ID: 915603969

View in Genome Browser
Species Human (GRCh38)
Location 1:156939411-156939433
Sequence CTTCTTCCAGGACCCAGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915603966_915603969 -3 Left 915603966 1:156939391-156939413 CCTGATATCGGCGTTGTCTCCTT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 915603969 1:156939411-156939433 CTTCTTCCAGGACCCAGCGTAGG 0: 1
1: 0
2: 1
3: 12
4: 167
915603964_915603969 7 Left 915603964 1:156939381-156939403 CCAAAGCCTGCCTGATATCGGCG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 915603969 1:156939411-156939433 CTTCTTCCAGGACCCAGCGTAGG 0: 1
1: 0
2: 1
3: 12
4: 167
915603962_915603969 13 Left 915603962 1:156939375-156939397 CCAACTCCAAAGCCTGCCTGATA 0: 1
1: 0
2: 2
3: 19
4: 189
Right 915603969 1:156939411-156939433 CTTCTTCCAGGACCCAGCGTAGG 0: 1
1: 0
2: 1
3: 12
4: 167
915603965_915603969 1 Left 915603965 1:156939387-156939409 CCTGCCTGATATCGGCGTTGTCT 0: 1
1: 0
2: 0
3: 2
4: 21
Right 915603969 1:156939411-156939433 CTTCTTCCAGGACCCAGCGTAGG 0: 1
1: 0
2: 1
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915603969 Original CRISPR CTTCTTCCAGGACCCAGCGT AGG Intronic
901702685 1:11053964-11053986 CGCCTTCCAGGACCCAACGGTGG - Intergenic
902758253 1:18563791-18563813 TTTCCTCCAGGACTCAGCCTCGG + Intergenic
904269777 1:29342371-29342393 CTTCTCCCAGGTCCAAGGGTAGG + Intergenic
904463203 1:30692633-30692655 TATCTTCCAGGTCCCAGTGTAGG - Intergenic
904999667 1:34658337-34658359 CTTCTTCCAGATCCCACGGTGGG + Intergenic
905482520 1:38271353-38271375 ATTCTTACAGGACCCATCCTGGG - Intergenic
906694572 1:47815396-47815418 CTGCTTCCAGGATCCACCTTGGG + Intronic
910179923 1:84471423-84471445 CTTCTTCAAAGAGCCAGAGTAGG - Intergenic
915603969 1:156939411-156939433 CTTCTTCCAGGACCCAGCGTAGG + Intronic
915912333 1:159922889-159922911 CTGTGTCCAGGCCCCAGCGTTGG - Intronic
916289642 1:163150747-163150769 CTTCCTCCATGACACAGGGTTGG - Intronic
916499782 1:165376660-165376682 CTGCTTCCAGGACCAGGCGGGGG - Intergenic
919924938 1:202187328-202187350 CTCCTTCAAGAAGCCAGCGTTGG - Intergenic
922810355 1:228411934-228411956 GGTCTTCTAGGACCCAGCGCAGG - Intronic
1066365784 10:34775537-34775559 CTCCTTACAGGACCAAGCCTGGG + Intronic
1067558482 10:47288252-47288274 GTTGCTCCAGGACCCAGTGTGGG - Intergenic
1068451717 10:57197974-57197996 CTTCTTCAAGGATCCAGGGCTGG + Intergenic
1069622439 10:69846235-69846257 CTTCATCCAGGACCCTGTCTTGG - Intronic
1069960624 10:72077035-72077057 CTTCTTTGAGGACACACCGTGGG - Intronic
1071775764 10:88786251-88786273 CTGCTGCCAAGACCCAGGGTGGG - Intergenic
1077210252 11:1367825-1367847 CCTCTGCCAGGACCCAGGGGTGG + Intergenic
1077535476 11:3122113-3122135 CTTCTCCCATGACCCACCGCGGG - Intronic
1078366386 11:10710030-10710052 CTTCTTCCACAGCCCAGAGTTGG + Intergenic
