 CAGAGGTGGTGGAAACAGGATGG - Intronic
1003584683 6:7376686-7376708 CAGAGTTGGAGGAAGGAGGAGGG - Intronic
1003793176 6:9570090-9570112 AAAAGATGGTGGAGGGTAGATGG - Intergenic
1003829181 6:9987817-9987839 CTGAGGTGGGGGAGCGAAGATGG + Intronic
1003876997 6:10446777-10446799 CAGAGGCGGAGGTGGGAGGATGG - Intergenic
1004009130 6:11664739-11664761 TAGAGGTGGTGGAGGACAGAAGG + Intergenic
1004374284 6:15078178-15078200 CACAGGTGGTGGAGGGGGGTGGG + Intergenic
1004800253 6:19138711-19138733 CAGAGGAGGAGTAGGAAAGAGGG + Intergenic
1005054442 6:21716735-21716757 CAGGGGTGTTGGTGGGAGGATGG + Intergenic
1005101933 6:22180856-22180878 CAGAGGGGGAGGAGCCAAGATGG - Intergenic
1005255378 6:23997269-23997291 CAGAGGTGGAGGAGGGGGAAGGG - Intergenic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1005473466 6:26184643-26184665 GTGAGGCGGTAGAGGGAAGAGGG - Intergenic
1006051452 6:31348058-31348080 TGGAGGTGGTGGAGGGCAGAGGG - Intronic
1006095994 6:31657199-31657221 CAGAGGTGGTGGTGGCAAGGAGG - Intronic
1006418655 6:33920043-33920065 CAGAGGGAGAGGATGGAAGAAGG + Intergenic
1006518467 6:34557427-34557449 CAGAGAAGGTTGAGGGAGGATGG + Intergenic
1006639738 6:35483773-35483795 CTGATGTGGTGGAGGGAGGGTGG - Intronic
1006662452 6:35658964-35658986 CAGAGGCTGAGGTGGGAAGACGG + Intronic
1007177923 6:39909219-39909241 CAGGGGAGGGGGAGGGGAGAGGG + Intronic
1007293772 6:40805959-40805981 CAGAGCTGGGGTAGGGAACAGGG - Intergenic
1007511988 6:42380886-42380908 CAGAAGTGGAGGAGGCAGGAGGG - Intronic
1007634087 6:43287604-43287626 GAGAGGTGGGGGAGGGAAAGTGG + Exonic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008874202 6:56307853-56307875 AAGAGGGGGTGGAGCCAAGATGG - Intronic
1008921740 6:56850117-56850139 AAGGGGAGGTGGAGGGAGGATGG - Intronic
1010044511 6:71425481-71425503 CAAAGGTGGGAGAGGAAAGAAGG + Intergenic
1010205242 6:73316615-73316637 CAAAGGTGGAGGCGGGCAGATGG + Intergenic
1010713417 6:79202344-79202366 CAGAGGTGCTAAAGGGAAGAAGG - Exonic
1010940213 6:81907882-81907904 TAGAGGTGGGGATGGGAAGAAGG - Intergenic
1011572156 6:88749856-88749878 TACAGGTGTTGGAGGGAACATGG - Intronic
1011923199 6:92608157-92608179 CAGAGGTGGGGAAAGGTAGAAGG + Intergenic
1012383280 6:98646425-98646447 GAGAAGTGGGGGAGGGAAGAAGG + Intergenic
1012818981 6:104061064-104061086 AAGAGATGGTGGAGAGGAGATGG + Intergenic
1013623074 6:111909222-111909244 CAGAGGTGCAGGAGGGCAGAAGG - Intergenic
1013734207 6:113206676-113206698 AAGCGAAGGTGGAGGGAAGATGG + Intergenic
1014152407 6:118072923-118072945 TGGAGGTGGAGTAGGGAAGATGG + Intronic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1014644390 6:123954991-123955013 CAGAAGGGGAGGAGGGGAGAAGG + Intronic
1014769458 6:125444787-125444809 CAGGGGTGGGGGTGGGGAGACGG - Intergenic
1015142463 6:129950436-129950458 CACAGGCTTTGGAGGGAAGAGGG + Intergenic
