ID: 915603309

View in Genome Browser
Species Human (GRCh38)
Location 1:156935943-156935965
Sequence CTCAGGCCAGTCCCTGAAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 216}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915603291_915603309 27 Left 915603291 1:156935893-156935915 CCTCCTCCACAGGGAGGAGTGTT 0: 1
1: 0
2: 1
3: 14
4: 172
Right 915603309 1:156935943-156935965 CTCAGGCCAGTCCCTGAAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 216
915603295_915603309 21 Left 915603295 1:156935899-156935921 CCACAGGGAGGAGTGTTGGGATC 0: 1
1: 0
2: 1
3: 19
4: 158
Right 915603309 1:156935943-156935965 CTCAGGCCAGTCCCTGAAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 216
915603303_915603309 -9 Left 915603303 1:156935929-156935951 CCCTGTGCCCCGGTCTCAGGCCA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 915603309 1:156935943-156935965 CTCAGGCCAGTCCCTGAAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 216
915603300_915603309 -4 Left 915603300 1:156935924-156935946 CCCTACCCTGTGCCCCGGTCTCA 0: 1
1: 0
2: 1
3: 22
4: 186
Right 915603309 1:156935943-156935965 CTCAGGCCAGTCCCTGAAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 216
915603301_915603309 -5 Left 915603301 1:156935925-156935947 CCTACCCTGTGCCCCGGTCTCAG 0: 1
1: 0
2: 2
3: 19
4: 236
Right 915603309 1:156935943-156935965 CTCAGGCCAGTCCCTGAAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 216
915603299_915603309 -3 Left 915603299 1:156935923-156935945 CCCCTACCCTGTGCCCCGGTCTC 0: 1
1: 0
2: 1
3: 27
4: 300
Right 915603309 1:156935943-156935965 CTCAGGCCAGTCCCTGAAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 216
915603293_915603309 24 Left 915603293 1:156935896-156935918 CCTCCACAGGGAGGAGTGTTGGG 0: 1
1: 0
2: 0
3: 16
4: 177
Right 915603309 1:156935943-156935965 CTCAGGCCAGTCCCTGAAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 216
915603298_915603309 -2 Left 915603298 1:156935922-156935944 CCCCCTACCCTGTGCCCCGGTCT 0: 1
1: 0
2: 1
3: 15
4: 269
Right 915603309 1:156935943-156935965 CTCAGGCCAGTCCCTGAAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 216
915603304_915603309 -10 Left 915603304 1:156935930-156935952 CCTGTGCCCCGGTCTCAGGCCAG 0: 1
1: 0
2: 1
3: 16
4: 229
Right 915603309 1:156935943-156935965 CTCAGGCCAGTCCCTGAAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 216
915603297_915603309 -1 Left 915603297 1:156935921-156935943 CCCCCCTACCCTGTGCCCCGGTC 0: 1
1: 0
2: 2
3: 26
4: 328
Right 915603309 1:156935943-156935965 CTCAGGCCAGTCCCTGAAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915603309 Original CRISPR CTCAGGCCAGTCCCTGAAGG AGG Exonic
900070910 1:770934-770956 CTCATGCCACTGCCTGAGGGGGG + Intergenic
901700939 1:11044539-11044561 TCCAGGCCAGACCCTGAATGGGG + Intronic
