ID: 915603085

View in Genome Browser
Species Human (GRCh38)
Location 1:156934719-156934741
Sequence ATCTGGGTCTGGGGGTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 450}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915603071_915603085 26 Left 915603071 1:156934670-156934692 CCCTAGTTCAGTGAGTGCACAGC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 915603085 1:156934719-156934741 ATCTGGGTCTGGGGGTGAGAGGG 0: 1
1: 0
2: 4
3: 39
4: 450
915603072_915603085 25 Left 915603072 1:156934671-156934693 CCTAGTTCAGTGAGTGCACAGCT 0: 1
1: 0
2: 0
3: 14
4: 148
Right 915603085 1:156934719-156934741 ATCTGGGTCTGGGGGTGAGAGGG 0: 1
1: 0
2: 4
3: 39
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915603085 Original CRISPR ATCTGGGTCTGGGGGTGAGA GGG Intergenic
900360032 1:2284018-2284040 GTCTGGGTCTGGGGAGAAGATGG - Intronic
900898217 1:5498542-5498564 ACCTGGTCCAGGGGGTGAGAGGG + Intergenic
900990756 1:6097153-6097175 ATCTTGGTCTGGGGGTCTGAGGG - Intronic
900990952 1:6098064-6098086 AACTGGATGTGGGGGTGAGAAGG + Intronic
901087922 1:6622899-6622921 TTCTGGGGCTGGGAGGGAGAGGG + Exonic
901176017 1:7299702-7299724 AGCAGGGACTGTGGGTGAGAGGG + Intronic
902717362 1:18281906-18281928 ATCTGGATTTGGGGGTGTGGTGG + Intronic
902723684 1:18321605-18321627 TTCTGGCTCATGGGGTGAGAGGG - Intronic
902737247 1:18409245-18409267 AGCTGGGTCTGCAGGTGGGAGGG - Intergenic
903294091 1:22332655-22332677 ATCTAGGGTTGGGGGAGAGAAGG + Intergenic
904330030 1:29752817-29752839 AAATGGGTCTGGGGGTGGGTGGG + Intergenic
904343225 1:29851563-29851585 AGCTGGGGCTGGGGGTGGCAGGG + Intergenic
904449297 1:30600728-30600750 CTCGGGGTCTGGGGAAGAGAGGG - Intergenic
904614684 1:31743354-31743376 CTCTGGGTCTAGGGGTGGGTGGG - Intronic
905179073 1:36155767-36155789 CTCTGGCACTGGGGCTGAGAGGG - Intronic
905304676 1:37009396-37009418 ATCTGGGGCTGGGGGTGTGAGGG - Intronic
905305225 1:37013315-37013337 ATTTGTGTCTGGGGCTGATATGG - Intronic
905798904 1:40831020-40831042 AGCTGGGGGTGGGGGTGAGTGGG - Intronic
905892929 1:41528419-41528441 ATGTGAGTCTGAGGGTGTGAGGG - Intronic
905898134 1:41562339-41562361 GTCTGGGGGTGGGGCTGAGAGGG + Intronic
906190153 1:43893667-43893689 ATCTGGGCCTGGAGAGGAGATGG - Intronic
906676731 1:47698560-47698582 ATATGGTTCTGTGGTTGAGATGG - Intergenic
907221170 1:52907839-52907861 ATCTGGGTGTGGGGTGGAGGAGG - Intronic
907426125 1:54380297-54380319 ATTTGGGCATGGGGGTGAGGAGG - Intronic
908125125 1:61023126-61023148 ATCTTTGACTGGGGGTAAGACGG - Intronic
908513043 1:64864739-64864761 GTCTGGATCTGGTGATGAGAGGG - Intronic
909012256 1:70347825-70347847 ACCTGGGTGTGGGGGTGATTTGG - Intronic
911550383 1:99271721-99271743 ATCAGTGGGTGGGGGTGAGAGGG + Intronic
913223868 1:116681388-116681410 ATTTGGGGGTGGGGATGAGATGG + Intergenic
915038275 1:152946871-152946893 TGCTGGGTGTGGGGGTGTGAGGG - Intergenic
915603085 1:156934719-156934741 ATCTGGGTCTGGGGGTGAGAGGG + Intergenic
915779035 1:158525062-158525084 ATCTGCTTCTGGTGATGAGATGG + Intergenic
916493807 1:165326930-165326952 GTGTGTGTCTGGGGGTGAGGGGG - Intronic
917720197 1:177779792-177779814 ATGGGTGTCCGGGGGTGAGAGGG - Intergenic
920451174 1:206062351-206062373 CTCTGGGGCTGGGGGTGATCTGG - Intronic
920556868 1:206910229-206910251 TTCTGGGGCTGGTGGTGAAAAGG - Exonic
920825582 1:209421754-209421776 TTCTGGGGCTGGGGGTGATGGGG - Intergenic
921314412 1:213876676-213876698 TCCTGGGTTTGGGGGTGAGCTGG - Intergenic
921660550 1:217795940-217795962 AGCTGGGCGTGGTGGTGAGAAGG - Intronic
922213227 1:223501046-223501068 GTCTTCTTCTGGGGGTGAGAGGG - Intergenic
923672602 1:236053590-236053612 ATCAGGGGCTGGGGGTGTGAGGG - Intronic
924183872 1:241466413-241466435 ATCTGGGCTTGGGGATGAGTTGG + Intergenic
924821338 1:247493550-247493572 ATGTGGGTTGGGGGGTGAGGTGG + Intergenic
1064091892 10:12392798-12392820 ACCTGGGCCTGGGGGTCAGGGGG - Intronic
1064402869 10:15035758-15035780 ATCTGGCTCTTGGGGAGAAAGGG + Intronic
1066104426 10:32144464-32144486 AGCTGGGTGTGGTGGTGACAGGG + Intergenic
1067260881 10:44690437-44690459 ACATGGGTCTGTGGGTGGGAAGG + Intergenic
1067531743 10:47079138-47079160 TTCTGGGGCTGGGGGTGGTAAGG + Intergenic
1068103842 10:52590333-52590355 CTCTGGGGCTGGGGGTGGGGTGG + Intergenic
1068827188 10:61453204-61453226 ATCGGGCGCTGAGGGTGAGAAGG - Exonic
1069873195 10:71545710-71545732 ATCTATGTCTGCTGGTGAGAAGG + Intronic
1070765441 10:79053582-79053604 AACTGGGTCTGGGAGGGAGAGGG + Intergenic