1015191308 6:130475509-130475531 CAGAATTGGTGGAGCCAAGATGG + Intergenic
1015218524 6:130777866-130777888 AAGAGGTGGAGGAGGGAAAACGG + Intergenic
1015229587 6:130899134-130899156 CAGAGGTGGGAGAGGGAACTGGG + Intronic
1015391610 6:132688838-132688860 CCAAGGTGCTGGAGGAAAGAGGG - Intronic
1015810827 6:137160579-137160601 AGGAGGAGGAGGAGGGAAGAAGG - Intronic
1016347588 6:143130865-143130887 GAGGGGTGGAGGTGGGAAGAGGG - Intronic
1016409337 6:143765564-143765586 CACAGGGGGTGGAGGGACCATGG - Exonic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1016942087 6:149490857-149490879 CAGAGGAGACGCAGGGAAGAAGG + Intergenic
1017081490 6:150673651-150673673 GAGAGGGAGGGGAGGGAAGAGGG - Intronic
1017390155 6:153929427-153929449 GAGGGGTGGTAGAGGGAGGAGGG - Intergenic
1017858783 6:158376108-158376130 GAGAGGAGGTGCAGGGAAAAGGG - Intronic
1018597299 6:165495335-165495357 GAGAGGGGGTGGAGGGGAAAGGG + Intronic
1019287339 7:230273-230295 CAGAGCTGGGAGAGGCAAGAAGG + Intronic
1019571341 7:1713879-1713901 GAGAGGTGGGGGAGGGGAGCCGG - Intronic
1019747151 7:2707391-2707413 CAGAGTTAGTGTAGAGAAGAGGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019783523 7:2958876-2958898 GAGATGGGGAGGAGGGAAGATGG + Intronic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1020009241 7:4799497-4799519 CAGAGGTGGGGGTGGGCAGGAGG + Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1020742188 7:12035026-12035048 CAGAGAAGGTGAAAGGAAGATGG + Intergenic
1021245174 7:18252912-18252934 CTGGGGTGGAGGATGGAAGAGGG - Intronic
1021337433 7:19420856-19420878 CAGTGTTGGTGAAAGGAAGAAGG + Intergenic
1021622570 7:22563191-22563213 GAGAGGTGTTGCAGGGAAAAAGG + Intronic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1022180297 7:27912558-27912580 CAGAGAGGGAGGAAGGAAGAGGG + Intronic
1022947081 7:35297238-35297260 CATAGGTGGTGGAGCACAGAAGG - Intergenic
1022965619 7:35468618-35468640 TAGAGGAGGTGGAGAAAAGAGGG - Intergenic
1023019376 7:35996884-35996906 AAGAGGTGGGGGAGAGACGAAGG - Intergenic
1023698291 7:42869812-42869834 AAGAAGTGGGGGAGGGCAGATGG - Intergenic
1023706491 7:42946745-42946767 CAGAGCTCATGGAGGGAAGTTGG + Intronic
1023708484 7:42967067-42967089 CAAAGGAGGAGGAAGGAAGAGGG - Intergenic
1023732629 7:43206629-43206651 GGGAGGTGGGGGAGGGAAGCTGG - Intronic
1023796026 7:43792963-43792985 CACAGATAGTGGAGGGCAGAAGG + Intronic
1023932087 7:44712253-44712275 CAGAGGTGTTGGAGGGAAATGGG + Intergenic
1023999383 7:45180724-45180746 CAGAGGTGGGTGGGGGGAGAGGG + Intronic
1024250656 7:47503372-47503394 CAGATGTTGGGGAGGGGAGAAGG - Intronic
1024306408 7:47932888-47932910 AAGAGGTGGTGGAGGCACGTTGG + Intronic
1026497090 7:70912642-70912664 GAGAGGTGGTGGGGGGCATATGG + Intergenic
1028465359 7:91145500-91145522 GAGAAGGGGTGGAGGGGAGAAGG - Intronic