902239087 1:15076345-15076367 CTCAAGCCCCTCCCTGTAGGAGG - Intronic
902299756 1:15493571-15493593 CTCTGTCCAGACCCTGAAGGCGG - Intronic
902805888 1:18861162-18861184 CTCAGACTGGGCCCTGAAGGAGG - Intronic
902926177 1:19697221-19697243 CCCAGGGCACTCCCTGGAGGAGG - Intronic
903241640 1:21986658-21986680 CTCAATCCAGTCAATGAAGGCGG - Exonic
903245147 1:22009832-22009854 CTCAATCCAGTCGATGAAGGCGG - Exonic
903915667 1:26762441-26762463 CCCAGCCCAGGCCCTGAAGTAGG + Intronic
904451896 1:30618686-30618708 CTCAAGACAGAGCCTGAAGGAGG + Intergenic
904529659 1:31160075-31160097 CTCAGGCCAGGCTCTGTCGGTGG + Intergenic
905765365 1:40595880-40595902 ATCAAGACAGTCCCTCAAGGTGG - Intergenic
906074099 1:43039277-43039299 CTCGGGCCGGTCCCTGCGGGGGG + Intergenic
906151099 1:43588197-43588219 CTCAGGCCATGGCCTGGAGGTGG + Intronic
912746046 1:112246247-112246269 CTCAGGACATCTCCTGAAGGAGG + Intergenic
915603309 1:156935943-156935965 CTCAGGCCAGTCCCTGAAGGAGG + Exonic
917648066 1:177048284-177048306 CTCAGGAGAGTCCCTGAATCAGG - Intronic
922226665 1:223651332-223651354 GGCAGCTCAGTCCCTGAAGGAGG - Intronic
922992329 1:229924894-229924916 CTCAGGGAAGACTCTGAAGGCGG - Intergenic
1062858429 10:791218-791240 CTCAGGCAAGTCCCTGAGACAGG - Intergenic
1064374082 10:14779928-14779950 CTCACTCCAGTCCCTGAACAGGG - Intergenic
1067539836 10:47143503-47143525 CTCAGGCAGGTCCCTGAAGAGGG + Intergenic
1068960053 10:62858602-62858624 CTGAGGGCGGTCCCTGGAGGAGG - Intronic
1069606221 10:69740351-69740373 TTCAGGCCTCTCCCAGAAGGTGG - Intergenic
1069855063 10:71435688-71435710 CTCAGGCCGCATCCTGAAGGTGG + Intronic
1070693477 10:78544459-78544481 CCCAGACCAGACCCTGAAGGAGG + Intergenic
1070768595 10:79069943-79069965 CTCAGGCCAGTGCCTGGACGGGG + Intronic
1075168862 10:120094394-120094416 CTCAGGGCAGCCCCCAAAGGAGG + Intergenic
1075599243 10:123755205-123755227 CTGAGGCCAGCCCCTGGAGGTGG + Intronic
1076156938 10:128211472-128211494 CTCAGGGCTGTTTCTGAAGGTGG - Intergenic
1077045045 11:540990-541012 CTCAGCCCAGCCCCTGCAGCTGG + Intronic
1079327869 11:19509903-19509925 CTCAGACCCATCCTTGAAGGTGG - Intronic
1082996062 11:59256465-59256487 CTCAGGCAAGGCCCTGCAGGAGG - Intergenic
1083847013 11:65341400-65341422 CACAGACCAGACCCTGAAGAAGG + Exonic
1084943745 11:72627894-72627916 CAGAGGCCTGGCCCTGAAGGAGG + Intronic
1084957768 11:72700482-72700504 CTCAGGCCTGTCCCCGCAGGTGG + Intronic
1086738383 11:90336244-90336266 CTCACCACAGTCCCTGAAGGAGG - Intergenic
1088841171 11:113628806-113628828 TCAAAGCCAGTCCCTGAAGGAGG - Intergenic
1088881867 11:113979154-113979176 CACATGCCAGCCCCTAAAGGAGG - Intronic
1090245994 11:125216418-125216440 CTCAGGGCAGTCCTGGTAGGGGG + Intronic
1090435545 11:126683918-126683940 CCCACGACAGTCCCTGAAGGGGG - Intronic
1091323027 11:134665049-134665071 CACAGGCCAGGCGCTGAGGGTGG + Intergenic
