ID: 915603974

View in Genome Browser
Species Human (GRCh38)
Location 1:156939434-156939456
Sequence TCTCTGCTCACACGGTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915603968_915603974 1 Left 915603968 1:156939410-156939432 CCTTCTTCCAGGACCCAGCGTAG 0: 1
1: 1
2: 0
3: 13
4: 186
Right 915603974 1:156939434-156939456 TCTCTGCTCACACGGTACCCAGG 0: 1
1: 0
2: 0
3: 10
4: 89
915603966_915603974 20 Left 915603966 1:156939391-156939413 CCTGATATCGGCGTTGTCTCCTT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 915603974 1:156939434-156939456 TCTCTGCTCACACGGTACCCAGG 0: 1
1: 0
2: 0
3: 10
4: 89
915603965_915603974 24 Left 915603965 1:156939387-156939409 CCTGCCTGATATCGGCGTTGTCT 0: 1
1: 0
2: 0
3: 2
4: 21
Right 915603974 1:156939434-156939456 TCTCTGCTCACACGGTACCCAGG 0: 1
1: 0
2: 0
3: 10
4: 89
915603964_915603974 30 Left 915603964 1:156939381-156939403 CCAAAGCCTGCCTGATATCGGCG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 915603974 1:156939434-156939456 TCTCTGCTCACACGGTACCCAGG 0: 1
1: 0
2: 0
3: 10
4: 89
915603970_915603974 -6 Left 915603970 1:156939417-156939439 CCAGGACCCAGCGTAGGTCTCTG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 915603974 1:156939434-156939456 TCTCTGCTCACACGGTACCCAGG 0: 1
1: 0
2: 0
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915603974 Original CRISPR TCTCTGCTCACACGGTACCC AGG Intronic
903963269 1:27070609-27070631 GCTCTGGTCACATGGTCCCCAGG - Intergenic
904301494 1:29557444-29557466 CCTTTGCTCACACTGTCCCCAGG - Intergenic
905391549 1:37639018-37639040 TCTTTGCTCACACAGGACCCTGG + Intergenic
906139774 1:43527168-43527190 TCTCTCCTCACCCTGCACCCTGG + Intronic
910132615 1:83926369-83926391 TCTCTGCTGACCATGTACCCTGG - Intronic
912550959 1:110484996-110485018 TCTCTGCCCACACGGTCCGGTGG + Intergenic
915603974 1:156939434-156939456 TCTCTGCTCACACGGTACCCAGG + Intronic
922756256 1:228098657-228098679 CCTGTGCTCCCACGGTTCCCAGG + Exonic
924625807 1:245695764-245695786 TCCCAGCTCACACGGTGCCCTGG + Intronic
924625820 1:245695831-245695853 TCCCAGCTCACACGGTGCCCTGG + Intronic
924625833 1:245695898-245695920 TCCCAGCTCACACGGTGCCCTGG + Intronic
924625845 1:245695960-245695982 TCCCATCTCACACGGTGCCCTGG + Intronic
1064339558 10:14474053-14474075 TCTCAGCTCACACGGCTCCACGG - Intergenic
1067297286 10:44982143-44982165 TCTCTGCCCACACTGCACCTGGG - Intronic
1071505733 10:86230307-86230329 TCTCTGGTCACACAGTTGCCTGG + Intronic
1071846218 10:89523923-89523945 ACTGTGCTCACGCGATACCCAGG - Intronic
1073250590 10:102118498-102118520 TCTCTCCTCCCACTGGACCCAGG + Intronic
1087117794 11:94543805-94543827 CCTCTGCTCGCACGTTCCCCCGG + Intergenic
1089735405 11:120547229-120547251 TCTCTGCCTCCAGGGTACCCTGG + Intronic
1091396251 12:155768-155790 ACTCTGCTCCCATGGTCCCCTGG - Intronic