1028963791 7:96778955-96778977 CAGAGGTGGAGAAGTAAAGATGG + Intergenic
1029166509 7:98595280-98595302 CACAGGTGGTGAAGGGAAAGGGG - Intergenic
1029438752 7:100576145-100576167 CAGAGGATGTGGAGGGAGGCTGG + Intronic
1029449650 7:100633592-100633614 CGGAGGAGAGGGAGGGAAGAGGG + Intronic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1029477041 7:100791360-100791382 AAGAGGAGGAGGAGGAAAGAAGG - Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029709197 7:102290335-102290357 CAGAGGTGGTGGAGGTTGCAGGG - Intronic
1029926922 7:104328489-104328511 CAGCGGCGGCGGCGGGAAGAGGG + Intergenic
1029985662 7:104921012-104921034 GTGGGGTGGGGGAGGGAAGATGG - Intergenic
1030012881 7:105188970-105188992 TAAAGGGGGTGGAGGGAGGAAGG + Intronic
1030994958 7:116349119-116349141 CCCAGGTGGTGTTGGGAAGATGG - Intronic
1031116673 7:117676275-117676297 CCAAGTTGGGGGAGGGAAGAGGG + Intronic
1031560890 7:123236755-123236777 GAGAGGTGGGGGAGGAAGGAAGG - Intergenic
1032225813 7:130030995-130031017 CTGAGCTGGGGAAGGGAAGATGG - Intronic
1032417481 7:131747594-131747616 CAGAGGTATTGGAGAGGAGATGG + Intergenic
1032540489 7:132699116-132699138 CAGGGGTGGTGGGAGGGAGAAGG - Intronic
1032904180 7:136345433-136345455 AAGAAGTGGTCGAGGGAAGAAGG - Intergenic
1033134776 7:138775261-138775283 CAGAGGTGGGGAGGGGAAGTGGG - Intronic
1033290592 7:140079489-140079511 CACTGGTTGTGGTGGGAAGAGGG + Intergenic
1033374179 7:140741518-140741540 CACAGCTAGTGGTGGGAAGAAGG - Intronic
1033444734 7:141410447-141410469 CAGAGGTGGGGGAGGGAGGGAGG - Intronic
1033938974 7:146627240-146627262 CACATGTCGTGGAAGGAAGATGG - Intronic
1034416220 7:150965587-150965609 GGGAGGAGTTGGAGGGAAGAGGG - Intronic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1034422278 7:150996170-150996192 CAGGGGTGGGAGAGGGGAGAGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034988152 7:155530420-155530442 CAGGGGTCATGGAGGGGAGAGGG - Intronic
1035227979 7:157444084-157444106 GAAAGGTGTTGGAGGGAAGTCGG + Intergenic
1035242864 7:157543496-157543518 CATAGTTGGTGGAGGGATGGAGG + Intronic
1035341478 7:158165313-158165335 GAGAGGTGCTGGAGGGAAAGTGG + Intronic
1035971246 8:4251780-4251802 GAGAGATGGAGGAGGAAAGATGG + Intronic
1036139178 8:6191078-6191100 TAGGGGTGGTGGAGCCAAGATGG + Intergenic
1036155863 8:6341341-6341363 AAGAGGTGGTAGAAGGGAGAAGG - Intergenic
1036561544 8:9903762-9903784 CGGAGGGGGTGGAGGGATGGGGG + Intergenic
1037293088 8:17372015-17372037 CAGAGGAGGGGGAGGGAATGAGG - Intronic
1037886569 8:22599169-22599191 CAGAGGAGAGGGAGGGGAGAGGG - Intronic
1037934717 8:22907792-22907814 CAGAGGTGGTGGCAGGGAGATGG + Intronic
1038293663 8:26271663-26271685 CAGGGATGGAGGAGGGAAGTGGG + Intergenic
1038461358 8:27720062-27720084 CAGAGGATGGGGAGGGATGAGGG + Intergenic