1091389522 12:117572-117594 CCCCGGCCACTCCCTCAAGGTGG - Intronic
1091563543 12:1631476-1631498 CTCATCTCAGTCGCTGAAGGAGG - Intronic
1091969413 12:4773089-4773111 CTCAGGACAGTCCAGGCAGGAGG - Intronic
1093822059 12:23632612-23632634 CTCCTGCCAGTCTCTGAAGAAGG - Intronic
1095948165 12:47765636-47765658 CACAGGCCAGGCCCTGAGGTGGG - Intronic
1096255685 12:50060691-50060713 CTCAGGCCAGCACCTCAGGGAGG + Intronic
1097287649 12:57889970-57889992 CTCTGGGCATTCCCTGGAGGTGG + Intergenic
1098703701 12:73661149-73661171 CACATGCCAGTAGCTGAAGGTGG - Intergenic
1104586361 12:130051097-130051119 CTCAGGTCACTCCCTAGAGGAGG + Intergenic
1104724489 12:131067404-131067426 GTCAGCCCAGGCCCTGGAGGAGG + Intronic
1105281221 13:18963780-18963802 CCCAGCCCAGTCCCTGCAGAGGG - Intergenic
1107016891 13:35714715-35714737 CTGAGGCCAGTCTCTGCAGCGGG + Intergenic
1112104745 13:96228851-96228873 CTCTGGCCAGCCCCAGAAGGAGG + Intronic
1112333880 13:98498396-98498418 CTCAGCCCAGTGACTGTAGGAGG - Intronic
1114233248 14:20802511-20802533 CTCAGGCCAGTGCCTGACACTGG + Intronic
1118748559 14:68790970-68790992 CTTAGGCCAGGTCTTGAAGGAGG - Intronic
1122534551 14:102453032-102453054 CTCAGGACAGTACCTGGCGGAGG + Intronic
1123932289 15:25177721-25177743 CTCTGGCCAGTGCCTGATGGTGG + Intergenic
1123934255 15:25186539-25186561 CTCCGGCCAGTGCCTGATGGTGG + Intergenic
1123937749 15:25202214-25202236 CTCCGGCCAGCACCTGATGGTGG + Intergenic
1124955510 15:34357515-34357537 CACTTGCCAGTCCCTAAAGGTGG + Exonic
1126754268 15:51910095-51910117 CTCAGGGCAGCCCCTGGAGCAGG + Exonic
1127387059 15:58475199-58475221 CACAGGCCAGACACTGAAGAGGG - Intronic
1128334830 15:66779170-66779192 ATCAGGCCAGTCCCAGCAGGTGG - Intronic
1128604693 15:69027971-69027993 CAAAGTCCAGTGCCTGAAGGGGG + Intronic
1128836606 15:70813883-70813905 GACAGACCAGTCCCTGTAGGTGG + Intergenic
1129517010 15:76163048-76163070 CTTAGGACAGTCCTGGAAGGTGG + Intronic
1130133330 15:81161426-81161448 CTCAGCCCACTCCCTGCAGCAGG - Intronic
1132537697 16:491334-491356 CTCGGGGCAGGCCCTCAAGGGGG - Intronic
1132954218 16:2582610-2582632 CTCAGTCCTGCCCCTGCAGGTGG - Intronic
1132960127 16:2617553-2617575 CTCAGTCCTGCCCCTGCAGGTGG + Intergenic
1133678006 16:8093738-8093760 ATCAGGGAAGTCCCTGAAGCGGG + Intergenic
1137627714 16:49920153-49920175 CTCAGCTCAGTTCCTGCAGGAGG + Intergenic
1138298911 16:55910233-55910255 CTCAGGCCAGTGGCTGTTGGAGG - Intronic
1138506436 16:57480518-57480540 CGCTGGCCAGTCCGTGAGGGTGG + Intronic
1140092007 16:71846265-71846287 CTCTGGCCTGTCCTGGAAGGTGG + Intronic
1140852835 16:78951012-78951034 CTCAGGCCAGACATTGTAGGTGG + Intronic
1141658412 16:85428620-85428642 TGCAGGCCAGCCCCTGAGGGCGG + Intergenic
1141754490 16:85982410-85982432 CTCAGGCCAGGCACTGCGGGAGG - Intergenic
1142027701 16:87823479-87823501 TTGAGGCCAGGCCCAGAAGGAGG + Intergenic
