ID: 915602664

View in Genome Browser
Species Human (GRCh38)
Location 1:156932081-156932103
Sequence CGGGGTAAACACCCTCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915602664_915602676 30 Left 915602664 1:156932081-156932103 CCTGCCTGAGGGTGTTTACCCCG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 915602676 1:156932134-156932156 TTTGGGCTACATGTCCCCCAAGG 0: 1
1: 0
2: 1
3: 11
4: 135
915602664_915602671 12 Left 915602664 1:156932081-156932103 CCTGCCTGAGGGTGTTTACCCCG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 915602671 1:156932116-156932138 AGAGCTGGTCCTCCCATCTTTGG 0: 1
1: 0
2: 1
3: 14
4: 165
915602664_915602670 -3 Left 915602664 1:156932081-156932103 CCTGCCTGAGGGTGTTTACCCCG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 915602670 1:156932101-156932123 CCGACTCTATGGAGCAGAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 63
915602664_915602672 13 Left 915602664 1:156932081-156932103 CCTGCCTGAGGGTGTTTACCCCG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 915602672 1:156932117-156932139 GAGCTGGTCCTCCCATCTTTGGG 0: 1
1: 0
2: 0
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915602664 Original CRISPR CGGGGTAAACACCCTCAGGC AGG (reversed) Intronic
901119297 1:6877347-6877369 AGGGTTAAACACCATCAGGATGG - Intronic
915602664 1:156932081-156932103 CGGGGTAAACACCCTCAGGCAGG - Intronic
920043081 1:203116461-203116483 AGGGGGAAACCCCCTCAGGCTGG + Intronic
921784654 1:219215499-219215521 GTGAGTAAACACCCTCAGGCTGG - Intergenic
1063968184 10:11363056-11363078 CTGGGTAACCACTCTCAGCCTGG + Intergenic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1066978939 10:42393311-42393333 CGAGGTAAGCCCCCTCTGGCTGG - Intergenic
1069943758 10:71972484-71972506 CGGGCAAAAGACCCTGAGGCAGG - Intronic
1070383362 10:75901953-75901975 CTGGGTCAAAACCCTGAGGCTGG - Intronic
1072884209 10:99259664-99259686 CTAGGTAAACACTCTAAGGCAGG + Intergenic
1076334729 10:129698094-129698116 AGGGGTACCCACCCTCAGCCGGG + Intronic
1079007629 11:16803152-16803174 CCGGGTGAACAGCTTCAGGCAGG - Intronic
1081564815 11:44252086-44252108 TGGTATAAAGACCCTCAGGCAGG + Intergenic
1084179324 11:67438652-67438674 CGGGGTATGCACGCGCAGGCAGG - Exonic
1090242799 11:125195969-125195991 CTGGGTTTACAGCCTCAGGCCGG + Intronic
1097272163 12:57782770-57782792 CGCGATAAACACCCTCCGGCGGG - Exonic
1097781145 12:63706616-63706638 AAGGTTAAAGACCCTCAGGCTGG + Intergenic
1104031098 12:125066053-125066075 CGGGGGAAGCCCCCACAGGCCGG - Intronic
1104334254 12:127878576-127878598 GGGAGTAGACACCCTGAGGCAGG + Intergenic
1104748230 12:131223070-131223092 CGCGGTAACCTCCCCCAGGCTGG - Intergenic
1108033752 13:46265239-46265261 CGAGGTAAACCAACTCAGGCAGG + Intronic
1110696963 13:78502336-78502358 CGGGGTAGCCACCTTCAGGATGG + Intergenic
1115753028 14:36508819-36508841 CGGGGCTAACATTCTCAGGCTGG - Intronic
1122463625 14:101916297-101916319 CGGGGCACACACCCTCAGCTGGG - Intronic
1125928422 15:43582552-43582574 CCAGGTACTCACCCTCAGGCCGG + Exonic
1125941588 15:43682387-43682409 CCAGGTACTCACCCTCAGGCCGG + Intergenic
1132567486 16:630153-630175 CGGGGCACACATCCCCAGGCTGG - Intronic
1138245937 16:55467303-55467325 CGGGGTCACCACCCTCAGAAGGG + Intronic
