ID: 915604112

View in Genome Browser
Species Human (GRCh38)
Location 1:156940084-156940106
Sequence CTGGTGTGCTTGAGGAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 635}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915604112_915604116 -9 Left 915604112 1:156940084-156940106 CCATCTCTCCTCAAGCACACCAG 0: 1
1: 0
2: 2
3: 41
4: 635
Right 915604116 1:156940098-156940120 GCACACCAGGAAGAGCCTTCGGG 0: 1
1: 0
2: 2
3: 16
4: 166
915604112_915604119 -2 Left 915604112 1:156940084-156940106 CCATCTCTCCTCAAGCACACCAG 0: 1
1: 0
2: 2
3: 41
4: 635
Right 915604119 1:156940105-156940127 AGGAAGAGCCTTCGGGAAGGTGG 0: 1
1: 0
2: 1
3: 39
4: 295
915604112_915604120 1 Left 915604112 1:156940084-156940106 CCATCTCTCCTCAAGCACACCAG 0: 1
1: 0
2: 2
3: 41
4: 635
Right 915604120 1:156940108-156940130 AAGAGCCTTCGGGAAGGTGGAGG 0: 1
1: 0
2: 0
3: 14
4: 225
915604112_915604121 2 Left 915604112 1:156940084-156940106 CCATCTCTCCTCAAGCACACCAG 0: 1
1: 0
2: 2
3: 41
4: 635
Right 915604121 1:156940109-156940131 AGAGCCTTCGGGAAGGTGGAGGG 0: 1
1: 1
2: 0
3: 26
4: 313
915604112_915604117 -5 Left 915604112 1:156940084-156940106 CCATCTCTCCTCAAGCACACCAG 0: 1
1: 0
2: 2
3: 41
4: 635
Right 915604117 1:156940102-156940124 ACCAGGAAGAGCCTTCGGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 143
915604112_915604125 29 Left 915604112 1:156940084-156940106 CCATCTCTCCTCAAGCACACCAG 0: 1
1: 0
2: 2
3: 41
4: 635
Right 915604125 1:156940136-156940158 GGCGCCTGCCAGTTCACACTGGG 0: 1
1: 0
2: 1
3: 10
4: 81
915604112_915604124 28 Left 915604112 1:156940084-156940106 CCATCTCTCCTCAAGCACACCAG 0: 1
1: 0
2: 2
3: 41
4: 635
Right 915604124 1:156940135-156940157 AGGCGCCTGCCAGTTCACACTGG 0: 1
1: 0
2: 0
3: 15
4: 137
915604112_915604115 -10 Left 915604112 1:156940084-156940106 CCATCTCTCCTCAAGCACACCAG 0: 1
1: 0
2: 2
3: 41
4: 635
Right 915604115 1:156940097-156940119 AGCACACCAGGAAGAGCCTTCGG 0: 1
1: 0
2: 0
3: 17
4: 202
915604112_915604123 8 Left 915604112 1:156940084-156940106 CCATCTCTCCTCAAGCACACCAG 0: 1
1: 0
2: 2
3: 41
4: 635
Right 915604123 1:156940115-156940137 TTCGGGAAGGTGGAGGGTGCAGG 0: 1
1: 0
2: 3
3: 33
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915604112 Original CRISPR CTGGTGTGCTTGAGGAGAGA TGG (reversed) Intronic
900269785 1:1781142-1781164 CTGGGGAGGCTGAGGAGAGAGGG + Intergenic
900288514 1:1913926-1913948 CTGGTCAGCATGAGGAGAGAGGG + Intergenic
901155556 1:7135430-7135452 CTGGTGAGGCTGTGGAGAGAAGG + Intronic
902268143 1:15283644-15283666 CTGCTGTGCCAGAGGAGAGCTGG - Intronic
902738989 1:18421296-18421318 CTCCTGTGCTTTGGGAGAGATGG - Intergenic
903298492 1:22361291-22361313 CTGCTGAGCTAGTGGAGAGACGG + Intergenic
905253383 1:36664567-36664589 CTGGTGGCTTTGAGGAGGGAGGG + Intergenic
905897370 1:41557607-41557629 GTGGTGAGGTTGAGGAGTGATGG + Intronic
905987142 1:42295984-42296006 TTGGTGTGGTTGTGGAGAAAAGG - Intronic
906448751 1:45925515-45925537 GTGGTGTCCTTGAAGAGAGGAGG + Intronic
907629859 1:56069598-56069620 CTGGTGGGCTTGATGAGAGATGG + Intergenic
907982231 1:59494986-59495008 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