1142249012 16:88982688-88982710 TCAAGGCCAGACCCTGAAGGTGG + Intergenic
1142284940 16:89167837-89167859 CTCAGGCCTGTCCCTGACCTGGG - Intergenic
1142760691 17:2040384-2040406 CTCAGGACAGCCTCTGGAGGAGG + Intronic
1143015684 17:3890083-3890105 CCCAGGCCAGACACAGAAGGTGG + Intronic
1143162733 17:4881872-4881894 CTGAGCCCAGTCCCTGAGGATGG + Intronic
1144479699 17:15618656-15618678 CTCAGTCCAATCCCTAAAGCAGG + Intronic
1144572196 17:16407273-16407295 CCCAGGCCTGTCCCAGGAGGGGG + Intergenic
1144918605 17:18745079-18745101 CTCAGTCCAATCCCTAAAGCAGG - Intronic
1146501601 17:33369493-33369515 CTCATGGCAGTCCTGGAAGGAGG - Intronic
1148334904 17:46834607-46834629 CTCAGCCCTGTCCCTGAGGCTGG + Intronic
1150851436 17:68707398-68707420 ATCAAGCTAGTCCCTGGAGGTGG + Intergenic
1151020728 17:70614088-70614110 CTCAGGCAGGTCCTTGTAGGAGG + Intergenic
1151248631 17:72816148-72816170 CTGAGGAAAGTTCCTGAAGGTGG + Intronic
1152246668 17:79188168-79188190 CGCAGGCCAGCCGGTGAAGGTGG - Intronic
1152415757 17:80160710-80160732 TCCAGGCCACTCCCTGATGGGGG + Intergenic
1154374737 18:13799556-13799578 CTCAGGTGAGTGCCTGAAGAGGG - Intergenic
1156158337 18:34330328-34330350 CTCAGGCCAGGTCAGGAAGGGGG - Intergenic
1157114734 18:44852205-44852227 CTCAGAGGAGCCCCTGAAGGTGG - Intronic
1157204704 18:45688252-45688274 AGGAAGCCAGTCCCTGAAGGCGG - Intergenic
1157606111 18:48926865-48926887 CTTAGGCTTGTCCCTGAAGAGGG - Intronic
1158327099 18:56324113-56324135 ATCAGGCCAGGGCATGAAGGTGG - Intergenic
1159130191 18:64272373-64272395 CTCAGACCTGACCCTGAAGAAGG + Intergenic
1162368659 19:10265464-10265486 GTCAGTCCAGTCCCTGCAGAGGG + Intergenic
1163509330 19:17725893-17725915 CTGAGCCCAGTCACCGAAGGTGG - Exonic
1163608220 19:18287371-18287393 CTCAGGGCAGTGTCTGGAGGGGG + Intergenic
1163695333 19:18760876-18760898 GTCAGGCCAGGTCCTGAGGGCGG - Intronic
1165138974 19:33687974-33687996 CACAGGTCAGTGCCTGAGGGAGG - Intronic
1166144269 19:40823601-40823623 CCCAGGCTGGTCTCTGAAGGGGG - Intronic
1167429587 19:49446870-49446892 CTCAGGACAGCACCAGAAGGTGG + Intronic
925976538 2:9146004-9146026 GTGAGGCCAGGCCCTGAAGGAGG - Intergenic
928082379 2:28322685-28322707 CTTAGGCCAGGCCTTGAGGGTGG + Intronic
930710690 2:54548545-54548567 CTCATGCCAGTCAATGAAGTGGG - Intronic
932494235 2:72138607-72138629 CTCAGGCCAAGCCCTGCAGAGGG + Intronic
933337901 2:80983792-80983814 CTGAGGCCAGTACCTCAGGGAGG - Intergenic
934655542 2:96115291-96115313 CTCAGGCCAGGGCCAGAAGGAGG - Exonic
934883839 2:98007473-98007495 TTCAGTCCTGTCCCTGAAGATGG + Intergenic
934950801 2:98574143-98574165 CTCAGGCCAGGCCCAGCAAGCGG + Intronic
935018816 2:99211262-99211284 CTCACCCAAGTCCATGAAGGCGG - Intronic
937046023 2:118852369-118852391 CTCAGAGCATTCCTTGAAGGGGG + Intergenic
937250311 2:120519587-120519609 TTCAGGGCACTCCCTGCAGGAGG - Intergenic
938580652 2:132643450-132643472 CTCAGGCCAGTGCATACAGGAGG + Intronic