1092900150 12:13051614-13051636 TCTCTGGTCAGACTGTACCTGGG + Intronic
1097631903 12:62074213-62074235 TCTGTGCTCAGACAGTACCATGG + Intronic
1101883244 12:108640213-108640235 TATCTGGTCACGCGTTACCCTGG + Intergenic
1103154990 12:118677018-118677040 TCTCTGCTTACACTGTAATCAGG - Intergenic
1104399008 12:128460343-128460365 CCTCTCCTCACAGGGTAGCCAGG + Intronic
1108708634 13:53012215-53012237 TCTCTGTTCACACACTGCCCAGG - Intergenic
1117997625 14:61492809-61492831 TGTCTGCTCCCAAGATACCCTGG - Intronic
1119014833 14:71039592-71039614 TCTCTTCTCACAATGTACCAGGG - Intronic
1122107972 14:99473879-99473901 TTTCAGCTAACACGGTACCATGG - Intronic
1123821329 15:24033177-24033199 ATTCTGCTCACATGGTACTCTGG - Intergenic
1129355952 15:74991879-74991901 TCTCTGCTCAGAAGGCACTCCGG + Intronic
1132013661 15:98297754-98297776 TCTCTGCTTCTACGGCACCCAGG - Intergenic
1135085562 16:19472152-19472174 TCTCTGCCTACATGGTAGCCTGG + Exonic
1142059057 16:88018125-88018147 ACTCTGCTCACCCTGGACCCGGG - Intronic
1142188079 16:88703991-88704013 TCACTGCTCAGACTGTCCCCTGG + Intronic
1143594740 17:7907458-7907480 TCTCTGTCCCCACGGTACCCAGG - Exonic
1156489111 18:37485885-37485907 TCTCTCCTTACCCCGTACCCTGG + Intronic
1158324254 18:56297235-56297257 TCTCAGCTCTCATTGTACCCTGG + Intergenic
1158682974 18:59585232-59585254 CCTCTACTCCCAAGGTACCCAGG + Intronic
1162896375 19:13766828-13766850 TCTCTGCTCTCAGGGGTCCCAGG + Intronic
1163534443 19:17869108-17869130 TCTCTGCTCAACCTGTATCCAGG + Intergenic
1166065486 19:40356049-40356071 TCTGGGCTCACACAGTCCCCTGG - Intronic
1167108181 19:47443272-47443294 TCTCTGCTCCTATGGTAACCAGG + Intronic
1168275722 19:55277317-55277339 TCTCTGATCAAACGTCACCCCGG + Intronic
1202637016 1_KI270706v1_random:51538-51560 TCTCTGCTGACTCGGTCCCAAGG + Intergenic
925101767 2:1253132-1253154 TCTCTGCCCACACAGAACTCTGG - Intronic
925369126 2:3330533-3330555 CCTCTGCTCACACTGTCTCCTGG - Intronic
934616855 2:95776770-95776792 GCTCTGCTCAGACTGTAACCCGG + Intergenic
934644038 2:96047789-96047811 GCTCTGCTCAGACTGTAACCCGG - Intergenic
934837454 2:97603883-97603905 GCTCTGCTCAGACTGTAACCCGG - Intergenic
936160233 2:110079302-110079324 GCTCTGCTCACACTGTTCACAGG - Intergenic
936184431 2:110292052-110292074 GCTCTGCTCACACTGTTCACAGG + Intergenic
938693529 2:133814740-133814762 TCTGTGCTCTCACTGTACCCTGG + Intergenic
940889334 2:159019734-159019756 TCTCTGCTCACAAAGTAGCTGGG + Intronic
943021716 2:182582388-182582410 TCTCTGCTTCCAAGGAACCCAGG + Intergenic
946248552 2:218400187-218400209 TCTCTCCTCCCACGGCGCCCCGG - Intronic
948006892 2:234617115-234617137 TCTCTGGGCACACAGTACTCTGG - Intergenic
1172032608 20:31992444-31992466 TCACTGCTCACACGCTCCCCAGG - Intronic
1172032615 20:31992496-31992518 CCACTGCTCACACGCTGCCCAGG - Intronic
1172044380 20:32070152-32070174 TCTCTGCCCCCACACTACCCTGG + Intronic