1081423912 11:42904098-42904120 CTTCTTCCAAGAACCAGAATGGG - Intergenic
1083408427 11:62474757-62474779 CTATTTCCAGGACCCAGCACGGG - Intronic
1084266292 11:68007084-68007106 CCTCTTCAAGGAGCCAGGGTGGG + Intergenic
1085517157 11:77118334-77118356 CTTCTTCCAGAACCCACAGGTGG + Exonic
1087157739 11:94921422-94921444 CTTCTTCCATGATCCAGCACAGG + Intergenic
1103167059 12:118779145-118779167 CTTCTGCCAGTCCCCAGCCTAGG + Intergenic
1103355516 12:120317060-120317082 CATCTTTCAGAACCCAGCCTGGG - Intergenic
1104302964 12:127582100-127582122 CTTCTCCAAGGACACAGAGTAGG + Intergenic
1109747522 13:66646838-66646860 CTTCTTCCATGCCCCAGCAGTGG + Intronic
1112378011 13:98861998-98862020 CCTCTTCCAGGACACAGGTTAGG + Intronic
1113548038 13:111169624-111169646 CTTCTTCCTGGTCCTTGCGTTGG + Intronic
1114380839 14:22201792-22201814 ATTATTCCAGGAGCCAGTGTGGG + Intergenic
1115318331 14:32050407-32050429 ATTCTTCCAGGACCTAGGATTGG - Intergenic
1119019561 14:71096887-71096909 CTTCTTCTAGAACCCAGCTAAGG - Intronic
1122882059 14:104694678-104694700 CTGCTACCAGGGCCCAGGGTGGG - Intronic
1124107447 15:26753274-26753296 CTTCTTGCCACACCCAGCGTAGG - Intronic
1126327290 15:47493480-47493502 CTTCTTCCAATGCCCAGCATTGG - Intronic
1129691842 15:77718160-77718182 CTTCTTCCAGGGCCCACGGAGGG + Intronic
1130794595 15:87195238-87195260 CTTCTTCGTTGACCCAGTGTGGG - Intergenic
1131395538 15:92082706-92082728 CTTCTTCCCAGACTCAGAGTTGG + Intronic
1131510392 15:93046714-93046736 CCTCCTCCATGACCCAGCTTGGG - Intronic
1131824085 15:96303454-96303476 CTGCTTCCAAGTCCCAGCCTGGG + Intergenic
1135936062 16:26781174-26781196 CTTCTTCCAGGATCCATGGATGG + Intergenic
1137384758 16:48031191-48031213 CCTCTTCCAGGATCCAGTGTAGG + Intergenic
1137538204 16:49343376-49343398 CATCTTTCAGGACCTAGCCTTGG - Intergenic
1141139740 16:81489620-81489642 ATTCTCCCAGGACCCAGCTGTGG + Intronic
1141992059 16:87616094-87616116 CAGCTTCCAGGCCCCAGGGTTGG + Intronic
1142237363 16:88928542-88928564 CCTCTTCCAGCACCCAGTGAGGG + Intronic
1142278974 16:89137915-89137937 CTGCTTCCAGGGCCCAGCTGGGG + Intronic
1142336157 16:89490560-89490582 CTGGCTCCAGGACCCAGCGGCGG + Exonic
1143461579 17:7107895-7107917 CCGCTTCCAGGAGGCAGCGTGGG - Exonic
1143844261 17:9760914-9760936 CTTCCTCCAGACCCCAGGGTAGG - Intergenic
1147801475 17:43092849-43092871 TTTCTTTAAGGACCCAGAGTGGG + Exonic
1147864074 17:43541570-43541592 GTTCTTCCAGAATCCAGCTTGGG - Intronic
1147922794 17:43928313-43928335 CTTCTTCCAGTGCCTAGCATAGG + Intergenic
1151834057 17:76571993-76572015 ATTCTTCCAGGGGCCAGTGTGGG + Intronic
1152357493 17:79813948-79813970 CTCCTTCCAGCAACCAGGGTGGG - Intergenic
1152605543 17:81287831-81287853 CTTCTTCCAGGACACAGCCAAGG + Intronic
1153523727 18:5976448-5976470 CCTCTTCCTGCACCCAGGGTGGG - Intronic
