ID: 915603966

View in Genome Browser
Species Human (GRCh38)
Location 1:156939391-156939413
Sequence AAGGAGACAACGCCGATATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 34}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915603966_915603977 23 Left 915603966 1:156939391-156939413 CCTGATATCGGCGTTGTCTCCTT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 915603977 1:156939437-156939459 CTGCTCACACGGTACCCAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 76
915603966_915603969 -3 Left 915603966 1:156939391-156939413 CCTGATATCGGCGTTGTCTCCTT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 915603969 1:156939411-156939433 CTTCTTCCAGGACCCAGCGTAGG 0: 1
1: 0
2: 1
3: 12
4: 167
915603966_915603974 20 Left 915603966 1:156939391-156939413 CCTGATATCGGCGTTGTCTCCTT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 915603974 1:156939434-156939456 TCTCTGCTCACACGGTACCCAGG 0: 1
1: 0
2: 0
3: 10
4: 89
915603966_915603975 21 Left 915603966 1:156939391-156939413 CCTGATATCGGCGTTGTCTCCTT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 915603975 1:156939435-156939457 CTCTGCTCACACGGTACCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 119
915603966_915603973 12 Left 915603966 1:156939391-156939413 CCTGATATCGGCGTTGTCTCCTT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 915603973 1:156939426-156939448 AGCGTAGGTCTCTGCTCACACGG 0: 1
1: 0
2: 1
3: 8
4: 103
915603966_915603976 22 Left 915603966 1:156939391-156939413 CCTGATATCGGCGTTGTCTCCTT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 915603976 1:156939436-156939458 TCTGCTCACACGGTACCCAGGGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915603966 Original CRISPR AAGGAGACAACGCCGATATC AGG (reversed) Intronic
915603966 1:156939391-156939413 AAGGAGACAACGCCGATATCAGG - Intronic
1064182175 10:13127423-13127445 AAGGTGATAACACCGAAATCAGG - Intronic
1068367644 10:56071324-56071346 ATGGAGACAAAGCCAATATCAGG - Intergenic
1072764320 10:98083501-98083523 AAGGAGACCCAGCAGATATCTGG + Intergenic
1078499020 11:11850903-11850925 AAGGAGACAAGGCAGCTCTCTGG + Intronic
1089958997 11:122599197-122599219 AAGCAGACAACCCCCATGTCTGG - Intergenic
1092587412 12:9913379-9913401 AAAGAGACAAGGCCGTTCTCTGG - Exonic
1105923859 13:24988828-24988850 AAGTACACAACTCCGTTATCAGG + Intergenic
1110597357 13:77333952-77333974 AAGGAGAAAACGCTGCTACCAGG - Intergenic
1131359041 15:91772899-91772921 AAGGAGACAGAGCCAATATGAGG - Intergenic
1135224058 16:20640300-20640322 AAGGAGAAAAGGCAGATATTGGG - Intronic
1136004486 16:27319251-27319273 AATGAGACAATGCAGGTATCTGG - Intronic
1148894840 17:50833600-50833622 AAGGAGAGGAGGCCGATTTCTGG - Intergenic
1149209633 17:54288393-54288415 AAGGAGACATAACCGATAGCTGG - Intergenic
1162237509 19:9320815-9320837 AAGGGGACAAAACCGATAGCCGG + Intergenic
928044111 2:27910164-27910186 GAGGAGACAAGGCCATTATCTGG + Intronic
933397900 2:81754950-81754972 AAGGAGCCAACGCAGAGCTCAGG - Intergenic
947105342 2:226662827-226662849 AAGGAGGCAAGGCCCATATTGGG + Intergenic
1171044433 20:21797192-21797214 AAGGAGGCAATGCAGATGTCTGG + Intergenic
1173970297 20:47147394-47147416 GAGGAGGCCATGCCGATATCTGG + Intronic
1174792515 20:53493607-53493629 AAGAAGAACACGCCGATGTCAGG - Exonic
956784801 3:72633634-72633656 AAGGAGACAAAGCCTTTACCAGG + Intergenic
962170807 3:133099224-133099246 AAGGAGCCAACGCAGAACTCAGG - Intronic
976578220 4:86701562-86701584 AGGGTGACAACGACGATATGTGG - Exonic
997443854 5:133927230-133927252 AAGGAGCCAACTCCCATAGCTGG - Intergenic
998738903 5:145176289-145176311 AAGGAGAGAAAGCCAATATAAGG - Intergenic
1014335648 6:120132398-120132420 AAGGATACAACGGCTATGTCTGG - Intergenic
1016786335 6:148014821-148014843 CAGGAGATAAAGCTGATATCTGG + Intergenic
1032431969 7:131869702-131869724 AAGGAGCCAACTCTGATCTCTGG - Intergenic
1032936779 7:136741866-136741888 AAGGAGATAAAGCCAATCTCAGG + Intergenic
1037860877 8:22404816-22404838 AAGGAGGCAGCGCTGATAGCTGG - Exonic
1057896209 9:98911006-98911028 AAGGACACAGCGCAGATATGTGG + Intergenic
1192546299 X:72017650-72017672 AGGGGGAGAACGCAGATATCTGG - Intergenic
1193024573 X:76831559-76831581 AAGGAGACATTGCAGAGATCTGG + Intergenic
1198564243 X:137887066-137887088 AAGGAAACAAGGCTGATTTCTGG + Intergenic
1200171217 X:154076503-154076525 AAGGAGGCAACGCCGATGCAGGG - Intronic