1172753626 20:37268391-37268413 TCTCCTCTGACACAGTACCCTGG - Intergenic
1176270246 20:64232476-64232498 ACTCTGGTCACACGGAGCCCTGG - Intronic
1179657073 21:42852149-42852171 TATCTGCACACCAGGTACCCCGG + Intronic
1181100368 22:20534887-20534909 TTTCTGCTCACAAGGCATCCAGG - Intronic
1183119668 22:35720645-35720667 TCTCTGCCCTCACGGAACTCAGG - Exonic
1184229143 22:43148998-43149020 TCTCTGCACACATAGTACTCAGG + Intergenic
951921775 3:27862594-27862616 TCTCACCTCACACTGAACCCAGG + Intergenic
953139218 3:40211847-40211869 TCTCTGCTGACACTCTGCCCAGG - Intronic
953290117 3:41651893-41651915 TCTTTGGTCACATGGTGCCCAGG - Intronic
960299846 3:115989192-115989214 TCTCTGTTCATATGGTACACAGG - Intronic
961809671 3:129514626-129514648 TCTCTCTTCAAACGGAACCCAGG - Intronic
962797457 3:138861625-138861647 TCTCTCCTCACAGGCTCCCCAGG - Intergenic
968041829 3:195595302-195595324 TCTGTGGTCTCAAGGTACCCAGG - Intergenic
977086441 4:92604784-92604806 TCTGTGCTCACATGGATCCCTGG - Intronic
983265128 4:165500494-165500516 TCTCTGTTCACTCGGGACCTAGG + Intergenic
989730701 5:44644574-44644596 TCTCTCCCCACACTGCACCCTGG - Intergenic
990723709 5:58729094-58729116 TCTCTGCACCCACACTACCCTGG + Intronic
992402946 5:76428121-76428143 TCTCTGCTCAAACCACACCCAGG - Intronic
994218723 5:97169610-97169632 TCTTTGCTCACAGGGTACTCTGG + Intronic
997431323 5:133843139-133843161 TCTCTGCTCACAGGCTCACCAGG + Intergenic
997694656 5:135851651-135851673 TCACTGCGCACACTGTACCCTGG - Intronic
1002186297 5:177456313-177456335 TGTCTGGTCACACAGAACCCTGG - Intergenic
1005414056 6:25582768-25582790 TCTCTGTCCACACAGTACTCTGG + Intronic
1018918195 6:168151129-168151151 TCTCCGCCCACATGGCACCCAGG - Intergenic
1025205856 7:56993028-56993050 TCTCTGCTCCTGCGGTTCCCTGG - Intergenic
1025237476 7:57244648-57244670 TCTCTGCCCACTTGGCACCCAGG - Intergenic
1025666084 7:63583910-63583932 TCTCTGCTCCTGCGGTTCCCTGG + Intergenic
1026892865 7:73992564-73992586 TCCCTGGTCACAGGGGACCCTGG + Intergenic
1030631344 7:111899404-111899426 TCTCTGGTCACAATGTACACTGG + Intronic
1032736678 7:134698742-134698764 TCTATGCACATATGGTACCCAGG + Intergenic
1035320117 7:158023317-158023339 TCTCTGCTCTCTCAGTCCCCAGG + Intronic
1036033543 8:4995693-4995715 TCTCTCCTTACACGTTCCCCAGG - Intergenic
1046452017 8:114405890-114405912 TGTCTGTTCTCACGCTACCCAGG + Intergenic
1051264668 9:15299036-15299058 TCTGTGCTCACAAAGTACCCTGG + Intronic
1060927076 9:127462451-127462473 GCTCTGATCTCACGGTACCAGGG + Intronic
1062357439 9:136171476-136171498 TGTCTGCTCAGCCGGCACCCAGG + Intergenic
1189732456 X:44035758-44035780 TCTCTGCCCACTCGTTCCCCTGG - Intergenic
1192845699 X:74905104-74905126 TTTCTACTCAAACTGTACCCTGG - Intronic
1199950880 X:152705099-152705121 TCTCCACTCTCACGGGACCCAGG - Intergenic
1199958802 X:152763362-152763384 TCTCCACTCTCACGGGACCCAGG + Intergenic