1038483689 8:27918972-27918994 AAGAGGAGGAGGAGGGGAGAAGG + Intronic
1038542601 8:28402193-28402215 CAGCGTCGGTGGAGAGAAGAGGG + Intronic
1038598384 8:28911801-28911823 CAGGGTTGGGGGAGGGCAGAGGG + Intronic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1038885592 8:31659434-31659456 AAGAGGTGATGCAGGGAAGCTGG + Intronic
1039129517 8:34247503-34247525 AAAATGTGGAGGAGGGAAGAGGG - Intergenic
1039147481 8:34465196-34465218 AAGGCCTGGTGGAGGGAAGAAGG - Intergenic
1039612077 8:38928037-38928059 CAGAGGCTGGGGAGGGGAGAGGG + Intronic
1039806188 8:41001730-41001752 AAGAGGAGGAGGAAGGAAGAAGG - Intergenic
1040385771 8:46914150-46914172 CAGAGGTGCTGAGGGGAGGATGG - Intergenic
1041423242 8:57692819-57692841 CAGAGGTCATGGAGGGGAGAGGG + Intergenic
1041568906 8:59313574-59313596 CAGAGAGGGTGGAAGGAAGATGG - Intergenic
1041698524 8:60762828-60762850 CAGAGGAGTGGGAGCGAAGAGGG + Intronic
1041709359 8:60879197-60879219 AAGAGGTTGGGGAGGGTAGAGGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1041777285 8:61537170-61537192 CAGAGAAGGTAAAGGGAAGATGG + Intronic
1041782170 8:61589087-61589109 CAGAGGCTGTGGTGGGAAAAGGG + Intronic
1043409813 8:79982270-79982292 AAGAGATGGTGGAGCCAAGATGG + Intronic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1044602050 8:94015092-94015114 CAGAGGGTGTGGATGGAAAAAGG - Intergenic
1044629723 8:94266591-94266613 CACATGGGGTGGAGGGAGGATGG + Intergenic
1044707009 8:95018588-95018610 GACAGGTGGGGGTGGGAAGAGGG + Intronic
1044940771 8:97340900-97340922 CGGGGGTGGTGGTGGGGAGAGGG + Intergenic
1045445354 8:102256762-102256784 TGGGGGTGGTGGAGGGAAGGAGG - Intronic
1045589262 8:103575564-103575586 CAAAGGTGGTGAAGTGAAGCTGG + Intronic
1045648651 8:104323351-104323373 CAGGGGAGTTGGAGGTAAGAAGG - Intergenic
1045939199 8:107718074-107718096 CAGAGGGAGTGGAGCCAAGATGG - Intergenic
1045962880 8:107989379-107989401 TGGAGGAGGTAGAGGGAAGAAGG - Intronic
1046547471 8:115669245-115669267 GGGAGGTGGGGGAGGGAGGAGGG - Intronic
1047415817 8:124663661-124663683 CAGAGGAGGTGGGAGGAGGATGG - Intronic
1048152504 8:131907850-131907872 CATAGGTGGTGGGTAGAAGAAGG - Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048365308 8:133733228-133733250 TGGGAGTGGTGGAGGGAAGAGGG - Intergenic
1048505837 8:135020519-135020541 CAGGAGTGTTGGAGGGAAGTGGG - Intergenic
1048664962 8:136650733-136650755 GAGATGTGGTTGAGGGAGGACGG - Intergenic
1048986017 8:139735443-139735465 CAGAGGTAGAGGAGGGAGAAGGG - Intronic
1049081272 8:140445226-140445248 CAGAGGTGGGGAAGAGATGATGG - Intronic
1049095207 8:140544601-140544623 CAGAGGGAGTAGAGGGTAGAAGG - Intronic
1049217759 8:141415658-141415680 CAGGGGTGGTGAAGGGTAGGGGG + Intronic
1049261398 8:141641116-141641138 CAGAGGTGCTCCAGGGAAAATGG - Intergenic
1049292221 8:141810255-141810277 CAGTGGTGGTGGAGGCAAGGCGG + Intergenic