1071566290 10:86673046-86673068 AGCTGTGTTTGGGGGTGGGAGGG - Intronic
1072160766 10:92764231-92764253 ATCAGGAGCTGGGGGTGAGCGGG - Intergenic
1072451574 10:95543183-95543205 ATGTGGGTTGGGGGGTGAGCTGG - Intronic
1072490993 10:95906012-95906034 CTCTGGGTCCTGGGGTGGGATGG + Intronic
1073539232 10:104304853-104304875 AACTTGGCCTTGGGGTGAGAGGG - Intronic
1074243079 10:111658398-111658420 AAATGGGTTTGGTGGTGAGAAGG - Intergenic
1074312948 10:112338108-112338130 ATCATGGTCTGGGTGTGGGAGGG + Intergenic
1075070573 10:119317439-119317461 ATCAGGGCCTGGGGGAGAGTTGG + Intronic
1075082628 10:119393997-119394019 GTCTGGGTCTGGGGGGGTGCGGG + Intronic
1075698245 10:124451054-124451076 TTCTGCTTCTGGGGCTGAGAGGG - Intergenic
1075872842 10:125783099-125783121 AACTGGGCCTGGGCCTGAGATGG - Intergenic
1076094062 10:127716069-127716091 ATCTGGGGGTGAGGGTGAGAAGG - Intergenic
1076497085 10:130904451-130904473 CTCTGGGTTTGGGGGTGCTAGGG - Intergenic
1077575585 11:3380554-3380576 CTCTGCTTCTGGGGATGAGATGG + Intergenic
1079007282 11:16800846-16800868 ATCTGGGGCTGAGGGGGAGAAGG + Intronic
1079661033 11:23036827-23036849 ACCTAGTTCTGGTGGTGAGAAGG + Intergenic
1080057304 11:27919679-27919701 GGCTGGGTTTGGGGGAGAGATGG - Intergenic
1080522832 11:33082702-33082724 ATCTGGGGCTGGTGGTGTGGGGG - Intronic
1081577515 11:44328371-44328393 CTCTGGGCCTGGGGGAGAGGAGG - Intergenic
1082084993 11:48042823-48042845 AGCTGGGTTTGGGGCTGGGAAGG + Intronic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG + Exonic
1083893175 11:65607058-65607080 ATGTCGGTCTGGGAGTGGGAAGG - Intronic
1084544455 11:69807756-69807778 AAAAGGGTATGGGGGTGAGAGGG - Intergenic
1087271451 11:96115977-96115999 ATCAGACTCTGGGGCTGAGAGGG + Intronic
1088537042 11:110872652-110872674 GTCTGGATGTGGGGGTAAGATGG - Intergenic
1088985875 11:114907806-114907828 CTCTGCTTCTGGGGGTTAGATGG + Intergenic
1089142041 11:116293211-116293233 GTCGGGGGCTGGGGGTGAGGGGG - Intergenic
1089481609 11:118809937-118809959 ATCTGGGCCTGTGGGTTAGATGG + Intergenic
1089606357 11:119643782-119643804 AGCTGGGTCTGGCTGTGAGCCGG + Intronic
1089747938 11:120630003-120630025 ATTTGTGTGTGGGGGAGAGAGGG + Intronic
1089785731 11:120905512-120905534 ATCTGGGCCTGAGGGTGGGCTGG + Intronic
1090479892 11:127058853-127058875 ATCTGGGTAAGGGGTAGAGAGGG - Intergenic
1090936163 11:131344452-131344474 ATCTGAGTCTGGGGCTCAGGGGG + Intergenic
1091844988 12:3648893-3648915 AGCTGGGTCTGGGGTTAGGAGGG - Intronic
1091949490 12:4581075-4581097 CTTTGGGTCTTGGTGTGAGAGGG + Intronic
1092227057 12:6754142-6754164 ATCTGGCTCTGCTGGAGAGAAGG + Intronic
1093969857 12:25365239-25365261 GCCTGGGGCTGGGGGTGGGAGGG + Intergenic
1095705158 12:45228977-45228999 ACTTGGGTCTGGAGGGGAGAAGG + Intronic
1095730973 12:45506390-45506412 ACTTGTGTCTGGGGGTGGGAAGG + Intergenic
1095737688 12:45575796-45575818 ATCTGGGGCTGGGAGTTGGAAGG - Intergenic
1096214778 12:49792922-49792944 ACCATGGTCTGGGGGTGGGAAGG + Exonic
1096386078 12:51196217-51196239 ATCTGGGTTTGGGGTGGAGCTGG - Intronic
1096549762 12:52364365-52364387 ACCTGGGTGTGGGAGAGAGAAGG + Exonic
1097100042 12:56581271-56581293 ATCTGGGGCTCAGGCTGAGAGGG + Intronic
1099010419 12:77284928-77284950 AACTGGGTCTGAGGATGAAAAGG + Intergenic
1101560939 12:105857394-105857416 TTCAGGGCCTGGGGGTGGGAGGG + Intergenic
1101977213 12:109370155-109370177 ATCTGGGTTAGGGAGTGATATGG - Intronic
1102454476 12:113063225-113063247 ATCAGGGTCTTGGGGTGAGGGGG + Intronic
1102497488 12:113329624-113329646 CTCTGCGTCTGGGGGAGGGAAGG + Intronic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1102677504 12:114668565-114668587 ATCGGGGGCGGGGGGAGAGAAGG + Intergenic
1103966953 12:124646102-124646124 ATGTGGGGCTGGGGGGGAGGGGG + Intergenic
1104204141 12:126620140-126620162 AAGTGGGTGTGGGGGTGAGGGGG + Intergenic
1104305532 12:127607544-127607566 GTCTGGGCGTGGGGGTCAGATGG + Intergenic
1105540722 13:21313939-21313961 GTCTTGGTCTGGGGTTTAGAAGG + Intergenic
1105898303 13:24736551-24736573 CTCTGCTTCTGGGGGTGAGTTGG - Intergenic
1106131136 13:26940450-26940472 ATCTGGGTTTGGGGTAGAAAGGG + Intergenic
1106340090 13:28819747-28819769 AGCTGGGGCTGGGGCTGAGGCGG + Intergenic
1107928579 13:45287678-45287700 TTCTTGGTTTGGAGGTGAGATGG - Intergenic
1108268869 13:48738997-48739019 ATGTGGGCCTGAGGGAGAGAGGG - Intergenic
1109049164 13:57456229-57456251 ATCTGTGTGTGTGTGTGAGAGGG + Intergenic
1109375551 13:61486885-61486907 ATCCTGGTTTGGGGGTGAGGTGG + Intergenic