1154170939 18:12049523-12049545 CTCCTTCCAGAAACCAGCTTTGG - Intergenic
1156468459 18:37362560-37362582 CTTCTGCCAGGACACAGGGAGGG + Intronic
1157478840 18:48040045-48040067 CTTCTACCAGGGGCCAGGGTGGG + Exonic
1160946966 19:1648215-1648237 CTTCCCCTAGGACCCAGCCTCGG + Intronic
1161178711 19:2864982-2865004 CTTGTTCAAGAGCCCAGCGTTGG + Intergenic
1161354454 19:3811090-3811112 CATCAGCCAGGAGCCAGCGTTGG + Intronic
1164592891 19:29515843-29515865 CTCCTTCCAGGACCCGGGGCCGG - Intergenic
1165994982 19:39837649-39837671 CTTCTTCCAGAAGCCTGCGGTGG + Intronic
1166123593 19:40700408-40700430 CTTCTTCCGGGTCCCAGCCGTGG - Exonic
1166750004 19:45160072-45160094 CTACTTCTGGGACCCAGAGTTGG - Exonic
1168574515 19:57498962-57498984 CTTCCTCAAGGACCCAACATTGG - Intronic
1168618444 19:57856974-57856996 CTTCTTGCAAGACCCTGCTTAGG + Intronic
1168625059 19:57911632-57911654 CTTCTTGCAAGACCCTGCTTAGG - Intronic
926053391 2:9758862-9758884 CTTGTTCCAGCAGCCAGGGTTGG + Intergenic
926365484 2:12129387-12129409 CTTGTTCCAGGACACAAGGTAGG - Intergenic
927206609 2:20615189-20615211 TTCCTCCCAGGACCCAGGGTGGG + Intronic
929441623 2:41969711-41969733 CTTTCTCCAGGAGCCAGGGTTGG - Intergenic
930050861 2:47215352-47215374 CTTTCTCCAGGATCCATCGTAGG + Intergenic
932134675 2:69217944-69217966 CTTCCTCCAGGAATCAGCCTGGG - Intronic
935118426 2:100158663-100158685 TTTCTTGCAGGACCCAGGGCTGG - Intergenic
937479551 2:122244104-122244126 CTTCTTCCAGGAGCTAGGATTGG + Intergenic
940526392 2:154820185-154820207 CTTCTTCCAGGATCCAACCCAGG + Intronic
948595594 2:239077317-239077339 GTTCTTCCAGGACTCAGCTGGGG + Intronic
1169650839 20:7865481-7865503 CTCCTTGCAGGACCCAGCTGAGG + Intergenic
1170703084 20:18721865-18721887 CCTCTTCCAGGACAGAGCGCAGG - Intronic
1170933783 20:20792485-20792507 CTTCTTGGAGGAACCAGCCTAGG + Intergenic
1172004302 20:31807487-31807509 CTTCTTTCAGGAGCAAGGGTGGG + Intergenic
1172316674 20:33960823-33960845 CTATTTCCAGGTCCCAGCATGGG - Intergenic
1174172764 20:48627603-48627625 CTTCTTCCAGGGCCCAAGGGTGG - Exonic
1175188711 20:57197280-57197302 CTTCTTGCAGGACTCACTGTGGG - Intronic
1176132777 20:63503258-63503280 CTTCCTCCAGGGCCCAGAGGAGG - Intergenic
1177042178 21:16127786-16127808 CTTCATCCATGTCCCAGCGAAGG + Intergenic
1180754719 22:18153029-18153051 CTTCTTACAAGGCCCAGCCTAGG - Intronic
1180966339 22:19789675-19789697 CCTCTTCCTGGGCCGAGCGTTGG + Intronic
1181056507 22:20262852-20262874 CTTCTGCCAGGGCCCAGCTCGGG - Intronic
1181256580 22:21566831-21566853 CATTTTCCAGGTCCCAGCATTGG + Intronic
1182644559 22:31797663-31797685 CTTCATCCAGTATCCAGTGTTGG + Exonic
1182728457 22:32467760-32467782 ATTGTTCAAGGACCCAGCGTTGG - Intergenic
1183468036 22:37989930-37989952 CCTCTTCCAGGACACACCTTGGG + Intronic
1185267949 22:49914411-49914433 CTTCTCCCAGCCCCCAGGGTGGG - Intronic