1049332166 8:142060335-142060357 CTGCGGTGGTGGAGGCAAAATGG + Intergenic
1049350691 8:142162968-142162990 CAGAGATGGAGGATGGAAGATGG + Intergenic
1049833971 8:144721181-144721203 GAGAGGTGGTGGAGAGAGTAAGG + Exonic
1050058702 9:1682020-1682042 TAGATGTGGTTGAGGGAAAAAGG + Intergenic
1050230990 9:3525986-3526008 GAGGGGTGGGGGAGGGAAGAGGG + Intronic
1050351197 9:4741874-4741896 CAGAGGAGGAGGAGGAAGGAGGG - Intronic
1050513052 9:6413983-6414005 CAGAGGGCGGGGAGGGCAGAGGG + Intronic
1050961211 9:11734303-11734325 CTGAGGTGGTGGATGACAGATGG + Intergenic
1051020030 9:12532718-12532740 CATAGATGGTGGAGGGATGTGGG - Intergenic
1052136733 9:24921078-24921100 TAGAGAAGGTGGGGGGAAGAGGG - Intergenic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052480981 9:29025801-29025823 CAGGGGTGGTTAAGGGTAGAGGG - Intergenic
1052546384 9:29886022-29886044 CAGAGGCTGAGGTGGGAAGATGG + Intergenic
1052951994 9:34220100-34220122 GAGGGGAGGGGGAGGGAAGAGGG - Intronic
1053072580 9:35110033-35110055 CAGAGGTGGGGGTGGGGAGCAGG + Exonic
1053122040 9:35554968-35554990 CAGAGATGGGAGAGGGGAGAGGG - Intronic
1053163278 9:35828414-35828436 CAGATGTCTTTGAGGGAAGAGGG + Intronic
1053184946 9:36008174-36008196 AAGAGGTGGAGGAGGTAAAAGGG - Intergenic
1053184985 9:36008493-36008515 CAGAGGCTGAGGAGGGAGGATGG - Intergenic
1054754792 9:68946741-68946763 CTGAGGTGGTGGGGGTAGGAAGG - Intronic
1055397717 9:75891926-75891948 GAAAGGAGGGGGAGGGAAGAGGG + Intronic
1055841753 9:80513595-80513617 CAGAGGTGGGGGTGGGAGGAAGG - Intergenic
1056040061 9:82656128-82656150 CAGAGGCTGGGAAGGGAAGAAGG + Intergenic
1056067314 9:82950051-82950073 CAGAGGTGGAGGTGGCAAGAAGG - Intergenic
1056086519 9:83155007-83155029 CACAAGAGGTGGTGGGAAGAAGG - Intergenic
1056218405 9:84427458-84427480 CAGAGGTTGGGCAAGGAAGAGGG - Intergenic
1056534250 9:87514149-87514171 TAGAGCTGGTGTAGGGAAGGAGG + Intronic
1057488143 9:95502173-95502195 CACAGGGGCTGGAGGGGAGAGGG - Intronic
1057744777 9:97742083-97742105 AGGAGGAGGAGGAGGGAAGAAGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058478614 9:105367757-105367779 CAGAGGGGCTGGGGTGAAGAGGG - Intronic
1058608578 9:106750467-106750489 TAGAGGTGGTGGAGATAAGATGG + Intergenic
1058768282 9:108205026-108205048 CAGAGGTTGTGAAGGGTAGTAGG + Intergenic
1058807736 9:108608596-108608618 GATAGTTGGAGGAGGGAAGAAGG - Intergenic
1058959341 9:109978158-109978180 CTGAGGTGGCAGAGGGGAGATGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059300354 9:113307642-113307664 AAGAGGTGGCAGAGGGCAGAAGG + Intergenic
1059304978 9:113346945-113346967 AAGAGGTTGTGGAGGGCAGGGGG - Intergenic
1060017333 9:120098154-120098176 CAGAGGGTGGGGTGGGAAGATGG + Intergenic
1060190179 9:121587714-121587736 CAGAGGTGGTTGAGTAAAGGAGG + Intronic