908000866 1:59677531-59677553 TTTATGTGCTTGAGGAGACAGGG + Intronic
908285251 1:62590850-62590872 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
908776682 1:67647468-67647490 TTTGTGTGCTGGAGGAGAGGGGG - Intergenic
908931452 1:69320892-69320914 GTGGTGTGCTTGAAGAAAAAGGG + Intergenic
909181016 1:72424128-72424150 CTGGTGAGGTTGTGGAGAAAGGG + Intergenic
909354735 1:74695844-74695866 CTGGTGAGGTTGTGGAGAAAGGG - Intergenic
910512263 1:88020569-88020591 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
910682852 1:89885016-89885038 GTGGTGTGGTTGTGGGGAGATGG - Intronic
910998996 1:93142250-93142272 CTTTTTTGCTTGAGGAGACATGG + Intergenic
911393548 1:97276713-97276735 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
912366359 1:109137036-109137058 CTGGTGAGTTTGAGGGGTGAAGG + Intronic
912466410 1:109877752-109877774 CGGGTGTGCTGGAGGACAGGCGG + Intergenic
912600623 1:110929398-110929420 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
914826729 1:151142717-151142739 CTGGCTTGCTTCAGGGGAGAGGG - Intronic
915604112 1:156940084-156940106 CTGGTGTGCTTGAGGAGAGATGG - Intronic
915690718 1:157687293-157687315 CTGGTGAGGCTGAGGAGAAAAGG + Intronic
915816199 1:158968451-158968473 CTGGTGAGCTTGCAGAGAAAAGG + Intronic
916363973 1:164002985-164003007 CTGGTGAGGTTGCGGAGAAAAGG + Intergenic
916599097 1:166275402-166275424 CTGGTGAGGTTGTGGAGAAATGG - Intergenic
916627704 1:166576462-166576484 ATGGTGGGGTTGAGGAAAGATGG + Intergenic
916690576 1:167186197-167186219 CTGGTGTGCTACAGCAGACATGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917803191 1:178589158-178589180 CTGGTGAGGATGAGGAGAAAAGG - Intergenic
918669280 1:187194227-187194249 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
919514966 1:198511316-198511338 TTCCTCTGCTTGAGGAGAGAAGG - Intergenic
919576744 1:199319524-199319546 CTGGTGAGATTGTGGAGAAAAGG - Intergenic
919781762 1:201225809-201225831 CGGGCATGCTTCAGGAGAGACGG - Exonic
920043870 1:203121133-203121155 ATGGTGAGCTGCAGGAGAGAGGG - Intronic
921180968 1:212630869-212630891 GTGATGTGCTGGAGGAGAGTAGG + Intergenic
921298870 1:213730405-213730427 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
922028274 1:221773732-221773754 CTGGTGGGGATGAGGAGAAAGGG + Intergenic
922381467 1:225032715-225032737 CTGGTGAGGTTGCGGAGAAAAGG - Intronic
922390152 1:225132860-225132882 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
923085393 1:230699429-230699451 CTGGTGAGGCTGAGGAGAAAAGG - Intergenic
923096897 1:230782643-230782665 CTGGTGGGGTTGGGGAGGGATGG - Intronic
923179620 1:231503637-231503659 CTGGTGAGGTTGTGGAGAAAGGG - Intergenic
924651243 1:245929343-245929365 CTATAGTGCTTGTGGAGAGACGG + Intronic
1063578026 10:7279282-7279304 CTGGTGTGGAGGAGGAGAGATGG - Intronic
1064889253 10:20150357-20150379 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1065171201 10:23031621-23031643 CTGATGTCCTTGAGAAGTGATGG + Intronic
1065299352 10:24307290-24307312 CTTGTGTTCATGAGCAGAGAAGG + Intronic
1065636398 10:27740685-27740707 CTGCTGGGCTTAAGGAGAGGAGG - Intronic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1066354080 10:34664977-34664999 GTGGTGTGTGTGAAGAGAGAGGG + Intronic
