ID: 915603973

View in Genome Browser
Species Human (GRCh38)
Location 1:156939426-156939448
Sequence AGCGTAGGTCTCTGCTCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915603964_915603973 22 Left 915603964 1:156939381-156939403 CCAAAGCCTGCCTGATATCGGCG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 915603973 1:156939426-156939448 AGCGTAGGTCTCTGCTCACACGG 0: 1
1: 0
2: 1
3: 8
4: 103
915603968_915603973 -7 Left 915603968 1:156939410-156939432 CCTTCTTCCAGGACCCAGCGTAG 0: 1
1: 1
2: 0
3: 13
4: 186
Right 915603973 1:156939426-156939448 AGCGTAGGTCTCTGCTCACACGG 0: 1
1: 0
2: 1
3: 8
4: 103
915603962_915603973 28 Left 915603962 1:156939375-156939397 CCAACTCCAAAGCCTGCCTGATA 0: 1
1: 0
2: 2
3: 19
4: 189
Right 915603973 1:156939426-156939448 AGCGTAGGTCTCTGCTCACACGG 0: 1
1: 0
2: 1
3: 8
4: 103
915603965_915603973 16 Left 915603965 1:156939387-156939409 CCTGCCTGATATCGGCGTTGTCT 0: 1
1: 0
2: 0
3: 2
4: 21
Right 915603973 1:156939426-156939448 AGCGTAGGTCTCTGCTCACACGG 0: 1
1: 0
2: 1
3: 8
4: 103
915603966_915603973 12 Left 915603966 1:156939391-156939413 CCTGATATCGGCGTTGTCTCCTT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 915603973 1:156939426-156939448 AGCGTAGGTCTCTGCTCACACGG 0: 1
1: 0
2: 1
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915603973 Original CRISPR AGCGTAGGTCTCTGCTCACA CGG Intronic
904784021 1:32972273-32972295 AGACAAGGTCACTGCTCACATGG + Intergenic
908450356 1:64248241-64248263 ATCGTATTTCTCTGGTCACAGGG - Intronic
911266207 1:95746658-95746680 AGAGCAGGTCTCTGATCCCAGGG - Intergenic
912578257 1:110695468-110695490 ACCTTTGGTCTCTGCTCACCTGG - Intergenic
915603973 1:156939426-156939448 AGCGTAGGTCTCTGCTCACACGG + Intronic
920219772 1:204388304-204388326 TGGCTAGGTCTCTGCTCTCAAGG - Intergenic
922491621 1:226021597-226021619 AGGCAAGGTCTCTGCTCTCAAGG + Intergenic
923500860 1:234562517-234562539 ACCGTAGGTCTCAGCCCAAATGG + Intergenic
923923170 1:238592856-238592878 AGCGTAGGGCTCCACTTACACGG - Intergenic
1063352391 10:5367709-5367731 ATCTTGGGGCTCTGCTCACACGG - Intronic
1071084204 10:81849280-81849302 AGCGTAGGTCTCTTTACAGATGG - Intergenic
1074861056 10:117510930-117510952 AGAGAAGGTCCCTGCTCCCACGG + Intergenic
1075232328 10:120691134-120691156 AGCCCAGGTCTCTGAGCACAAGG + Intergenic
1076348846 10:129800915-129800937 AGGGCAGGTTTCTGCTCCCATGG - Intergenic
1077266290 11:1652334-1652356 AACGTGGGTCTCTGCTGCCAGGG - Intergenic
1079130198 11:17742794-17742816 AGCCTAGGCCTCTGGTCCCAGGG + Intronic
1081614537 11:44582815-44582837 AGCCTAGGGCTCTGTTCTCAAGG - Intronic
1084264885 11:67999755-67999777 ACCGCAGGTCCCAGCTCACAGGG + Intronic
1084768544 11:71327751-71327773 AGCGATGGTCCCTGCTCACATGG + Intergenic
1090951228 11:131475217-131475239 AGAGTAGATATCTGCCCACATGG + Intronic
1092501108 12:9049117-9049139 AGAGTAGGTCCCTGCTCTGAAGG - Intergenic
1095280905 12:40352051-40352073 AGCCTCAGTCTCTGCCCACAAGG + Intronic
1095557423 12:43523742-43523764 GGGGTAGGTCTCTGGTCACTGGG - Intronic
1096373557 12:51088708-51088730 AGCTTAGGCCTATGTTCACAAGG + Intergenic
1097179082 12:57160645-57160667 AGCCAAGGTCCCTGCTCCCACGG - Intronic