938912430 2:135898093-135898115 CTCGGGCCACTCATTGAAGGAGG + Intergenic
941920660 2:170847808-170847830 CTCAGGCCAGTCCATGTGGGGGG + Intronic
942124101 2:172805709-172805731 CTCAGGCAAGAGACTGAAGGTGG - Intronic
944291095 2:198006001-198006023 CTTAGGCCAGCAGCTGAAGGAGG + Intronic
944349712 2:198712624-198712646 CTCAGGCCAGGCCCAGTGGGTGG + Intergenic
946410894 2:219514696-219514718 CTCTGGCCAGTCCCAGCAGCCGG + Exonic
947539835 2:230968769-230968791 CACAGGCCAGACCCTGAATGAGG + Intergenic
947585448 2:231353572-231353594 CTCATGCCATGCCCTGAAGCAGG - Intronic
947619876 2:231583024-231583046 CTCAGTCCAGGCCCTGAGTGGGG - Intergenic
948690157 2:239696953-239696975 CTCAGGCCAGGCCATGGTGGTGG - Intergenic
1168758720 20:333946-333968 GTCAGGTCATTCCCTGGAGGAGG + Intergenic
1172804000 20:37598335-37598357 CTCACACCAGGCCCTGCAGGGGG - Intergenic
1173034247 20:39393624-39393646 CCCAGACCAGTCACTGAATGTGG - Intergenic
1173253424 20:41376316-41376338 CTAAGGTCAGGCCCTCAAGGTGG - Intergenic
1174403855 20:50291347-50291369 CTCAGCCCCGACCCTCAAGGAGG + Intergenic
1175195600 20:57241372-57241394 CTAATGCCAGTCCTTGAGGGAGG + Intronic
1175669656 20:60890960-60890982 ATCAGGCTTTTCCCTGAAGGAGG - Intergenic
1175918691 20:62439813-62439835 CTCAAGCCAGGCCCTGCTGGTGG - Intergenic
1175929943 20:62489123-62489145 CTTTGGCCAGTCCCTGGAGATGG + Intergenic
1176051731 20:63123431-63123453 CTCTGGCCAGTCTCTGCAGCCGG - Intergenic
1176103268 20:63374172-63374194 CTGGGGCCAGTCACTGAGGGTGG - Intronic
1178367149 21:31997472-31997494 ATTACGCCAGTCCCTAAAGGCGG + Intronic
1182429487 22:30291499-30291521 CTCAGCCCAGGCCCTCAGGGAGG - Intronic
1182555250 22:31125575-31125597 CTCAGGCCGGGCTCGGAAGGAGG - Exonic
1183442329 22:37830252-37830274 CTCAGGCCACTGCCTGAGGTAGG - Intergenic
1183554218 22:38512672-38512694 CTTTCTCCAGTCCCTGAAGGCGG + Intergenic
1183831992 22:40423127-40423149 TTCAGGCCAGGCCTTGAAGGAGG + Intronic
1184431450 22:44443498-44443520 CTCAGGCCAGTCCTGGAGGAAGG + Intergenic
1184457122 22:44616986-44617008 CCCAGGTCAGTCCGGGAAGGAGG + Intergenic
1184592518 22:45494552-45494574 CTCAGGCCAGGCGGTGATGGGGG - Intergenic
1184646252 22:45896997-45897019 CTCACCCCAGCCCCTGATGGGGG + Intergenic
1184647348 22:45903474-45903496 CGCAGGCCAGTTCCTGGAGCGGG - Intergenic
1184729922 22:46366439-46366461 GTCAGGCCCGTCACCGAAGGTGG + Exonic
1185246171 22:49774550-49774572 CTCGGGCCTGTCCCTGCACGGGG - Intronic
950336118 3:12194795-12194817 CCCAGCCCAGTCCCGGCAGGTGG - Intergenic
953415025 3:42710769-42710791 CTCAGTCCAGCCCCTGTAGAGGG - Intronic
954038002 3:47863459-47863481 CTTGGGCCAGCCCATGAAGGAGG - Intronic
954077447 3:48191166-48191188 CCCAGGAGAGTCACTGAAGGTGG + Intergenic
954664019 3:52241147-52241169 CTCATGACAGCCCCTGAAGTAGG + Intergenic