1066490959 10:35894240-35894262 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1066524345 10:36260109-36260131 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1068120619 10:52779413-52779435 GTGTTGTGCTTGAGGAGGGAGGG - Intergenic
1070025064 10:72624630-72624652 CTTGTGTGCCTGAGGAGAAAGGG - Intronic
1071075526 10:81746853-81746875 GTGGAGTGTTTGAGGAGAGTGGG - Intergenic
1071205592 10:83272564-83272586 TTGATGAGCTTGAGGAGAGAAGG + Intergenic
1072903854 10:99432542-99432564 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1073054109 10:100688245-100688267 CTGGTGTGTCAGAGTAGAGAGGG + Intergenic
1073112821 10:101072713-101072735 CTTGTTTGCTTATGGAGAGAGGG + Intergenic
1074426984 10:113359972-113359994 GTGGTGTTCATGAAGAGAGATGG + Intergenic
1074645876 10:115451617-115451639 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1075052535 10:119193502-119193524 ATGGTCTGCTTCAGGGGAGAAGG - Intergenic
1075444620 10:122504809-122504831 CTGATGAGCTTGAGGAGTGTGGG + Intronic
1075813812 10:125248700-125248722 TTGGTGAGCTTGGGCAGAGAGGG + Intergenic
1075816901 10:125271526-125271548 CAGGTGTGATCCAGGAGAGAAGG + Intergenic
1076121352 10:127939535-127939557 CAGGTGTGCTGGAGGATACATGG + Intronic
1076592629 10:131596834-131596856 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1076592950 10:131601524-131601546 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1077402515 11:2366221-2366243 CTGGAGAGCCTGAGGAGTGAGGG + Intergenic
1077730108 11:4721440-4721462 CTGAAGTGGTGGAGGAGAGAGGG - Intronic
1077823856 11:5782588-5782610 CTGGTTTGGTTTAAGAGAGATGG - Intronic
1077867417 11:6234616-6234638 CTGGTGCGCTTGAGAAGCGATGG - Exonic
1078044543 11:7901420-7901442 GGGGCGTGCTTGAGGATAGAGGG - Intergenic
1078113291 11:8418727-8418749 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1078630260 11:12996317-12996339 CTGGTGAGGTTGTGGAGAAAGGG - Intergenic
1079345338 11:19646900-19646922 CTGTAGTGCCTGAAGAGAGATGG - Intronic
1079420836 11:20286146-20286168 CTGGTGTGGATGAGGAGAAAAGG - Intergenic
1079605101 11:22355494-22355516 TTAGTGGGATTGAGGAGAGAGGG - Intronic
1079879956 11:25914618-25914640 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1079977743 11:27113159-27113181 CTGGTGAGGTTGTGGAGACAAGG + Intronic
1080796672 11:35570435-35570457 CTGGTGAGGTTGTGGAGAAAGGG + Intergenic
1081685795 11:45042180-45042202 GTGGTGTGCTAGAGGAGAAAGGG - Intergenic
1082757912 11:57096390-57096412 GTGGGGTGGTGGAGGAGAGATGG + Intergenic
1082795173 11:57373619-57373641 CTGGTGAGGTTGTGGAGAAAGGG + Intergenic
1083132911 11:60643110-60643132 CTGGTGAGGTTGAGGAGAAAAGG + Intergenic
1083529130 11:63401742-63401764 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1083594314 11:63911779-63911801 CTGGTGTCACTGAGGACAGAAGG - Exonic
1084530560 11:69725377-69725399 GTGGTTCCCTTGAGGAGAGAAGG + Intergenic
1084600938 11:70145073-70145095 CTCGTGTGGGTGAGGAGGGAGGG + Intronic
1085084111 11:73655481-73655503 CAGGTGGGCTAGAGGACAGAAGG + Intronic
1085084234 11:73656051-73656073 CTGGTGTGGCTGGGGACAGAGGG - Intronic