1060409753 9:123392388-123392410 CGGAGGTGGTGAAGGGGAGCTGG + Intronic
1060414483 9:123420851-123420873 CAGAGGCGGGGGAGGGAGGAGGG + Intronic
1060697085 9:125718565-125718587 CAGAGGTATTGGTGGGGAGAGGG + Intergenic
1060921313 9:127422494-127422516 CTGAGGTGGCAGAAGGAAGATGG - Intergenic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061369538 9:130190761-130190783 CAGGGGTGGAGGAGTGGAGATGG - Intronic
1062035262 9:134380061-134380083 CAGAGGGGCTGCAGGGGAGAGGG - Intronic
1062319626 9:135984385-135984407 CAGAGGGGCTGGAGGGGACAAGG + Intergenic
1203465525 Un_GL000220v1:82706-82728 GAGAGGGGGTGGAGCCAAGATGG + Intergenic
1203637222 Un_KI270750v1:124309-124331 TGGAGTTGGTGGAGGGGAGATGG + Intergenic
1185505666 X:630966-630988 CGGAGGCGGCGGAGGTAAGAAGG + Exonic
1186195665 X:7108469-7108491 CACAGGGGGAGGAAGGAAGATGG - Intronic
1186419826 X:9416550-9416572 AAAAGGTGGAGGAGGGAAGGAGG + Intergenic
1186776083 X:12865869-12865891 CTAAGGTGGTGGGGGGAGGATGG - Intergenic
1187173196 X:16870716-16870738 CAGCGGTGGTGGGGGTGAGAGGG + Intergenic
1187178770 X:16922322-16922344 CAGAGGCTGGGAAGGGAAGAGGG + Intergenic
1187305233 X:18089392-18089414 CAGAGGAGCTGGAGGAATGAGGG - Intergenic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187428011 X:19196311-19196333 GAGAGGTGATGGAGCGAACAAGG - Intergenic
1187433846 X:19248905-19248927 CAGAGGTGGTGATGGGAGGAAGG - Intergenic
1187526798 X:20061572-20061594 CTAATGTGGTGGAGGGAAGCAGG - Intronic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1188239497 X:27768287-27768309 CAGGTTTGGTGGTGGGAAGATGG + Intergenic
1188304096 X:28541265-28541287 GAGTGGTGGTGGAGGGGAGGTGG + Intergenic
1189004054 X:36977130-36977152 TGGAGGTGGTTGGGGGAAGATGG + Intergenic
1189128504 X:38474259-38474281 CAAAGGTGGTGGGGGCAAAAGGG + Intronic
1189179107 X:38986767-38986789 CAGAGGGGCTGCAGGGAGGAGGG - Intergenic
1189223889 X:39396577-39396599 CAGGTGTGGAGGAAGGAAGATGG - Intergenic
1189227221 X:39422961-39422983 CAGTGGTGGAGGTGGAAAGAAGG - Intergenic
1189468844 X:41298672-41298694 GAGAGGAGGAGGAGAGAAGAAGG - Intergenic
1189725436 X:43964070-43964092 CAGGGGTGGTGGGGGGGTGAGGG + Intronic
1189741633 X:44123358-44123380 GAGAGGTGGAGGTGGGCAGATGG - Intergenic
1189988184 X:46572191-46572213 AAGAGGTGGGTGGGGGAAGAGGG + Intergenic
1190055040 X:47176350-47176372 GAGAGCGGATGGAGGGAAGAAGG - Intronic
1190146149 X:47893284-47893306 CAAAGGTGGTAAAAGGAAGAAGG + Intronic
1190153038 X:47964568-47964590 CAGAAGGGGGAGAGGGAAGAGGG + Intronic
1190288561 X:48976452-48976474 CAGAGGTGGGTGAGAGAACATGG + Intronic
1190458247 X:50645687-50645709 GAGAGGTGGTGGAGGGAAAAGGG + Intronic
1190458399 X:50646706-50646728 CAGAGGAGGTGGGGAGAGGAGGG - Intronic
1190459746 X:50660612-50660634 CAGAGATGGAGAGGGGAAGAGGG - Intronic