1109624936 13:64962436-64962458 ATCTGGGGATGGGGGTGAATAGG + Intergenic
1109758921 13:66800228-66800250 ATCCCGGGCTGGGGGTGAGAGGG - Intronic
1110429276 13:75404987-75405009 ATGTGGGCCAGGGGTTGAGAAGG + Intronic
1111961877 13:94820420-94820442 ATCTGGGTTTATGAGTGAGATGG + Intergenic
1112235849 13:97635922-97635944 ATCTGGCTGTGGGGGTGGGAAGG - Intergenic
1112312146 13:98328297-98328319 AGCTGGGTCTGTGGCTGTGAGGG - Intronic
1112419920 13:99239341-99239363 ATGTGTGTCCGGGGTTGAGAAGG - Intronic
1113912889 13:113852676-113852698 ACCTGGGTCTGGTGGTGGGCAGG - Intronic
1113927707 13:113950738-113950760 AGCTGGGTCTGGGGTTCAGCAGG + Intergenic
1114769887 14:25417015-25417037 CTCTGGGTCTGCTGGTGACACGG + Intergenic
1114821087 14:26019888-26019910 ATCTTAGTCTGGAGGTGAGGAGG - Intergenic
1114960928 14:27888172-27888194 ATCAGGGTGTGGGGGTGAGTGGG + Intergenic
1115394945 14:32897831-32897853 ATGTGGCTCTGGAAGTGAGAGGG + Intergenic
1115528867 14:34307535-34307557 ATGAGGGTCTGTGGTTGAGAAGG - Intronic
1117234090 14:53753000-53753022 ATCTGGAACTGGGTGTGTGATGG - Intergenic
1117535465 14:56698694-56698716 CCCTGGGGCTGGGAGTGAGATGG + Intronic
1118359241 14:65042179-65042201 ACCTGGGGTTGGGGGTGGGACGG + Intronic
1118744303 14:68762868-68762890 ATCTGGGGGTGGGGGTGGGGTGG + Intergenic
1118809318 14:69261572-69261594 ATCTGGGCCTGGGGGTGGAGGGG + Intronic
1119749136 14:77065137-77065159 ATCTGAGTCTGGGGCTGCGGTGG - Intergenic
1120708999 14:87773850-87773872 ATCTGGGCCAGAGGGAGAGAAGG - Intergenic
1121122574 14:91385269-91385291 CCCTGGGTCTGGGGTAGAGATGG - Intronic
1121846033 14:97173228-97173250 TCCTGGGCCTGGGGGTGGGATGG - Intergenic
1122005093 14:98696906-98696928 ATCTAGCTCTGGGGATGGGATGG + Intergenic
1122104184 14:99439268-99439290 GTCTGGAGTTGGGGGTGAGAAGG - Intronic
1122486286 14:102083609-102083631 ATCTGCCTCTGGTGATGAGATGG - Exonic
1122680518 14:103458006-103458028 ATCTGAGTTTTGGGGTCAGAGGG - Intronic
1122897782 14:104768976-104768998 ACCTGGGGCTGGGGGGCAGATGG + Intergenic
1122937164 14:104965622-104965644 AACTGGGTCTGGGGCAGGGATGG - Intronic
1122961237 14:105094413-105094435 ACCTGGGCCTGGGGGACAGAGGG - Intergenic
1122967443 14:105137957-105137979 CCCTGGGTCTGGGGGTCTGATGG + Intergenic
1124230045 15:27936724-27936746 TTCTGGGTCTAGGAGGGAGAGGG - Intronic
1124368614 15:29090847-29090869 ATCTGGCTGTGGGGCTGGGAAGG - Intronic
1126998362 15:54473005-54473027 ATGTGGGGGTGGGGGAGAGAGGG - Intronic
1127958600 15:63874025-63874047 GTCTGGGTCTGGGGGAAAAAAGG - Intergenic
1128551447 15:68600555-68600577 GCCTGGGTCCGGGGGTGGGACGG - Intronic
1129758463 15:78112723-78112745 ATCTGGCTTTGGGGGTGGCAGGG - Intronic
1130194908 15:81770642-81770664 AACTGGGGCTAGGGATGAGAGGG + Intergenic
1131556737 15:93406079-93406101 ATCTGGGGCTGAGGGTGTGGAGG + Intergenic
1132482473 16:173351-173373 ATCTGGGTCGAGGGGCGAGATGG + Intronic
1132483321 16:177155-177177 ATCTGGGTCGAGGGGCGAGATGG + Intronic
1132619092 16:855944-855966 CTTTGGGTCTGGGTGTGTGATGG + Intronic
1132845389 16:1998845-1998867 GCCTGGGTCTGGGGGTCAGAAGG + Exonic
1134117623 16:11561083-11561105 AGGTGGGTCTGGGGCTGTGACGG - Intronic
1136736778 16:32474011-32474033 CTGCGGGTCTTGGGGTGAGATGG - Intergenic
1136922337 16:34343619-34343641 TTGTGGCTCTGGGGGTGACAAGG + Intergenic
1136982236 16:35068187-35068209 TTGTGGCTCTGGGGGTGACAAGG - Intergenic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1138538861 16:57676120-57676142 ATCAGGCTCCTGGGGTGAGAGGG - Intronic
1140437006 16:74955419-74955441 ATCAGGGGCCGAGGGTGAGAGGG + Intronic
1140684416 16:77419395-77419417 ATGGGGCTCTAGGGGTGAGAAGG - Intronic
1141273592 16:82563753-82563775 ACCAGGGGCTGGGGGTGAGGGGG - Intergenic
1141370462 16:83481716-83481738 ATCTGGCTCAGGGAGTGACAGGG + Intronic
1141721479 16:85758318-85758340 ACCTGGGACTGGGGCTGGGAAGG + Intergenic
1142426005 16:90002624-90002646 GTCTGATTCAGGGGGTGAGATGG - Intergenic
1203016290 16_KI270728v1_random:355566-355588 CTGCGGGTCTTGGGGTGAGATGG + Intergenic
1203034625 16_KI270728v1_random:628724-628746 CTGCGGGTCTTGGGGTGAGATGG + Intergenic
1142806255 17:2372635-2372657 AGCTGGGCCTGGGGCTGACACGG + Intronic
1143023833 17:3929769-3929791 ATTAGGGTCTGGGGGTCAGTGGG - Intronic
1143164206 17:4889844-4889866 ATCTGGGGGTGGGGGAGAGAAGG - Intronic
1143575777 17:7792349-7792371 AGCTGGGCCTGGGTGTGAGGAGG + Intronic
1144170706 17:12657283-12657305 AGCTGGGTCTGAGGCTGAGGTGG + Intergenic