1085277153 11:75307561-75307583 CTGGTGTGATGGAGGAGGCATGG - Intronic
1085327439 11:75617857-75617879 CAGTTGAGATTGAGGAGAGAAGG + Intronic
1085398649 11:76221247-76221269 CTGGTGAGATTGTGGAGAAAAGG + Intergenic
1086022101 11:82242576-82242598 CTGGTGAGGTTGAAGAGAAAAGG - Intergenic
1086303408 11:85454179-85454201 ATGGTGAGGTTGAGGAGAAAGGG - Intronic
1086619067 11:88863118-88863140 CTGGTGAGGTTGTGGAGAAATGG + Intronic
1087538542 11:99484385-99484407 CTGGTGAGGATGTGGAGAGAAGG + Intronic
1088730278 11:112674804-112674826 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1088757963 11:112902502-112902524 CTGGTGTGGGGAAGGAGAGAGGG - Intergenic
1089001910 11:115059196-115059218 CTGGTGTCTTAGAGGAGAGGAGG + Intergenic
1089492951 11:118895077-118895099 CAGGTGGGCAGGAGGAGAGAGGG - Exonic
1089950884 11:122525110-122525132 GTGGTTTGTCTGAGGAGAGAAGG - Intergenic
1090181189 11:124701378-124701400 CTGGTGAGGCTGAGGAGAAAAGG - Intergenic
1090326750 11:125894032-125894054 CTGGTCTGCTTTATGACAGAGGG + Exonic
1090349882 11:126101192-126101214 CTGGTGGGGTTGAGGGGAGTTGG + Intergenic
1090705118 11:129329308-129329330 CTGGAGCTCTGGAGGAGAGATGG - Intergenic
1090878488 11:130812788-130812810 CTGGAGGGCAGGAGGAGAGAAGG - Intergenic
1091151577 11:133333999-133334021 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1091386200 12:96937-96959 CTGGTGAGGCTGTGGAGAGAGGG - Intronic
1091811528 12:3402825-3402847 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1091893772 12:4083946-4083968 GTGGTGTGCTTGGGGCGAGATGG - Intergenic
1091901824 12:4150363-4150385 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1092841259 12:12543292-12543314 CTGATGTGCTTGAGGATAGTGGG + Intronic
1093498384 12:19782882-19782904 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1093946958 12:25120267-25120289 CAGGTGTGTTAGGGGAGAGAGGG + Intronic
1093992037 12:25600805-25600827 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1095240145 12:39848530-39848552 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1095680048 12:44963582-44963604 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1095823872 12:46510734-46510756 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1095846323 12:46749191-46749213 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1096099173 12:48958503-48958525 CTGCTGTAAATGAGGAGAGAGGG - Intergenic
1096280552 12:50249180-50249202 CTGCAGAGCTTGGGGAGAGAGGG - Intronic
1096764424 12:53871987-53872009 CTGAAGAGCTAGAGGAGAGAGGG + Intergenic
1097688578 12:62713394-62713416 CTGGGCTGCTTGAGGAGGGGAGG + Intronic
1097776457 12:63652279-63652301 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1097857189 12:64475996-64476018 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1099487414 12:83245655-83245677 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1100059684 12:90559105-90559127 CTGGTGAGGCTGAGGAGAAAAGG - Intergenic
1100344006 12:93709414-93709436 CGGGTCTACTTGAGGGGAGAGGG - Intronic
1100708677 12:97229809-97229831 CTGGTGTTCTTAAGCACAGAAGG - Intergenic
1101814876 12:108138354-108138376 CTGTTGTGCCTTAGGAGTGAGGG + Intronic