1190509660 X:51162594-51162616 CAGAGGAGGAGCAGGGAGGAAGG - Intergenic
1190713172 X:53083647-53083669 CAGAGATGGTGAAAGGAGGAGGG + Intronic
1190921798 X:54860083-54860105 CACAGGGGGTGGAGCCAAGATGG - Intergenic
1190989557 X:55532408-55532430 AAGAGTTGGTGGATGGGAGAGGG - Intergenic
1191157880 X:57295467-57295489 TAGAGGGGGTGGAGCCAAGATGG + Intronic
1192099484 X:68248947-68248969 GAAAGGTAGTGGAGGGATGATGG + Intronic
1192169692 X:68846659-68846681 CCTGGGTGGGGGAGGGAAGAAGG - Intergenic
1192330737 X:70173286-70173308 CAGGAGTGGTGGTGGGACGAGGG - Intergenic
1192917798 X:75672776-75672798 CGGAGGTGGTGGCTAGAAGAGGG - Intergenic
1193599805 X:83496348-83496370 TACATGGGGTGGAGGGAAGAGGG + Intergenic
1193601661 X:83513928-83513950 CAGAGGTTGTGGAGGGAGGTAGG + Intergenic
1193896050 X:87116303-87116325 CAGAGGAGGAGGAGCCAAGATGG + Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195306139 X:103585750-103585772 CAGAGATGGCGGTGGGAAAACGG + Intronic
1195400009 X:104451325-104451347 CAGAGCTTGGGTAGGGAAGAGGG - Intergenic
1195574935 X:106439016-106439038 CACAGATTGGGGAGGGAAGAGGG - Intergenic
1195860695 X:109380060-109380082 GAGATGGCGTGGAGGGAAGAAGG + Intronic
1195917582 X:109951041-109951063 CAGAGGTTGAGAAGGGAAGAGGG + Intergenic
1195934620 X:110113023-110113045 CAGAGGGGAGGGAGGGAGGAAGG - Intronic
1196205951 X:112939664-112939686 CAGAGGTTGGGGAGGGTAGTAGG + Intergenic
1196230837 X:113219117-113219139 CTGAGGTGGAGGAGGAGAGAAGG - Intergenic
1196374760 X:115020931-115020953 CAGAGGCTGGGGAGGGAATAAGG - Intergenic
1196478727 X:116121198-116121220 CAGCGGAGGTGGAGCCAAGATGG + Intergenic
1196700384 X:118661478-118661500 TAGAGGTTGGGGAAGGAAGAAGG - Intronic
1196820841 X:119699098-119699120 CAGAGGGAGTGGTAGGAAGAGGG + Intergenic
1196883187 X:120218995-120219017 CAGAGGCTGTGAAGGGTAGAGGG + Intergenic
1196897706 X:120353904-120353926 CAGAGGTGGTGGAAAGAAAATGG + Intergenic
1197199472 X:123735210-123735232 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1197376043 X:125682777-125682799 CAGTGGTGGTGGTGGGCACAGGG + Intergenic
1197950479 X:131890662-131890684 CAGAGGAGGAAGAGGAAAGATGG - Intergenic
1198245512 X:134827487-134827509 CATTGATGGTGGATGGAAGAGGG - Intronic
1198654206 X:138895982-138896004 CAGAGGTTGGGGATGGAAGAAGG + Intronic
1199838680 X:151620892-151620914 AGGAGGAGGTGGAGGGAAAAAGG - Intronic
1200120184 X:153786469-153786491 GAGAGTGGGTGGAGGGCAGAAGG + Intronic
1200830886 Y:7688101-7688123 GATAGGTAGTGGAAGGAAGATGG - Intergenic
1201011261 Y:9549524-9549546 GATGGGTGGTGGAAGGAAGATGG + Intergenic
1201346697 Y:12992003-12992025 AAGAGGAGGTGGAGCCAAGAGGG - Intergenic
1201419536 Y:13782954-13782976 CAAAGGTGGTGGAGCCAAGATGG - Intergenic
1202116052 Y:21469577-21469599 GATGGGTGGTGGAAGGAAGATGG + Intergenic