950615960 3:14158416-14158438 GTGCCTCCAGGACCCATCGTGGG - Exonic
950776689 3:15356379-15356401 CTTCTTCCCGGTCCTAGCGCTGG + Intergenic
952549503 3:34460669-34460691 CCCCTTCCAGGACCCTGGGTGGG + Intergenic
953331254 3:42054553-42054575 CTTCTTCCAGGCACCAGGCTAGG - Intronic
954258125 3:49420229-49420251 TTTCTCCCAGCAGCCAGCGTTGG + Exonic
954320262 3:49827783-49827805 GTTTTTCCAGGACCCAGCATGGG - Intergenic
957946321 3:87067985-87068007 CTTCCTCCAGGACACACAGTGGG - Intergenic
959747314 3:109791639-109791661 ATTCCTCCAGGACCTAGAGTTGG + Intergenic
960901392 3:122557756-122557778 CTTCCTGGAGGACCCAGCTTGGG + Intronic
962936792 3:140088758-140088780 TTTCTTCCTGGACCCAGCAAGGG + Intronic
964691490 3:159454691-159454713 AGACTTCCAGGACCCAGAGTTGG - Intronic
964938672 3:162126990-162127012 CTTCTTCCATGCCCCAACCTGGG + Intergenic
965122819 3:164584702-164584724 ATTCTTCCATTACCCAGGGTAGG - Intergenic
968529942 4:1086483-1086505 CTTCTTGCAGGAGCCAGCCTGGG - Intronic
968534503 4:1114270-1114292 CTGCTTCCAGGTTCCAGCATGGG + Intergenic
968675660 4:1877577-1877599 CTTCTGCCAGGTCTCAGCTTGGG + Intronic
972641571 4:40930064-40930086 TCTGTTCCAGGACCCAGCCTAGG - Intronic
979100371 4:116604634-116604656 CTTCCTCCAGTCCCCAGCGGTGG - Intergenic
982165424 4:152609506-152609528 CCTCTTCCAGGACTCAAAGTTGG + Intergenic
985895456 5:2748247-2748269 CTTCTTCCCGGACCCTCCCTCGG + Intronic
986281074 5:6323035-6323057 GTTCTAGCAGGACCCAGCCTGGG - Intergenic
993457921 5:88145902-88145924 CTTCTTGCAGGCCCCAGAGTTGG + Intergenic
995141700 5:108742577-108742599 CTTCTTCCTGGACCAAGCTGAGG + Intergenic
995897155 5:117027958-117027980 CTTCTTCCTTGCCCCAGCCTGGG - Intergenic
997349545 5:133220854-133220876 CTCCTCCCAGGCCTCAGCGTGGG - Exonic
997967384 5:138369428-138369450 GTTCTTACATGACCCAGAGTTGG - Intronic
998804814 5:145907704-145907726 TTTCTTCCAGGACCCCGTGTCGG - Intergenic
999543128 5:152596506-152596528 CCTCTTCCAGGACCCAGCTTAGG + Intergenic
1000185667 5:158855512-158855534 ATCCCTCCAGGACCCAGGGTGGG - Intronic
1006824848 6:36927221-36927243 CTTCTACCAAAACCCAGCATAGG + Intronic
1007265811 6:40595115-40595137 CTTGTTCCAGGACCCCGAGATGG - Intergenic
1007718704 6:43872546-43872568 CTTCTCTCAGGACCCAGGCTGGG + Intergenic
1008369427 6:50715560-50715582 CTCCTGCCAGGGCCCAGCCTGGG + Exonic
1009494451 6:64330480-64330502 CTTGATCCAGGTCCCAGCATTGG + Intronic
1012964850 6:105662498-105662520 CTTCTCCCATGACCCAGAATAGG - Intergenic
1019276879 7:180343-180365 CTCCTGCCAGGACCCTGCTTCGG + Intergenic
1019729847 7:2623752-2623774 CCTCTTCCAGCCCCCAGCCTAGG - Intergenic
1023055492 7:36286747-36286769 CTCCTGCCAGGACCCACCGCTGG - Intronic
1023836122 7:44068191-44068213 CTGCATCCAGGGCCCAGCGCAGG - Intronic
1024118594 7:46215358-46215380 TTTCTTCCAGGGCCCAGGGAAGG + Intergenic