1099629334 12:85120810-85120832 AGTGTAGGTCTCTTTTCACCAGG - Intronic
1100527242 12:95431375-95431397 AGGGTAGATCTCTGCCTACATGG + Intergenic
1103629591 12:122248833-122248855 ACCCTTGGCCTCTGCTCACAGGG + Intronic
1104706583 12:130951919-130951941 AAAGAAGGTCTCTGCTCTCATGG + Intergenic
1104964249 12:132501857-132501879 TGCCCAGATCTCTGCTCACAGGG + Intronic
1105271602 13:18881318-18881340 AGGGTAGGTCTCTGCTCCCCAGG - Intergenic
1113047861 13:106175062-106175084 GGCTCAGGTCTCTGCTCAAATGG + Intergenic
1113691912 13:112317074-112317096 AGGGTTGGTCTCTGCCTACATGG - Intergenic
1117748532 14:58896886-58896908 AGAGTAGGACCCTGCTCACCTGG - Intergenic
1118572662 14:67209378-67209400 TGCTCAGGTCTCTGCTCAAATGG - Intronic
1119428340 14:74550325-74550347 AGCCTGGGGCTCTGCTCACAAGG - Intronic
1122396100 14:101433141-101433163 AGCCTAGCTCCCTGCTCACGTGG + Intergenic
1128860436 15:71066428-71066450 ACAGTAGGTCTTTGCTTACAAGG - Intergenic
1129185339 15:73902714-73902736 AGAGAAGGTCTCTGCTCTCCAGG - Intergenic
1133456436 16:5946452-5946474 AGCCAAGATCTCTGCTCTCATGG + Intergenic
1137625895 16:49908331-49908353 AGATTAGGTCTCTGCCCTCAGGG + Intergenic
1139491903 16:67290750-67290772 AGCTTAGGCCACTGCTCCCAGGG - Intronic
1140206291 16:72936368-72936390 AACGTAGGTCTCTGCTGTCTTGG + Intronic
1141784285 16:86188200-86188222 AGCTTAGGTCTCTCCTAACGTGG + Intergenic
1144409417 17:14986018-14986040 AGGGTATTTCTCTTCTCACATGG - Intergenic
1151522110 17:74637611-74637633 AACGTTGGTCTCATCTCACAAGG - Intergenic
1156407120 18:36793292-36793314 AATGGAGTTCTCTGCTCACAGGG - Intronic
1159113880 18:64091365-64091387 AGGGTCTCTCTCTGCTCACATGG + Intergenic
1161587253 19:5112390-5112412 AGGGAAGGTCACTGCTCAAAGGG - Intronic
1161637354 19:5397222-5397244 AGCCTATGTTTCTGCTCACCTGG - Intergenic
1165458889 19:35932483-35932505 AGCACAGGTTTCTGTTCACAGGG + Intergenic
1165814501 19:38633292-38633314 AGGGTAGGGCTCTGATCAGATGG + Intronic
1166967867 19:46541168-46541190 AACATAGGTTTCTGCTCATATGG - Intronic
1168288106 19:55344433-55344455 AGAGTGGGTATTTGCTCACAAGG + Intronic
934884931 2:98016243-98016265 AGCTTAGGCCTCTGCCCAGAAGG + Intergenic
938116121 2:128603909-128603931 AGCCCAGGGCTCTGCACACACGG + Intergenic
939728256 2:145750591-145750613 AACGTAGGTTTCTACTTACAAGG - Intergenic
944661523 2:201925382-201925404 AAGGAAGGTCTCTGCTGACACGG + Intergenic
948122577 2:235542263-235542285 AGGATGGGTCTCTGCTCACTAGG - Intronic
948484431 2:238271524-238271546 AGAGTAGGGCTCTGATGACAAGG + Intronic
1175820289 20:61905463-61905485 AGCGTCTGTCTCTGCTTACATGG - Intronic
1178792134 21:35710368-35710390 AGAGTCAGTCTGTGCTCACAGGG - Intronic
1185006312 22:48278831-48278853 TGTGTAGCTCTCTGCTCCCACGG - Intergenic
949386577 3:3509220-3509242 AGCCTGGGTCTGTGCACACATGG + Intergenic
950496510 3:13337266-13337288 AGCTGGGGTCCCTGCTCACAGGG + Intronic
953395678 3:42567716-42567738 AGAGTAGGTCTCTTTTCTCAAGG - Intronic
956342615 3:68243351-68243373 TGTGTAGATCTATGCTCACATGG + Intronic
956724133 3:72143218-72143240 AGCAAAGGGCTCTTCTCACACGG - Intergenic
969211964 4:5694918-5694940 AGCATAGGTCTCACCTCACTAGG + Intronic