1144296989 17:13885676-13885698 CGATGGGTCAGGGGGTGAGATGG - Intergenic
1144695944 17:17303851-17303873 GTCTGGGGCTCGGGGCGAGAAGG - Intronic
1144759375 17:17698679-17698701 AGCTGGCTCAGGGGCTGAGAGGG - Intronic
1144875327 17:18394390-18394412 ACCTGGGTCTGGTGCTGGGAAGG + Intergenic
1145156897 17:20550031-20550053 ACCTGGGTCTGGTGCTGGGAAGG - Intergenic
1145799064 17:27671903-27671925 CTCTGGGTCTGGTGCTGGGAAGG - Intergenic
1145868039 17:28253251-28253273 AACTGGCTCTGGGGTTGAGAGGG + Intergenic
1146836801 17:36117556-36117578 ATCTGAGTGTGGGAGGGAGAAGG - Intergenic
1146844421 17:36174123-36174145 ACCTGGGTCTGGTGCTGGGAAGG - Intronic
1146856725 17:36262058-36262080 ACCTGGGTCTGGTGCTGGGAAGG - Intronic
1146863892 17:36326317-36326339 ACCTGGGTCTGGTGCTGGGAAGG + Intronic
1146872635 17:36385969-36385991 ACCTGGGTCTGGTGCTGGGAAGG - Intronic
1146879994 17:36437054-36437076 ACCTGGGTCTGGTGCTGGGAAGG - Intronic
1146916379 17:36680824-36680846 ATCTGGTGCTGGGAGTGAAAAGG - Intergenic
1147066751 17:37926905-37926927 ACCTGGGTCTGGTGCTGGGAAGG + Intronic
1147075520 17:37986593-37986615 ACCTGGGTCTGGTGCTGGGAAGG - Intronic
1147078283 17:38006466-38006488 ACCTGGGTCTGGTGCTGGGAAGG + Intronic
1147087045 17:38066139-38066161 ACCTGGGTCTGGTGCTGGGAAGG - Intronic
1147094221 17:38130401-38130423 ACCTGGGTCTGGTGCTGGGAAGG + Intergenic
1147102990 17:38190102-38190124 ACCTGGGTCTGGTGCTGGGAAGG - Intergenic
1147301660 17:39533713-39533735 AAATGGGGGTGGGGGTGAGATGG - Exonic
1147428112 17:40355945-40355967 TGCTGGGGCTGGGGGTGGGAGGG + Intronic
1147638073 17:41975988-41976010 AAATGGGTCTGGGGGTCAGGAGG + Exonic
1147864431 17:43543417-43543439 ATCTGTGCCTGGGTTTGAGATGG - Intronic
1147924076 17:43935968-43935990 AACTGGCTCTGGGCTTGAGAGGG - Intergenic
1148160122 17:45444906-45444928 ATCCGGGGGTGAGGGTGAGAGGG - Intronic
1148160136 17:45444955-45444977 ATCCGGGGGTGAGGGTGAGAGGG - Intronic
1148187451 17:45654928-45654950 ACCTGGGTCTGGGTGTGGGAAGG + Intergenic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1148840798 17:50495508-50495530 GGCTGGGGCTGGGGGTGAAAGGG + Intergenic
1149422930 17:56528304-56528326 AGCTGGGACTGGGGGTGGGGAGG + Intergenic
1149498942 17:57136644-57136666 AGATGGGGCTGGGGGTGAGGTGG + Intergenic
1149546224 17:57505717-57505739 ATCTTGGTTTGGGGGTGCGGCGG + Intronic
1149847562 17:60016569-60016591 ACCTGGGTCTGGTGCTGGGAAGG - Intergenic
1150085920 17:62273186-62273208 ACCTGGGTCTGGTGCTGGGAAGG - Intronic
1150391412 17:64791785-64791807 ATCCGGGGCTGAGGGTGAGAGGG - Intergenic
1150391425 17:64791834-64791856 ATCCGGGGGTGAGGGTGAGAGGG - Intergenic
1150410196 17:64935816-64935838 ATCCGGGGGTGAGGGTGAGAGGG - Intergenic
1150410211 17:64935866-64935888 ATCCGGGGGTGAGGGTGAGAGGG - Intergenic
1150410226 17:64935916-64935938 ATCCGGGGGTGAGGGTGAGAGGG - Intergenic
1150410239 17:64935965-64935987 ATCCGGGGGTGAGGGTGAGAGGG - Intergenic
1150453507 17:65288767-65288789 AGCTGGGGATGGGAGTGAGAGGG - Intergenic
1151577293 17:74959136-74959158 ATCTGGCTCTGGGGGATGGAGGG - Intronic
1152528400 17:80902719-80902741 ATGGGTGTCTGGGGGTGAGGAGG - Intronic
1152795511 17:82304321-82304343 CCCTGGGGCTGGGGGTGGGAAGG + Intergenic
1152898875 17:82928713-82928735 AGCTGGGGCTGGGGAAGAGATGG - Intronic
1155177640 18:23314776-23314798 ATTCGGGTCTGTGTGTGAGAAGG - Intronic
1156015052 18:32537987-32538009 ATTTGTGTGTGGGGGTGAGGGGG - Intergenic
1156273321 18:35557388-35557410 ATCTGGGAATGGGGGAGGGAGGG + Intergenic
1156760890 18:40588863-40588885 ATGTGAGTGTGGGGATGAGATGG - Intergenic
1157285362 18:46373859-46373881 GTCTGGGACCGGGGGTGGGAGGG - Intronic
1157567828 18:48691720-48691742 ACTTGGGTCTGGGAGGGAGAGGG - Intronic
1158198386 18:54913031-54913053 ATCTGGGTATTTGGGTGATATGG - Intronic
1158865820 18:61636804-61636826 AGCTTGGTCTGGAGGTGAGGAGG - Intergenic
1159775891 18:72602313-72602335 CTCTGGGTCTGGTGAGGAGAAGG + Intronic
1160002965 18:75045052-75045074 ATCTGGGTGTGGGGGGGTGTGGG + Intronic
1160458473 18:79019501-79019523 ATCTGGGTTTGGGGGTAAATGGG - Intergenic
1160828894 19:1093626-1093648 ATGGGGGGCTGGGGGTGAGTGGG + Intronic
1161488763 19:4550265-4550287 ACCCGGGCCTGGGGGTGACAAGG + Exonic
1161933112 19:7354373-7354395 ATTTGGGGCTGGGGGTGATTTGG + Intronic
1161980692 19:7628734-7628756 ATCTGGGCCTGGGGTGGAGATGG - Intronic
1162568768 19:11458610-11458632 ACCTGGGTGAGGGGGTCAGATGG + Exonic