954752540 3:52821720-52821742 CACAGGCCCCTCCCTGAGGGAGG - Intronic
955400232 3:58586231-58586253 CTCACACAAGTGCCTGAAGGCGG - Intronic
962184428 3:133243294-133243316 CACAGGAGAATCCCTGAAGGAGG + Intronic
962280911 3:134051175-134051197 CTCAGGCCACTCGCTGAACCTGG + Intronic
963952486 3:151218275-151218297 CTCATGCCAGTCCATTAAAGAGG + Intronic
965604461 3:170484881-170484903 CTCAGGAGACTCCCTGAAGCTGG - Intronic
967886892 3:194339395-194339417 CTCAGTCCAGACCCCGAAAGAGG + Intergenic
968603007 4:1519327-1519349 CCCAGGCCAGCCCCTGTAGCAGG - Intergenic
968654990 4:1774599-1774621 CTCAGGCCAGTGTCTGTAGGCGG - Intergenic
968689955 4:1985306-1985328 CTGAGGCCAGGGCCTGGAGGAGG - Intronic
969320469 4:6409490-6409512 CTCAGGGCAGCCCCAGAAGGTGG - Intronic
970033893 4:11709835-11709857 TTCAGGCCATGCCCTGAAGTGGG - Intergenic
971385536 4:26137870-26137892 CTGGGGCCCGTCCCTGAAGGGGG - Intergenic
975991648 4:80264923-80264945 CTCAGGGCATTGCCTGAAGAAGG + Intergenic
976516189 4:85970092-85970114 CTCAGTCCTTACCCTGAAGGAGG + Intronic
977133127 4:93267667-93267689 CTCAGTCCAGTCCCACAAAGGGG + Intronic
978405398 4:108373294-108373316 CTCAGGCCTGACCCTGGAGAAGG - Intergenic
978708505 4:111747377-111747399 CTTAGACCAGTCCCTGGAGAGGG - Intergenic
983466393 4:168097704-168097726 CTCTGACCAGTACCTGGAGGTGG - Intronic
984562696 4:181289622-181289644 CTCTAGGCAGTGCCTGAAGGTGG + Intergenic
984712570 4:182897966-182897988 CTCAGGACAGGCCCAAAAGGAGG - Intronic
984856414 4:184199686-184199708 CTCAGGCCAGTCCTTGTTAGGGG + Intronic
986052216 5:4100918-4100940 TTCAGGCCACTCCATGAAGCTGG + Intergenic
986153385 5:5148831-5148853 CACAGGCAAGTCCCTTACGGGGG + Intronic
986446863 5:7829166-7829188 CTCAGGCCCCAACCTGAAGGAGG + Exonic
989199573 5:38750287-38750309 GGCTGGCCAGTCCCTGAAGGTGG + Intergenic
990199521 5:53355567-53355589 CTCAGGCCCGTCTCTGAAGAAGG - Intergenic
992183481 5:74221159-74221181 CTCAGCCCAGTACCTGAGGAGGG - Intergenic
993671291 5:90764556-90764578 ATGGGGCCAGTCACTGAAGGGGG - Intronic
997340459 5:133140750-133140772 GTCAGGAGAGGCCCTGAAGGTGG + Intergenic
997699365 5:135885623-135885645 CTCAGCCCTGGCTCTGAAGGGGG - Intronic
998045827 5:138985853-138985875 CACTGGCCAGTCGCTGAGGGAGG - Intronic
998475673 5:142419413-142419435 ATCAGGCCAGTCCCTTAGCGAGG + Intergenic
1001123202 5:168996844-168996866 CTCAGGCCTGTCTCAGGAGGTGG + Intronic
1001818368 5:174690404-174690426 CTCTGGCCAGGCCCTGATTGGGG + Intergenic
1002725080 5:181289302-181289324 CTCATGCCACTGCCTGAATGAGG - Intergenic
1005894132 6:30163690-30163712 CGCAACCCCGTCCCTGAAGGTGG + Exonic
1007841879 6:44723171-44723193 CTAAAGCCAATCCCTGAAGCTGG + Intergenic
1010052081 6:71517585-71517607 CTCAGGCAAGTCCTTCAGGGAGG - Intergenic
1015255543 6:131175693-131175715 CTCCTGCCCTTCCCTGAAGGAGG + Intronic
1018593024 6:165448428-165448450 CTCAGGCCAGTCAAGGAATGGGG - Intronic
