ID: 915603965

View in Genome Browser
Species Human (GRCh38)
Location 1:156939387-156939409
Sequence AGACAACGCCGATATCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 21}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915603965_915603976 26 Left 915603965 1:156939387-156939409 CCTGCCTGATATCGGCGTTGTCT 0: 1
1: 0
2: 0
3: 2
4: 21
Right 915603976 1:156939436-156939458 TCTGCTCACACGGTACCCAGGGG 0: 1
1: 0
2: 0
3: 3
4: 70
915603965_915603977 27 Left 915603965 1:156939387-156939409 CCTGCCTGATATCGGCGTTGTCT 0: 1
1: 0
2: 0
3: 2
4: 21
Right 915603977 1:156939437-156939459 CTGCTCACACGGTACCCAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 76
915603965_915603973 16 Left 915603965 1:156939387-156939409 CCTGCCTGATATCGGCGTTGTCT 0: 1
1: 0
2: 0
3: 2
4: 21
Right 915603973 1:156939426-156939448 AGCGTAGGTCTCTGCTCACACGG 0: 1
1: 0
2: 1
3: 8
4: 103
915603965_915603969 1 Left 915603965 1:156939387-156939409 CCTGCCTGATATCGGCGTTGTCT 0: 1
1: 0
2: 0
3: 2
4: 21
Right 915603969 1:156939411-156939433 CTTCTTCCAGGACCCAGCGTAGG 0: 1
1: 0
2: 1
3: 12
4: 167
915603965_915603974 24 Left 915603965 1:156939387-156939409 CCTGCCTGATATCGGCGTTGTCT 0: 1
1: 0
2: 0
3: 2
4: 21
Right 915603974 1:156939434-156939456 TCTCTGCTCACACGGTACCCAGG 0: 1
1: 0
2: 0
3: 10
4: 89
915603965_915603975 25 Left 915603965 1:156939387-156939409 CCTGCCTGATATCGGCGTTGTCT 0: 1
1: 0
2: 0
3: 2
4: 21
Right 915603975 1:156939435-156939457 CTCTGCTCACACGGTACCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915603965 Original CRISPR AGACAACGCCGATATCAGGC AGG (reversed) Intronic
915603965 1:156939387-156939409 AGACAACGCCGATATCAGGCAGG - Intronic
1073492758 10:103865384-103865406 AGACAACTCTGATGTCAGACTGG - Intergenic
1082837989 11:57665835-57665857 AGAAAATGCCAATATCAGGCCGG + Intergenic
1089541141 11:119189599-119189621 AGACACCACCGATCACAGGCTGG + Exonic
1092677792 12:10942027-10942049 AGACAACCCCAATATCAGCCTGG - Intronic
1096308415 12:50499121-50499143 AGACAAGGCCTCAATCAGGCTGG - Intergenic
1096560516 12:52432938-52432960 AGCAAATGCCGATATCAGCCGGG - Intronic
1104858976 12:131915056-131915078 AGACAAGGCAGATATTAGGAGGG - Intronic
1106432171 13:29691616-29691638 AGACAATGCTGAAATGAGGCTGG - Intergenic
1109236818 13:59831710-59831732 ATAAAACGCCCTTATCAGGCAGG + Intronic
1141528877 16:84632039-84632061 ACACAACGCCTATTTCAGCCAGG - Intergenic
1142682818 17:1560459-1560481 AGGAAACGCAGATACCAGGCAGG + Intronic
1155480397 18:26280235-26280257 TGCCAAGGCCGATGTCAGGCAGG - Intronic
1163177046 19:15571703-15571725 AGACAAGGCTGACACCAGGCTGG - Intergenic
934503461 2:94875516-94875538 ATAGAACGCCGAGACCAGGCTGG - Intronic
940201714 2:151158399-151158421 ATAGAAAGCCCATATCAGGCTGG - Intergenic
942104545 2:172619867-172619889 AGACAAAACTGATCTCAGGCTGG + Intergenic
946504520 2:220284692-220284714 AGACAAGGCCCCTATCAGTCTGG - Intergenic
1004537422 6:16516032-16516054 AGACAAGGCCAATGTCTGGCAGG + Intronic
1019316599 7:389891-389913 AGACAGTGCCGATGTCAGGGCGG - Intergenic
1022148199 7:27569489-27569511 AGCCCACCCAGATATCAGGCTGG - Intronic
1024228136 7:47344130-47344152 GGACAAGGCCGAGCTCAGGCAGG - Intronic
1060044652 9:120330229-120330251 AGACAAGACCCACATCAGGCCGG + Intergenic
1192146780 X:68687870-68687892 AGAGAACGCCCATCCCAGGCAGG - Intronic