1163251765 19:16130021-16130043 ATCTGGGGCTGGGGTGGAGCGGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163526475 19:17824586-17824608 AGCTGGGGCTGGGAGTGAGGGGG + Intergenic
1165385250 19:35506549-35506571 ACCTTGGTCTGGTGGTGACATGG + Intronic
1165797661 19:38528241-38528263 ATCCAGGGCTGGGAGTGAGAGGG + Intronic
1166038941 19:40191031-40191053 ATCTCGGTCGGGGGGTCCGAGGG + Intergenic
1166993086 19:46704877-46704899 TTCAGGGTCTGGGGGACAGATGG - Intronic
1166993116 19:46704996-46705018 TTCAGGGTCTGGGGGACAGATGG - Intronic
1166997218 19:46725415-46725437 ATCTGGGGACGGGGGTGACAGGG - Intronic
1167646933 19:50710998-50711020 ATCTGGGACTGGGCTTGGGATGG - Intronic
1167667965 19:50833618-50833640 AGCTGGGTCTGGGGGTGTGGTGG + Intronic
1167749652 19:51371999-51372021 GTCTGGATCTGGGGGTGTGGAGG + Exonic
1168234058 19:55050849-55050871 ATCTGGTTCTCTGTGTGAGAAGG + Intronic
926415217 2:12643022-12643044 ATCTGTGTGTGGGCGAGAGAGGG - Intergenic
926438384 2:12860790-12860812 ATCTTGGGCTGTTGGTGAGATGG - Intergenic
927721778 2:25387729-25387751 TGCTGGGGCTGGAGGTGAGAAGG - Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
931251633 2:60536235-60536257 GTCTGAGGCTGGGGGAGAGAGGG - Intronic
931297277 2:60939771-60939793 AACGGGGTCTGTGGGTTAGATGG + Intergenic
933457422 2:82534174-82534196 ATTTGGGTGTGAGGGAGAGAGGG + Intergenic
933685306 2:85136597-85136619 ATGTAGGTATGGGGGTGGGATGG - Intronic
934942227 2:98510996-98511018 ATTTGTGTCTGCAGGTGAGAAGG + Intronic
936246608 2:110833934-110833956 GACAGGGCCTGGGGGTGAGAGGG + Intronic
936290631 2:111221073-111221095 ATTTGGGTGTGGGGGTGAGAGGG - Intergenic
937362555 2:121239169-121239191 CACTGAGTGTGGGGGTGAGAGGG - Intronic
938986822 2:136584583-136584605 ATCTGGGTCTGTGGACCAGAAGG + Intergenic
939676553 2:145079475-145079497 ATCTGCTGCTGGGGGTGGGAAGG - Intergenic
941396851 2:164983878-164983900 CTTTGGGTATGGGTGTGAGAGGG + Intergenic
941884090 2:170510726-170510748 ATCAGGGGCTGAGGGTGAGGGGG - Intronic
943764119 2:191642013-191642035 ATCTGGGTCTGCAGGTGTGTTGG - Intergenic
945141533 2:206691821-206691843 ATAGGGGTCTGGGATTGAGATGG + Intronic
946052985 2:216879605-216879627 AGCTGGGTCTGGGAGAGATATGG - Intergenic
947626362 2:231621586-231621608 ATCAGTGTCTGGGGGTGGGGCGG - Intergenic
948109717 2:235444950-235444972 GTCTGGGTCTGGAGGTGGGTGGG + Intergenic
948228856 2:236334995-236335017 AGCTTGGTCTGGGGGAAAGAAGG + Intronic
948804578 2:240447967-240447989 CGCTGGCTCTGGGTGTGAGATGG + Intronic
948813734 2:240499342-240499364 ATGTGGGGGTGGGGGTGAGTAGG + Intronic
948861230 2:240753523-240753545 ATCTGAGCCTGGGGTTGCGAGGG - Intronic
1168803839 20:661665-661687 ATGGGGGTTTGGGGGTGAGTTGG + Exonic
1169569916 20:6894977-6894999 GTCTGTGTCTGGGGGTGGGGAGG + Intergenic
1170256217 20:14347027-14347049 TTCGTGGTCTGTGGGTGAGAAGG + Intronic
1170337243 20:15283214-15283236 ATTAGGGTCTGGGGCTGATATGG - Intronic
1170780608 20:19422304-19422326 ATCTGGAACTTGGGGAGAGAGGG + Intronic
1172084191 20:32366568-32366590 TTCTGTGTCTGGTAGTGAGATGG + Intronic
1172221331 20:33276967-33276989 ACCAGGGGCTGGAGGTGAGATGG - Intronic
1173000811 20:39104373-39104395 ATCTGTGTGTGGGGGAGAGGAGG + Intergenic
1173089368 20:39955632-39955654 GGCTGGGTCTGGAGGTGTGAAGG - Intergenic
1173198614 20:40937520-40937542 AACTGGATATGGAGGTGAGAGGG + Intergenic
1173337564 20:42125104-42125126 ATCTGGGTCTAGGGCTGGTAAGG + Intronic
1173409154 20:42794302-42794324 ATGGAGGTGTGGGGGTGAGAGGG - Intronic
1174201853 20:48811934-48811956 AAGTGGGTCTGCGGTTGAGATGG - Intronic
1174378540 20:50141840-50141862 ATCTGGGTCTGGGGTGGGGTTGG - Intronic
1174455015 20:50642706-50642728 ATGTGGGGCAGAGGGTGAGAGGG - Intronic
1174988747 20:55485949-55485971 ACCTGAGTCTGGGAGTTAGAGGG - Intergenic
1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG + Intergenic
1176031384 20:63014696-63014718 ATCTGGGGGTGGGGGTGGGCGGG - Intergenic
1176039223 20:63055729-63055751 CTCTGGGCCTGGGGGTGGGCTGG + Intergenic
1176144828 20:63560952-63560974 CTCTGGGTCTAGGGGTGTCAGGG - Intronic
1177843802 21:26265143-26265165 ATCTGGGTCTGAGGATGAAAAGG - Intergenic
1178347824 21:31846969-31846991 ATCTGGGTATGTGGGGGAGGAGG + Intergenic
1178763062 21:35422561-35422583 CTCTGGGTCTTGGGGTGATGAGG - Intronic
1179414660 21:41188555-41188577 CCCTGGGTCTGGGGGGGTGATGG - Intronic
1179636677 21:42715918-42715940 ATCTGGGGCTTGGGGCGGGAGGG - Intronic
1180183005 21:46126347-46126369 ATCTTGGGCTGTGGGTGGGAAGG + Intronic
1180911922 22:19456687-19456709 AGCCGGGGGTGGGGGTGAGAGGG - Intronic