1025858242 7:65303135-65303157 CTTGTACCAGGACCCATCTTGGG + Intergenic
1029213966 7:98931783-98931805 TTGGTTCCAGGACCCTGCGTGGG + Intronic
1030697514 7:112602316-112602338 CTTCATCCATGACCCAGCAAAGG - Intergenic
1031153594 7:118083367-118083389 CTTGTTCCAGGATCCAGCCCTGG - Intergenic
1031333910 7:120502214-120502236 CTTTTAGCAGGACCCAGCTTGGG - Intronic
1033268536 7:139910024-139910046 CATCTTCCAGAACTCAGCTTGGG + Intronic
1037825730 8:22159686-22159708 CCTCTCCCAGCACCCAGCGATGG + Intronic
1039471806 8:37818117-37818139 CTTCCTCCAAGACCAAGCCTGGG - Intronic
1039798222 8:40933208-40933230 CTTCTTCCCAGCCCCAGCCTCGG - Intergenic
1048883386 8:138888439-138888461 CATCTGCCAGGCCCCAGAGTGGG + Intronic
1049346633 8:142142710-142142732 CACCTTCCAAGACCCAGGGTTGG + Intergenic
1049443735 8:142620612-142620634 CTCCTCCCATGTCCCAGCGTGGG - Intergenic
1051575062 9:18605880-18605902 CTGCTTCCACCACCCAGCCTGGG - Intronic
1053365211 9:37517981-37518003 CTCCTGCCAGGACTCAGCCTGGG - Intronic
1053375768 9:37605145-37605167 GTGCTTCCAGTACCCAGCCTGGG + Intronic
1056662012 9:88550690-88550712 CTTCCTCCAGGACCCTTAGTAGG + Intronic
1058769280 9:108214763-108214785 CAGCTTCCAGGAGCCAGAGTAGG - Intergenic
1059071678 9:111144326-111144348 GTTCTTCCAGGACCCAGCCAAGG - Intergenic
1060740997 9:126097583-126097605 CTTTTTCCAGGGCCCAGTGGAGG - Intergenic
1061287321 9:129631469-129631491 CTGCTGCCAGGACCCAGCTGAGG + Intronic
1061506806 9:131036274-131036296 CTTCTTCCAGGACCGCCCGTGGG + Exonic
1062037042 9:134386974-134386996 CGTCTTCCTGGGCCCAGCGTTGG + Intronic
1062096491 9:134706519-134706541 CTTCTTCCAGGGCACAGTGGGGG - Intronic
1062567715 9:137170649-137170671 CTCCTTCCTGCACCCAGCTTTGG - Intronic
1062725819 9:138072962-138072984 CCTCTGCCAGGTCCCAGCGAGGG + Intronic
1186182847 X:6989942-6989964 CTTCCTCCAGGACTCAGGGAAGG + Intergenic
1187125911 X:16454233-16454255 CTTCCTCCAGGAGGCAGCATGGG - Intergenic
1188647798 X:32591882-32591904 CTTCTCCCAGGAGCCAGTGCGGG - Intronic
1189202852 X:39212557-39212579 CTTCTTCAATGACCCAGGGTTGG - Intergenic
1190321075 X:49179523-49179545 CTTCTTCCAAGGCCCAGCTGTGG + Intronic
1192247611 X:69386828-69386850 CTAGTTCTAGGACCCAGCTTGGG + Intergenic
1195812120 X:108845741-108845763 CTTCATCCAGGTCCCAGCAAAGG - Intergenic
1197391936 X:125878171-125878193 CCTATTCCAGGACCTAGCTTGGG - Intergenic
1198807528 X:140505700-140505722 GTGCGTCCAGGACGCAGCGTGGG + Intergenic
1199175908 X:144786923-144786945 CTTCATCCACGACCCTGCGAAGG + Intergenic
1199375934 X:147109472-147109494 CTTCTTGCAGGACACAGAGAAGG + Intergenic
1199665528 X:150093621-150093643 CTTCTTTCAGGGCCCAGCCAGGG + Intergenic
1200052769 X:153443764-153443786 CTTCTTACCTGACCCAGCGTTGG + Intergenic
1200257854 X:154594345-154594367 CTTTATCCATGACCCAGCCTCGG + Intergenic