1102037379 12:109779708-109779730 CTTGTGTCCTTGAGGAAAGCTGG + Intergenic
1103996954 12:124836383-124836405 CTGTTGTGCTTCCTGAGAGATGG - Intronic
1104221655 12:126790423-126790445 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1104358474 12:128109934-128109956 CTGCTGTGACTGAGGAGTGAGGG - Intergenic
1104492423 12:129206459-129206481 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1105274913 13:18911764-18911786 CTGGTGAGATTGTGGGGAGAAGG - Intergenic
1105618748 13:22046616-22046638 CAGGTGTGAGTGAGGAGAGAAGG - Intergenic
1106860388 13:33901047-33901069 CTGGTGAGGATGTGGAGAGAGGG + Intronic
1107423162 13:40268548-40268570 CTGGGGTCCTTAAGGAGAGCTGG - Intergenic
1108158138 13:47609645-47609667 CTGGTGAGGATGTGGAGAGAGGG + Intergenic
1108165146 13:47685336-47685358 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1109052623 13:57504144-57504166 TTGGTGTGCATGTGGAGAAAAGG - Intergenic
1110069377 13:71154121-71154143 CTGGTGAGGTAGAGGAGAAAGGG - Intergenic
1110208437 13:72945522-72945544 CTGGTGAGGCTGAGGAGAAAAGG - Intronic
1110645133 13:77873849-77873871 CTGCTGTGCTTGAGTAGAAGTGG + Intergenic
1110848761 13:80219923-80219945 CTGGTGAGGTTGCGGAGAAAAGG - Intergenic
1111450813 13:88412872-88412894 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1111492017 13:88991477-88991499 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1111911802 13:94321550-94321572 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1112508170 13:99987903-99987925 GAGGGGTGCTTGGGGAGAGAGGG + Intergenic
1112589641 13:100751343-100751365 CTGGGGGCTTTGAGGAGAGAAGG + Intergenic
1113227412 13:108174598-108174620 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1113239334 13:108318872-108318894 CTGGTGAGATTGAGGAGAAAAGG - Intergenic
1114257233 14:21013509-21013531 CTGATGTTAGTGAGGAGAGAGGG + Intergenic
1114661281 14:24346764-24346786 CCTGTGGTCTTGAGGAGAGAGGG + Intergenic
1115307207 14:31945221-31945243 CAAGTGTGCCTGAGGACAGAGGG + Intronic
1115391850 14:32862751-32862773 CTGGTGAGCTTGTAGAGAAAAGG - Intergenic
1115560388 14:34577557-34577579 GTGGTATGTTTGAGGTGAGATGG + Intronic
1115890982 14:38028656-38028678 CTGGTGAGATTGTGGAGAAAAGG + Intronic
1115903060 14:38175610-38175632 TTGGTGTGGTTGAGGAGACTAGG - Intergenic
1116471582 14:45291810-45291832 CTGGGGTGCTGGAGGGGAAATGG + Intergenic
1116666008 14:47776595-47776617 ATGGTCTGCTTCAGGAGACAAGG - Intergenic
1117902212 14:60546599-60546621 CTGGTGAGAATGAGGAGAAAAGG - Intergenic
1118114242 14:62757298-62757320 CTGGTGAGGGTGTGGAGAGAAGG + Intronic
1118479627 14:66151383-66151405 CTGGTATGGTTGTGGAGAAAAGG + Intergenic
1118814264 14:69298789-69298811 CAGGTGTGACTGAGGAGAGTTGG + Intronic
1118950175 14:70429085-70429107 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1119619057 14:76118088-76118110 CTGGTGAGGCTGAGGAGGGAGGG + Intergenic
1120861175 14:89256150-89256172 CAGGTGTCCTTGAGGGGACAGGG - Intronic
1123823464 15:24056236-24056258 TTGGTGTGGATGAGGTGAGAAGG + Intergenic
1124122669 15:26903589-26903611 CTGGTGAGGTTGTGGAGAAAGGG - Intronic
1124631956 15:31343065-31343087 CTCCTGTGCTTGGGGAGAGGAGG + Intronic
