ID: 915603964

View in Genome Browser
Species Human (GRCh38)
Location 1:156939381-156939403
Sequence CGCCGATATCAGGCAGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 46}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915603964_915603973 22 Left 915603964 1:156939381-156939403 CCAAAGCCTGCCTGATATCGGCG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 915603973 1:156939426-156939448 AGCGTAGGTCTCTGCTCACACGG 0: 1
1: 0
2: 1
3: 8
4: 103
915603964_915603967 -5 Left 915603964 1:156939381-156939403 CCAAAGCCTGCCTGATATCGGCG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 915603967 1:156939399-156939421 CGGCGTTGTCTCCTTCTTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 94
915603964_915603969 7 Left 915603964 1:156939381-156939403 CCAAAGCCTGCCTGATATCGGCG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 915603969 1:156939411-156939433 CTTCTTCCAGGACCCAGCGTAGG 0: 1
1: 0
2: 1
3: 12
4: 167
915603964_915603974 30 Left 915603964 1:156939381-156939403 CCAAAGCCTGCCTGATATCGGCG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 915603974 1:156939434-156939456 TCTCTGCTCACACGGTACCCAGG 0: 1
1: 0
2: 0
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915603964 Original CRISPR CGCCGATATCAGGCAGGCTT TGG (reversed) Intronic
904818250 1:33221303-33221325 GGCCCCCATCAGGCAGGCTTGGG + Intergenic
906706206 1:47896601-47896623 CACTAAAATCAGGCAGGCTTGGG + Intronic
908742368 1:67342034-67342056 TGCCACTCTCAGGCAGGCTTGGG + Intronic
912429531 1:109621647-109621669 TGCCTTTACCAGGCAGGCTTAGG + Intronic
914847102 1:151289340-151289362 TGCAGACATCAGGCAGGGTTGGG - Intronic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
917981274 1:180271270-180271292 TGCCTACAGCAGGCAGGCTTAGG + Intronic
922664058 1:227453958-227453980 CCCCGATATCAGCCAGTCATTGG - Intergenic
1073432562 10:103495559-103495581 CGCCGAGGTCTGGCTGGCTTTGG - Intronic
1076513147 10:131026358-131026380 CAACGAAGTCAGGCAGGCTTTGG + Intergenic
1078003345 11:7514361-7514383 CGCGGATCCCAGGCAGGGTTGGG - Intronic
1105439196 13:20401877-20401899 TGCGGATATCAGGCATGTTTTGG - Intergenic
1110795394 13:79631233-79631255 CTCCGATGCCAGGCAGACTTGGG - Intergenic
1111969996 13:94901970-94901992 CCGGGGTATCAGGCAGGCTTTGG + Intergenic
1141423543 16:83931807-83931829 TGCCTATCTCAGCCAGGCTTGGG + Intronic
1145059574 17:19724291-19724313 CACCCATATCAGGCAGTCCTAGG - Intergenic
1146565605 17:33910396-33910418 TGGTGGTATCAGGCAGGCTTGGG - Intronic
1147342809 17:39764697-39764719 CTCCTTGATCAGGCAGGCTTCGG - Intergenic
1148754367 17:49964932-49964954 GGCCGAGCTCAGGCAGGCTGGGG + Intergenic
1160095836 18:75872081-75872103 CGCAGATATCAGGCAGGCTGCGG - Intergenic
1164537122 19:29094054-29094076 CACGGCTATCTGGCAGGCTTTGG + Intergenic
1166844302 19:45717457-45717479 TGCCCATATAAGGCAGGCCTTGG + Intronic
933744585 2:85561375-85561397 CGCCCAGCTCAGGTAGGCTTAGG - Exonic
1168986384 20:2052559-2052581 CTCCTATATCAGTCAGTCTTCGG + Intergenic
1170879754 20:20286247-20286269 CGCCACTATCAGGCAGGATGTGG - Intronic
1181553012 22:23651796-23651818 GGCCAATATGAGGCAGCCTTTGG + Intergenic
1182253865 22:29023841-29023863 CCCAGCTATCAGGCAGGCATGGG - Intronic
1182710583 22:32320514-32320536 TGCAGAGACCAGGCAGGCTTGGG + Intergenic
949878240 3:8641133-8641155 AGCCGCACTCAGGCAGGCTTTGG - Intronic
957992451 3:87644537-87644559 CGCAGATATCAGGTTGGCTCAGG - Intergenic
959693685 3:109226663-109226685 CACCGGGATCAGGTAGGCTTGGG - Intergenic
961244612 3:125440588-125440610 CTCCAATGTCAGGCAGGATTGGG + Intergenic
963082827 3:141410203-141410225 TGCCGATATTAGCCAGACTTTGG + Intronic
964384158 3:156129515-156129537 CTCTGATATCAGGCTGACTTAGG + Intronic
967542080 3:190679745-190679767 CAGCCATATCAGGCAGGCCTAGG + Intergenic
969326014 4:6444274-6444296 CGCGGAGATCAGGGAGGCCTGGG + Intronic
978053948 4:104239536-104239558 CTCCCATATTAGGGAGGCTTGGG + Intergenic
985064338 4:186105580-186105602 CGCCGATGTCAGGCAGCGTAAGG - Intronic
999840172 5:155416139-155416161 GGCCGACATAAGCCAGGCTTTGG + Intergenic
1002160732 5:177312571-177312593 GGCAGATGGCAGGCAGGCTTGGG - Intronic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1007614945 6:43174305-43174327 TGCCCATATAAGGCCGGCTTGGG + Intronic
1012859858 6:104546045-104546067 GGCCCATATCCGGCAGGCTCTGG - Intergenic
1022571006 7:31454277-31454299 GGCCCATATCAGGCTGGTTTAGG - Intergenic
1029958147 7:104661080-104661102 CACTGATATCAGGAAGGCTTAGG + Intronic
1032487645 7:132300037-132300059 TCCCAATGTCAGGCAGGCTTTGG - Intronic
1050490553 9:6184133-6184155 AGCCCAGATCAGGAAGGCTTTGG + Intergenic
1062372676 9:136248112-136248134 GGCAGATTTCACGCAGGCTTTGG - Intergenic
1191244136 X:58212599-58212621 TGGCGATATCAGGCATTCTTAGG + Intergenic