972246643 4:37251929-37251951 AGACTAGGTCTCTGCTCTTAGGG + Intronic
972816293 4:42650049-42650071 TGCGTGGGTCTCTATTCACATGG - Intronic
975293654 4:72707117-72707139 AGCATATGTCACTGCTGACATGG - Intergenic
976474302 4:85465264-85465286 AGCATAGGTCGCTTTTCACAAGG + Intergenic
979073965 4:116246679-116246701 AGAATATGACTCTGCTCACAAGG + Intergenic
980434161 4:132747455-132747477 AGGGTAGGTTTCTGCTCACAGGG + Intergenic
983346341 4:166529802-166529824 AGCTGAGGCCTCTGCTCACAAGG + Intergenic
986443270 5:7799461-7799483 AGCTCAGGTCACTGCTCACCTGG - Intronic
987263593 5:16228657-16228679 AGTCAAGGTCTCTGCTCACAAGG + Intergenic
990410572 5:55537151-55537173 AGAGAAGTTCTCTGCCCACAAGG + Intergenic
991472466 5:66984061-66984083 AGAGAAAGTCTCTGCTCTCATGG + Intronic
995450264 5:112292134-112292156 AGCCAAGGTCTCTGGTCTCAAGG - Intronic
997847448 5:137300897-137300919 AGTGCAGCTCTCTTCTCACAAGG + Intronic
998872673 5:146568141-146568163 AGCTAAGTCCTCTGCTCACAAGG - Intergenic
1000213227 5:159129628-159129650 AGAGAAGGTCTCTGTTCTCATGG + Intergenic
1005162316 6:22878012-22878034 AGCGTAGGTCTGTTCCCAAATGG + Intergenic
1011043541 6:83057356-83057378 AGGGGAGGTGTCTGCTCTCATGG - Intronic
1015448755 6:133339863-133339885 AGCGAAGGACTGTGCTTACAAGG + Intronic
1016035435 6:139378370-139378392 AGGCTAGGTCTCTGCTCTCATGG - Intergenic
1017630315 6:156390713-156390735 AGCTTAGGTCTCTGCCCAAGGGG - Intergenic
1019641299 7:2105202-2105224 AGGGAAGGTCTCTGCCGACAAGG + Intronic
1022567055 7:31413905-31413927 AGCATAGGTCCCTGGTCACATGG + Intergenic
1022878984 7:34565995-34566017 TGTGTAGGTGTCTGCTCAAATGG + Intergenic
1029575343 7:101399963-101399985 TGAGTAAGTCTCTGCTCTCAGGG + Intronic
1032393767 7:131574438-131574460 AGACCCGGTCTCTGCTCACAAGG - Intergenic
1032430471 7:131856975-131856997 AGAGGAGGACTCTGCTCTCAGGG + Intergenic
1035271554 7:157722825-157722847 AGGGTGGGGCTCTGCTCCCACGG + Intronic
1035917942 8:3645328-3645350 AGGATAGGTCTTTGCTCAGAAGG - Intronic
1040777215 8:51059696-51059718 GACTTAGCTCTCTGCTCACAGGG - Intergenic
1040851934 8:51909845-51909867 AGAGTATGTCTCTTCTCATAAGG + Intergenic
1048016876 8:130505560-130505582 AGAGTAGGCCTCTGCCCTCAAGG + Intergenic
1049351517 8:142167232-142167254 AGCGTGGGGCTCTGGGCACAAGG - Intergenic
1055056313 9:72027527-72027549 AGGCAAGGTCTCTGCTCTCAGGG + Intergenic
1056651384 9:88467325-88467347 AGGGAAGGTCTCTGCTTTCATGG + Intronic
1057515804 9:95719405-95719427 AGCGTGGGTCCTTGCTGACATGG + Intergenic
1057930030 9:99185173-99185195 AGGGTTGGTCTCAGTTCACAGGG + Intergenic
1059648350 9:116289763-116289785 AGCCTATGTTTCTGCTCTCAAGG + Intronic
1060699700 9:125740067-125740089 AGCCTAGGTGTCTGCAGACATGG - Intergenic
1062721038 9:138044150-138044172 TGCGTGTGTCTCTGCACACAGGG + Intronic
1187365159 X:18660802-18660824 AGCCTCACTCTCTGCTCACAAGG + Intronic
1193472218 X:81920407-81920429 AGGATAGGTTTCTGCTCTCATGG - Intergenic
1194574533 X:95595879-95595901 AAGTTAGGTCTCTGCTGACAGGG - Intergenic
1199191635 X:144978332-144978354 AGACAAGGTCCCTGCTCACATGG - Intergenic
1200080503 X:153573838-153573860 AGCACAGGTCTAGGCTCACACGG + Intronic