1147620606 17:41864397-41864419 CAGCGCAAACGCCCTCAGGCAGG - Intronic
1147892444 17:43726897-43726919 TGGGGTCAGCACCCTCAGACAGG + Intergenic
1153543970 18:6186765-6186787 CTGGGCAAACACCCTCAGTGCGG - Intronic
1160184050 18:76660879-76660901 GGGGGTGAACAGCCTCAGGCAGG + Intergenic
1160627001 18:80217460-80217482 CCGGGCAAACACTCTCAGCCAGG + Intronic
1168462106 19:56567828-56567850 CGGGGTAAGCCTCCTCCGGCCGG - Exonic
925180045 2:1811673-1811695 CGGTGTAAACAGCAGCAGGCAGG - Intronic
933700433 2:85251553-85251575 AGAGGTAAACAGCCTCAAGCGGG - Intronic
933788870 2:85867667-85867689 GGGTGTATACACCCTCAGTCTGG - Intronic
935716251 2:105941676-105941698 CGCGTAAAACAGCCTCAGGCAGG - Intergenic
937222877 2:120352259-120352281 CCGGGAAAACCCCCTCAGGAAGG - Intergenic
940908718 2:159191479-159191501 GGGGGTAAAGACCATGAGGCCGG + Intronic
945660891 2:212683960-212683982 CAAGGCAAACACCCTGAGGCAGG + Intergenic
946637118 2:221741824-221741846 TGGGTTAAAAACCCTTAGGCTGG - Intergenic
1170184385 20:13571870-13571892 CAGGGTGAAGACCCTGAGGCTGG - Intronic
1171882313 20:30627607-30627629 CTGGGTGAACACCCGCAGGGAGG - Intergenic
1174420129 20:50394059-50394081 CGGGGGAAGCTCCCTGAGGCAGG + Intergenic
1175873131 20:62217657-62217679 CAAGGTAAACGCCATCAGGCTGG - Intronic
1177043807 21:16145633-16145655 CGTGGTAAACATCCACAGGGAGG - Intergenic
1177612920 21:23476164-23476186 CAGTGTAAACACCCTATGGCAGG - Intergenic
1181836665 22:25615936-25615958 CAGGGCAAAGACCCTAAGGCTGG + Intronic
956170371 3:66429010-66429032 CGGGATAAACAGCCTCCGCCAGG + Intronic
960616770 3:119602953-119602975 CCGGGCAAAGACCCTCAGGCAGG + Intronic
973620450 4:52721292-52721314 CAGGGAAAACAGACTCAGGCTGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
979890122 4:126081896-126081918 AGGGGCAAACACTCTGAGGCAGG + Intergenic
984699336 4:182808328-182808350 CGTGGGAGACCCCCTCAGGCTGG + Intergenic
988689533 5:33558626-33558648 CTGGCTAGACTCCCTCAGGCTGG + Intronic
1011628477 6:89302403-89302425 CTGCGTCAGCACCCTCAGGCTGG + Intronic
1016307207 6:142696805-142696827 CAGGGTAAACAACCTGGGGCAGG - Intergenic
1022939728 7:35222679-35222701 AAGGTTAAAGACCCTCAGGCTGG + Intronic
1026889154 7:73972102-73972124 GGTGGTCAACTCCCTCAGGCTGG - Intergenic
1034996603 7:155581275-155581297 CGGGATAAACAGCCTCATCCTGG - Intergenic
1036660666 8:10706390-10706412 CGGGAAAAATACACTCAGGCCGG - Intronic
1042795628 8:72660349-72660371 TGGGGTAAGGACTCTCAGGCAGG - Intronic
1054826949 9:69582764-69582786 CTGGGCAAACAAGCTCAGGCAGG - Intronic
1056806179 9:89730785-89730807 CTGGGTAAACACACTCAAGCTGG - Intergenic
1056967668 9:91178527-91178549 TGGGCTAAACACCCCCAGGATGG + Intergenic
1061820249 9:133223433-133223455 CAGGGTAAACAGGCTCAGGGCGG + Intergenic
1062240384 9:135534471-135534493 CAGGGTAAACAGGCTCAGGGCGG - Intergenic
1062377011 9:136266396-136266418 TGGAATAAACACCCTCAGTCTGG + Intergenic
1188777466 X:34238533-34238555 CATTGTAAACAGCCTCAGGCAGG - Intergenic
1190250716 X:48722993-48723015 AGGGATAGACACCCTCAGACAGG + Intergenic
1192809207 X:74534974-74534996 CAGTGTAGACACCCTCAGGCTGG + Intergenic
1199990895 X:152987376-152987398 CCGGTTAAGCACCTTCAGGCCGG + Intergenic