1018977095 6:168574149-168574171 CACTGCTCAGTCCCTGAAGGAGG - Intronic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1020071137 7:5227673-5227695 CTGAGGCCAGACCCTGGAGCCGG - Intronic
1021434376 7:20597745-20597767 CTCAGGCGAGAGCCTGAAGCAGG + Intergenic
1027421619 7:78022427-78022449 CTCACACCATTTCCTGAAGGAGG + Intronic
1028793455 7:94878689-94878711 CTCTGGCCACTCCCCTAAGGGGG - Intergenic
1029706899 7:102280882-102280904 CTCAGGCCTGTCCAGGGAGGGGG - Intronic
1031449223 7:121893909-121893931 CTCAGTCATATCCCTGAAGGAGG - Intronic
1032799596 7:135307507-135307529 CTGAGGCCAGTCCCTGTGGCTGG - Intergenic
1033012422 7:137636604-137636626 CTCAGGGCAATTCCTGAAGATGG - Intronic
1036757012 8:11477405-11477427 CTCAGCCCCTTCTCTGAAGGAGG + Intergenic
1037894746 8:22644448-22644470 CACAAGCCAGTCCCTAGAGGTGG + Intronic
1038252668 8:25920372-25920394 CTCAGGCCAGTGCTTTATGGAGG - Intronic
1041890491 8:62863296-62863318 CTCACTGCAGACCCTGAAGGAGG + Intronic
1044957118 8:97492635-97492657 CTCATTCCAGTCCCAGCAGGTGG + Intergenic
1048163924 8:132045346-132045368 CTCAGGTGGGTCCCTGAAGGTGG - Intronic
1048542411 8:135354538-135354560 CTCAGGAGTGTCCGTGAAGGTGG - Intergenic
1048737407 8:137517111-137517133 CTGAGGCCTGTACCTGAATGAGG + Intergenic
1049035937 8:140076052-140076074 CTCAGGCCAGTCCTGAGAGGAGG + Intronic
1049286514 8:141778299-141778321 CTCAGGACAGTCCTGGATGGTGG - Intergenic
1049509338 8:143019559-143019581 CTCGGGCTACTCCCTGGAGGCGG + Intronic
1049726070 8:144147153-144147175 CTCAGGCCTGCCCCTGGCGGAGG + Intergenic
1049773877 8:144395882-144395904 CTCAGGACTGTCCATGAAAGAGG - Intronic
1051782120 9:20700870-20700892 TCCATGCCAGACCCTGAAGGGGG + Intronic
1051943769 9:22540847-22540869 CTCAGGCCAGGTCCTTCAGGAGG - Intergenic
1053066922 9:35075508-35075530 CCCAGGCCTGGCCCTGAAGCAGG + Exonic
1056110487 9:83389816-83389838 CTCACTCCAGTCCCTGAAGAAGG + Intronic
1056381985 9:86064062-86064084 CTCAGGCCCCTCCCTGGAGGTGG + Intronic
1057271624 9:93654772-93654794 CCCAGCCCAGTCCCTGCAGAGGG + Intronic
1058217602 9:102254506-102254528 CTCAGGCCATTCACTGAACTAGG - Intergenic
1059506773 9:114806323-114806345 GTTAGGAAAGTCCCTGAAGGAGG + Intergenic
1059976775 9:119725992-119726014 CTAAAGCCAGTCCATCAAGGTGG - Intergenic
1060073274 9:120569531-120569553 CTCAGGCTTCTCCCTGAATGTGG - Intronic
1060733684 9:126052992-126053014 AGCTGGGCAGTCCCTGAAGGAGG + Intergenic
1061808890 9:133151232-133151254 CGCAGGCCTGTCCCAGCAGGGGG - Intergenic
1062069269 9:134546827-134546849 CTCAGGCCATTCCCAGCAAGAGG - Intergenic
1062567882 9:137171323-137171345 CCCAGGGGAGTCCCTGGAGGAGG - Intronic
1190718322 X:53123850-53123872 CTCTCTGCAGTCCCTGAAGGTGG - Intergenic
1194250441 X:91568141-91568163 GTCATGCAAGTACCTGAAGGAGG - Intergenic
1200569393 Y:4809387-4809409 GTCATGCAAGTACCTGAAGGAGG - Intergenic