1125343180 15:38694443-38694465 CTGGTGGGCTGGAGTAGAGTAGG + Intergenic
1126464642 15:48950802-48950824 CTGGTGTGCTTGGGTCGCGATGG + Intronic
1126464886 15:48952774-48952796 CTGGTGAGATTGTGGAGAAAAGG + Intronic
1126567213 15:50113035-50113057 CTGGGCAGCTGGAGGAGAGAAGG - Intronic
1127174039 15:56335008-56335030 CTGGTGAGGATGAGGAGAAAAGG + Intronic
1127203652 15:56688089-56688111 CTGCTGTGTTTGTGTAGAGATGG - Intronic
1127211209 15:56776789-56776811 CTGGTTTGCTTTAGGGAAGAGGG - Intronic
1129181086 15:73875981-73876003 GTGGTGTGCATGTAGAGAGAGGG + Intronic
1129656888 15:77530292-77530314 CTGGGGTGCTTGTGGACAGCAGG - Intergenic
1129932764 15:79426060-79426082 CTGGCGTGCTTGGAGAGTGAAGG + Intronic
1129979645 15:79856151-79856173 CTGGTGAGATTGTGGAGAAAAGG - Intronic
1130424499 15:83781926-83781948 CTGGTGAGATTGTGGAGAAAAGG + Intronic
1130689169 15:86065490-86065512 CTAGTGTGAATGAGGGGAGAGGG + Intergenic
1131638507 15:94263572-94263594 CTGGTGTTCCTAAGGACAGAAGG - Intronic
1132107998 15:99078322-99078344 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1133558719 16:6930043-6930065 CTGGTTTGCTATGGGAGAGAGGG - Intronic
1134294934 16:12937326-12937348 TTAGAGTGCTTGAGGAGAGAGGG - Intronic
1135243856 16:20837111-20837133 CTTAGGTGTTTGAGGAGAGAGGG + Intronic
1136598504 16:31268107-31268129 GTGGTGAGGGTGAGGAGAGATGG - Intronic
1137969422 16:52969232-52969254 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1138627103 16:58261163-58261185 CTGATGTGCCCAAGGAGAGAGGG + Intronic
1140412814 16:74751628-74751650 CTGGTGTGATCAAGCAGAGAGGG + Intronic
1141240607 16:82261966-82261988 CTTCTGTGCTAGAGAAGAGAGGG + Intergenic
1141345289 16:83239327-83239349 CAAGGGTGCGTGAGGAGAGAGGG + Intronic
1142698052 17:1644304-1644326 CTGCTGGGCTGGAGGAGAGCTGG + Intronic
1143435661 17:6922765-6922787 GGGGTGTGCTGGGGGAGAGACGG - Intronic
1143801497 17:9386413-9386435 CTGGGGTGCTTGACTAGAAAGGG + Intronic
1144075263 17:11713536-11713558 CTGGTGAGGTTGAGGAGAAAAGG - Intronic
1144079883 17:11754462-11754484 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1144081015 17:11763930-11763952 GTGGTGTGTTTGTGGAGAGAGGG + Intronic
1144275802 17:13667077-13667099 CTGCTGTGCCTGAGGTCAGATGG - Intergenic
1144513732 17:15900392-15900414 CTGGTGAGGTTGAGGAGAAAAGG - Intergenic
1144832272 17:18138392-18138414 CTGGGGTGATTGAGGCCAGATGG + Intronic
1146210913 17:30942905-30942927 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1146268075 17:31466204-31466226 CTGGTGCACTTGAGGACAGTGGG + Intronic
1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG + Intronic
1146924996 17:36738293-36738315 CTGGTGTGGTTGTGGAGAAAGGG + Intergenic
1147498978 17:40943963-40943985 CTGGTGAGGTTGTGGAGAAATGG - Intergenic
1148053837 17:44781921-44781943 CTGGGGTGCTGGAGGCGGGAAGG + Intergenic
1148849788 17:50549028-50549050 CTGGTGGCCTGGCGGAGAGAGGG - Exonic
1148911975 17:50947683-50947705 CTGCTGTGTTTTTGGAGAGAGGG - Intergenic
1149160228 17:53685013-53685035 CTGGTGAGATTGTGGAGAAAAGG + Intergenic
1150011240 17:61506121-61506143 CTGGTATCCTTGAGGAAAGGGGG - Intergenic
1150879680 17:69009734-69009756 CTGGTGTTTTGTAGGAGAGATGG + Intronic