1181419891 22:22790421-22790443 CTCTGGGTCTGAGGGAGAGTTGG + Intronic
1181967010 22:26663887-26663909 GGCTGGGACTGGGGCTGAGAGGG - Intergenic
1182020216 22:27075367-27075389 ATCTGAGTGTGTGGCTGAGACGG + Intergenic
1182049693 22:27303232-27303254 GTCTGGGTTTGGGGTTGAGTTGG - Intergenic
1182679708 22:32069252-32069274 ACCAGGGTCTGGGGGTGAGCGGG + Intronic
1183321369 22:37167068-37167090 CTCTGAGTCTGGGGGTTAGGTGG - Intronic
1183536347 22:38403801-38403823 GTCTGGGAATGGGGGTGGGAGGG + Intergenic
1183708654 22:39489855-39489877 AGCTGGGACTGGGTGTCAGAAGG - Exonic
1184770667 22:46594813-46594835 AGCTGGGGTTGGGGGTGAGGAGG + Intronic
1184977139 22:48070290-48070312 GTCTGGGTCTGGGGGAGAGTAGG - Intergenic
1185388649 22:50547748-50547770 AGCTGGGGCTGGGGCTGAGGTGG - Intergenic
949399208 3:3647998-3648020 ATCTGTGTGTGGGGAAGAGAAGG + Intergenic
949801820 3:7912495-7912517 CTCTGGTTTTGGGGGTGATAGGG - Intergenic
950090308 3:10290202-10290224 AGGTGGGCCTGGGGGAGAGAGGG + Exonic
950271658 3:11620769-11620791 GTCGGGTCCTGGGGGTGAGAGGG - Intronic
951962790 3:28348416-28348438 AGCTGGGTGTGGGGGTGACTGGG + Intronic
952617371 3:35290723-35290745 ATCGGTGTCTAGGGGTGAGGAGG + Intergenic
952648250 3:35689031-35689053 GTCTGGGTGTGGGGGAGAGGTGG - Intronic
953186594 3:40643400-40643422 CTCTGAGGCTGGGGGAGAGATGG + Intergenic
953449900 3:42997269-42997291 TGCTGGGTCTGAGGGTGAGAAGG + Intronic
954136269 3:48583555-48583577 ACCTGGGTCTCCGGGTGAGCAGG - Exonic
954239861 3:49285078-49285100 TTTTGGGGCTGGGGGTCAGAAGG - Intronic
954747397 3:52794919-52794941 ATCTGGGTCTTGGTGTGGAATGG + Intronic
955208885 3:56922474-56922496 ATCTGAATATGGGGGTGGGAGGG + Intronic
955387819 3:58492814-58492836 GGCTGTGTCTGGGGGTGGGACGG + Intronic
956232472 3:67032031-67032053 ATCTGTGTGTGGGGGTGGGTGGG - Intergenic
958833027 3:99112546-99112568 CTGTGTGTCAGGGGGTGAGAGGG + Intergenic
960284453 3:115811237-115811259 ATGTGGGTGTGGGTCTGAGAGGG + Intronic
961125053 3:124409884-124409906 ATCAGTGCCTGGGGGAGAGAAGG + Intronic
962131475 3:132682439-132682461 ATCTGGCTCTGGGAGTAATATGG - Intronic
962254532 3:133861368-133861390 ATGTGTGTTTGGGGGTGAGGAGG + Intronic
962746678 3:138402088-138402110 ATCTGGGGCTAGGGAGGAGAGGG + Intronic
965540937 3:169870741-169870763 ATGTGGGTCAGGGGGTGTGGAGG + Intergenic
966710027 3:182962562-182962584 ATCTGGGGTTTGGGGGGAGAGGG - Intronic
967672473 3:192254177-192254199 ACCTGGGTCTTGGGGAGAGGAGG - Intronic
968674057 4:1867707-1867729 GGCTGGGTGTGTGGGTGAGAAGG - Intergenic
969043754 4:4321467-4321489 ATCTTGAGCTGGGGGTGTGAGGG + Exonic
969494876 4:7520756-7520778 GGCTGAGTCTGGGGGTGAGGTGG + Intronic
972439645 4:39074937-39074959 AACTGGGTGTGAGGGTGAGGAGG + Intronic
972455891 4:39254785-39254807 ACCAGGGTCTGGGGGAAAGAGGG - Intronic
973629640 4:52807994-52808016 ATCTGGGTGTGGGGGTAAAGGGG + Intergenic
975441659 4:74418369-74418391 ATATGGGTGTGGGAGTGAGGGGG + Intergenic
975766730 4:77676338-77676360 AACTGAATCTGGGGGAGAGATGG + Intergenic
976861170 4:89668840-89668862 AGGTGGGACTGGGGGTGGGATGG - Intergenic
976990626 4:91360553-91360575 ATCTGGGATTGGGGAAGAGATGG - Intronic
981688651 4:147481807-147481829 ATCTGGGTCTGGGTATGCCAAGG + Intronic
981843978 4:149145480-149145502 ACCTGGGTCTGGGTGAGAGTAGG + Intergenic
982671521 4:158325485-158325507 CCCTGGGTCTGGGGGTGCAATGG - Intronic
983701732 4:170604765-170604787 ATCTGCCTCTGGTGATGAGATGG - Intergenic
984697638 4:182795389-182795411 ATATGAGTTTGGGGGTGGGAGGG - Intronic
984784348 4:183554067-183554089 ATGTGGGTGTGGGTGTGAGTGGG + Intergenic
985875603 5:2591624-2591646 GGCTGGGCCTGGGGGTGTGAGGG + Intergenic
986572736 5:9181873-9181895 CTCTGCGGCTGGGAGTGAGATGG - Intronic
986686337 5:10278387-10278409 ATGTGGGTGTGGGGGTCAGTGGG - Intronic
988447619 5:31305385-31305407 ATCTGGATCTTGGGCTGTGACGG - Exonic
988466288 5:31495753-31495775 ATCTGGGTCGGTGGGTGAGCAGG + Intronic
988511464 5:31868029-31868051 ATCTGGGCCTGAGGCTCAGAAGG + Intronic
989986996 5:50712760-50712782 ATATGGATCTGGTGGTCAGAAGG + Intronic
990266724 5:54084630-54084652 ATCTGGCTCTGGAGGGGAGATGG - Intronic
993478052 5:88389047-88389069 AGCTGGGGCGGGGGGTGAGGCGG + Intergenic
993885566 5:93411696-93411718 ATCTGTGCCTGGGGGTGAGATGG - Intergenic
994123416 5:96143412-96143434 AACTGGGTCAGGGGATTAGATGG - Intergenic
994155758 5:96502691-96502713 ATCTGCTTTTGGGGGTGAGGTGG + Intergenic
994573374 5:101542495-101542517 ATCTAGGGCTGGGTGTGGGAAGG + Intergenic
997716867 5:136049056-136049078 ACCTTTGTCTGGCGGTGAGATGG + Intronic
999205861 5:149847437-149847459 ATCTGGGCATGGGGGTGAAGAGG - Exonic
999269768 5:150289960-150289982 GTGTGGGCCTGGGGGTGGGATGG + Intronic
999379618 5:151110938-151110960 CTCTGGGTTTTGGGGTGCGAAGG - Intronic
999394332 5:151217400-151217422 ACTTGGGGCTGGGGGTGAGAGGG + Intronic
999523907 5:152381713-152381735 ATCATGGCCTGGAGGTGAGAGGG + Intergenic
999684126 5:154087246-154087268 CTCTGGGTTTGGGAGAGAGATGG - Intronic
999949978 5:156638249-156638271 ACCTGGGAGTGAGGGTGAGATGG - Intronic
1000122009 5:158206583-158206605 ATATGGGTCTGAGGGTCAGCTGG + Intergenic
1001010593 5:168094405-168094427 ATCTGGGTCTGGGGATGGTTTGG - Intronic
1001788106 5:174431191-174431213 ATCTAGGTCTGGGGGTGCCTTGG + Intergenic
1001824909 5:174736594-174736616 AGCTGGGGCTGGGGCTGACATGG - Intergenic
1001872707 5:175170685-175170707 CCCTGGTTCTGTGGGTGAGAGGG - Intergenic
1002003872 5:176216153-176216175 ATCTGGGGCTGGTGGCGTGATGG - Intergenic
1002222499 5:177694453-177694475 ATCTGGGGCTGGTGGCGTGATGG + Intergenic
1002317262 5:178351186-178351208 AACTGGCTCTGGAGGTGAGCAGG + Intronic
1002424990 5:179169617-179169639 ATCTGGGACAGGGGATGAGGTGG - Intronic
1002815046 6:671812-671834 AGCTGGGGTTGGGGATGAGATGG - Intronic
1003316219 6:5014418-5014440 CTCTGCTTCTGGGGGTGAGCTGG + Intergenic
1003392093 6:5723085-5723107 TTCCGGTTCTGGGGGTGAGTGGG + Intronic
1003412499 6:5877882-5877904 GTCTTGGTCTGGGGTTTAGAAGG - Intergenic
1004228644 6:13811787-13811809 ATGTGGGGGTGGGGGTGAGGAGG - Intronic
1005610014 6:27514706-27514728 ATCAGGGGCTGAGGGTGAGAGGG + Intergenic
1005825516 6:29629263-29629285 AGGTGGGTCTGGGGGTAAGGGGG + Intronic
1006747326 6:36352478-36352500 GACTGGGGTTGGGGGTGAGAGGG - Intergenic
1007182027 6:39935820-39935842 AACTGGGTATGGGGGAGAGAAGG + Intergenic
1007247086 6:40470702-40470724 ACCTGGGGCCTGGGGTGAGAGGG - Intronic
1007599269 6:43071708-43071730 ATCTGGGGCTGGTGCTGGGATGG - Intronic
1007782875 6:44264299-44264321 ATCTGGGTCTGGAGGAGGAAGGG + Intronic
1008068336 6:47074072-47074094 ATCTGGGGATGGGGGTGGGAAGG + Intergenic
1010092498 6:72001498-72001520 ATATGGGGCAGGGGGTGAGTAGG - Intronic
1010390252 6:75328832-75328854 AGCTGAGACTGGAGGTGAGAGGG - Intronic
1011001222 6:82590635-82590657 ATAGGGGTCTGGGGGAGGGAGGG - Intergenic
1012123858 6:95401367-95401389 ATTTGAGTTTGGGGGAGAGAGGG - Intergenic
1013168192 6:107612754-107612776 ATCTGGGGCTGGGGATTGGAGGG - Intronic
1014080114 6:117276095-117276117 ATTTGGGTCTGGATGGGAGATGG + Intergenic
1014486660 6:122007524-122007546 ATATGTGTCTGGGTGTGAGGAGG - Intergenic
1018126805 6:160690494-160690516 ACCTGGGTGTGGGGAAGAGAGGG - Intergenic
1018191322 6:161311501-161311523 ATCTTGGTCTTGTGGTTAGATGG + Intergenic
1018671345 6:166180040-166180062 ATCTGGGGGTGGGGGTGATTAGG - Intergenic
1018797254 6:167196185-167196207 AGCTGGCTCTGATGGTGAGAGGG - Intronic
1018819043 6:167358579-167358601 AGCTGGCTCTGATGGTGAGAGGG + Intronic
1019377091 7:698366-698388 ATCTGCTTCTGAGGGTGAGCAGG - Intronic
1019378361 7:708238-708260 TTCTGGGTCTGTGTGGGAGAAGG - Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1020060598 7:5148976-5148998 ATTTGGGTATGAGGGTGATATGG + Intergenic
1021625849 7:22592299-22592321 ATCTGCATCTGGATGTGAGAAGG - Intronic
1021805210 7:24348701-24348723 TTCTGGGCCTGGGAGTGAGGGGG - Intergenic
1023109978 7:36800074-36800096 ATCAGGGTATGGGAGTGGGAGGG + Intergenic
1023161097 7:37296559-37296581 ATCTGGGTCTGTGAATAAGAGGG - Intronic
1024395752 7:48864768-48864790 ATTTGGGGGTGGGGGTGGGAAGG + Intergenic
1024399482 7:48907508-48907530 ATTTGGGGGTGGGGGTGGGAAGG - Intergenic
1025312532 7:57966178-57966200 ATCTGTGTCTGCATGTGAGATGG + Intergenic
1026570072 7:71521650-71521672 CTCAGGGCCTGGGCGTGAGAAGG - Intronic
1027222483 7:76222957-76222979 GTCAGGGTGTGGGGGTGAGCAGG - Intronic
1027430850 7:78111059-78111081 CTTTAGGTCTGGGGGAGAGATGG + Intronic
1027446184 7:78275387-78275409 ATCTGGGTCTGCTGGCAAGATGG - Intronic
1029201885 7:98844700-98844722 AGCAGGGGCTGGGGGTGACAAGG + Intergenic
1030042471 7:105464526-105464548 ATCTGGCTCTGGGAAGGAGAGGG - Intronic
1032710394 7:134455923-134455945 ACATGGGTCTGGGGCAGAGATGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034884192 7:154785264-154785286 ATCTCCATCTGGGGGTGAGATGG - Intronic
1035127463 7:156618873-156618895 ACCAGAGTCTGGGGGTGAGCAGG + Intergenic
1035667522 8:1389827-1389849 ATCTGGGTCTGGGGCAGATCTGG - Intergenic
1035882517 8:3257740-3257762 TTCTGGGGCTGGAGCTGAGAAGG + Intronic
1036112773 8:5922387-5922409 GTCTGGGGCTGGGAGTGAAATGG + Intergenic
1036420975 8:8595117-8595139 ACCTGTGTATGAGGGTGAGAGGG - Intergenic
1037513723 8:19609648-19609670 ATGGGGGTTGGGGGGTGAGAGGG + Intronic
1037927054 8:22851867-22851889 ATCAGGGCCTTGGGCTGAGAAGG - Intronic
1038411350 8:27362026-27362048 GACTGGGTCTGTGGGTGACAAGG + Intronic
1038436356 8:27539529-27539551 ATGTGGGTGTGGGGGAGGGAAGG - Intronic
1038495511 8:27999391-27999413 AGGTGGGCATGGGGGTGAGAGGG - Intergenic
1038975934 8:32696062-32696084 ACCTGGGGCTGGGGGTGAAGAGG - Intronic
1039439205 8:37583284-37583306 GTGTGGGTCGGGGGGAGAGATGG - Intergenic
1039862486 8:41470951-41470973 ATCAGGGTGTGGGTGTGAAAGGG + Intergenic
1042692738 8:71520663-71520685 CTCTGGCCCTGGGGGTGTGAAGG - Intronic
1044836215 8:96297966-96297988 ACCAGGTTCTGGGGGTGAGATGG - Intronic
1044871959 8:96628257-96628279 TTCTGGGTCTGGGGCTGGGGAGG + Intergenic
1045611537 8:103848445-103848467 ATCTGGGCCTAGGGTTGAGCAGG - Intronic
1046561727 8:115846388-115846410 AACTGGGACTAGGAGTGAGATGG - Intergenic
1046768746 8:118098041-118098063 CCCTGGGGCTGGGGATGAGAAGG + Intronic
1047226099 8:122956495-122956517 ATCTGACTCAGGGGATGAGAAGG + Intronic
1047526180 8:125636169-125636191 GCCTGGGGCTGGGGGTGACAGGG + Intergenic
1048494076 8:134920782-134920804 TTCTGGGTCTGAGGCTGACAAGG - Intergenic
1049392457 8:142379296-142379318 ATTTGAGTCTGGGGGTTAGGAGG - Intronic
1049684910 8:143935473-143935495 TTCTGGGTGTGGGGGTGGCAGGG - Intronic
1049783520 8:144439734-144439756 ATCTGGGGCCAGGGGTGAGACGG - Intronic
1050136944 9:2475735-2475757 ATCTGGCTCTGGGGTTGATTGGG - Intergenic
1051828075 9:21243690-21243712 ACCTGGGTCAGGAGGAGAGAAGG - Intergenic
1051837467 9:21357217-21357239 ATCTGGGTCAGGAGATGAGGGGG - Intergenic
1052853153 9:33390374-33390396 TAATGGGTCTGGTGGTGAGAGGG + Intronic
1053409565 9:37906817-37906839 ATTTGGTACTGGGGGTGTGAAGG - Intronic
1054706404 9:68466983-68467005 TTCTGGACCTGGGGATGAGAAGG + Intronic
1055510563 9:76992076-76992098 CACTGGGTCTGGCGGTGTGAAGG - Intergenic
1056446859 9:86674768-86674790 ACATGGGTCTGGGGGTCAGCTGG - Intergenic
1056722089 9:89081453-89081475 CTCAGGGTGTGGGGGTGGGAGGG - Intronic
1057996462 9:99824504-99824526 AGCTGGGGCTGGGGGTGGCAAGG + Intronic
1058916028 9:109566509-109566531 ATCTGGGAGTGGGGATGACATGG - Intergenic
1059796146 9:117699130-117699152 ATTTTGGTCTGGGGAGGAGATGG + Intergenic
1060231002 9:121825215-121825237 ATCTGTGTGTGTGTGTGAGATGG + Intronic
1060234463 9:121852718-121852740 ATCAGGGTCTGGGTGAGCGAGGG + Intronic
1060987210 9:127826596-127826618 ATCTGGGTCTTGGGGAAGGATGG + Exonic
1061397174 9:130349522-130349544 AGGAGGGGCTGGGGGTGAGAAGG - Intronic
1062529458 9:136993565-136993587 ATCTGGGTCTGGGGGAAAACAGG - Exonic
1185856707 X:3542826-3542848 ATGAGGGTCTTGGGGAGAGAGGG + Intergenic
1186771409 X:12821436-12821458 ATCAGGGTCTGGGGGTGGGGGGG + Intronic
1187191762 X:17042469-17042491 ATCTGGGTCCTGCGGTGACATGG + Intronic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1187576142 X:20558233-20558255 ATCAGAGGCTGGGGGTGAGAGGG - Intergenic
1188726079 X:33583818-33583840 ATCTGTGTGTGGGGGTGGGGAGG - Intergenic
1189198685 X:39173364-39173386 ACTTGGGTCTGGGGTTGAGTGGG + Intergenic
1189865545 X:45323532-45323554 ATTTGGGTCTGCAGGTGGGAGGG - Intergenic
1191908544 X:66122400-66122422 CTCTGGGGGTGGGGGTGAGGGGG + Intergenic
1192507263 X:71695767-71695789 ACCAGGGTCTGGGGCTGGGAAGG + Intergenic
1192512602 X:71732764-71732786 ACCAGGGTCTGGGGCTGGGAAGG - Intergenic
1192514095 X:71748745-71748767 ACCAGGGTCTGGGGCTGGGAAGG + Intergenic
1192519433 X:71785785-71785807 ACCAGGGTCTGGGGCTGGGAAGG - Intergenic
1192541113 X:71973770-71973792 AGCTGGGACTGGGTGGGAGAAGG + Intergenic
1192737160 X:73860769-73860791 CTCTGGGTCTGGTGGTGTGGCGG + Intergenic
1195066901 X:101245326-101245348 ATCTGAGTGTGGGGGTGGGTGGG + Intronic
1196192033 X:112804904-112804926 ATATGAGCCTGGGGGTGGGAGGG - Intronic
1197495282 X:127172253-127172275 ATGTGGGGGTGGGGGTGTGATGG + Intergenic
1198985203 X:142443386-142443408 ATCTGGACCTGGAGTTGAGAAGG - Intergenic
1200807468 Y:7447296-7447318 ATGAGGGTCTTGGGGAGAGAGGG - Intergenic
1200954431 Y:8929924-8929946 ACCTGGGTCTGGGGGAGGGATGG - Intergenic
1201972859 Y:19815872-19815894 ATCTGGCTCTTTGGGTGTGAAGG + Intergenic