1151319873 17:73346586-73346608 GTGATGGGCTAGAGGAGAGAGGG - Intronic
1151681276 17:75624119-75624141 TTGGTGGGCTTGGGGAGACATGG + Intergenic
1151807701 17:76416786-76416808 CTGTTGTGCCTTGGGAGAGATGG - Intronic
1152152097 17:78608298-78608320 CTGGTGAGGTTGTGGAGAAAGGG + Intergenic
1153225384 18:2895827-2895849 CTGGTATGTTTGGGGAGGGAAGG + Intronic
1153353439 18:4108042-4108064 ATGATCTGCTTCAGGAGAGAGGG - Intronic
1153421701 18:4914229-4914251 CTGGTGAGCATGTGGAGAAAAGG + Intergenic
1153722328 18:7918372-7918394 CTGGTGAGCATGTGGAGAAAGGG - Intronic
1155084922 18:22448739-22448761 CTGATGAGGTTGAGGAGAAAAGG + Intergenic
1155522032 18:26677961-26677983 CTGGTGTCCTTAAAGAGAGCAGG + Intergenic
1156067910 18:33167398-33167420 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1156770656 18:40718657-40718679 CTGCTGTGCTTGGATAGAGATGG + Intergenic
1156885800 18:42134143-42134165 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1156999930 18:43511723-43511745 CTGGTCTGCTTGGGAAAAGATGG + Intergenic
1157039124 18:44017421-44017443 CTGGTGAGGCTGAGGAGAAAAGG - Intergenic
1157795987 18:50575998-50576020 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1159149884 18:64507286-64507308 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1159270438 18:66142238-66142260 CTGGTGTGCATGGGGAGTGCAGG + Intergenic
1159290534 18:66413090-66413112 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1159542141 18:69791387-69791409 CTGGTGAGAATGTGGAGAGAAGG - Intronic
1159573048 18:70142642-70142664 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1160109219 18:76009516-76009538 CTGGTGAGGTTGAGGGGAAAAGG - Intergenic
1160280859 18:77489302-77489324 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1160944169 19:1633470-1633492 CTGGTGTGGATGAGCAGGGAGGG - Intronic
1161061257 19:2216263-2216285 CTGATCTGCAGGAGGAGAGATGG - Exonic
1162013383 19:7830883-7830905 CTGGTCTCCTTGGGGAGAGGTGG - Intronic
1162593182 19:11606552-11606574 CTGGGGTTCTTGAGGACGGATGG + Intronic
1163080319 19:14935253-14935275 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1163224883 19:15952351-15952373 CTGGTGAGGATGAGGAGAAAAGG - Intergenic
1163272997 19:16265476-16265498 CTGGTGTGCAGGAGGAGATGGGG + Intergenic
1164306149 19:24005002-24005024 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1165089498 19:33375831-33375853 GTGGTGTGAGGGAGGAGAGAGGG + Intronic
1165324086 19:35104163-35104185 CTGGTGTGTTGGAGGAGTGGTGG + Intergenic
1165352103 19:35281208-35281230 CTGCTGTGTTTTAGGGGAGATGG + Intronic
1166453248 19:42919015-42919037 CCTGTGTGCTTGCGGGGAGAAGG - Intronic
1166465531 19:43027599-43027621 CCCGTGTGCTTGCGGGGAGAAGG - Intronic
1166485286 19:43206753-43206775 CCTGTGTGCTTGTGGGGAGAAGG - Intronic
1166822215 19:45587586-45587608 CTGGAGGGCTAGAGAAGAGAGGG - Intronic
1166878046 19:45909978-45910000 GTAGTGTGCTGGAGAAGAGATGG + Intergenic
1167857186 19:52251722-52251744 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1168519719 19:57039621-57039643 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1168629686 19:57947286-57947308 CTGGTGTGCTAGGGAAGGGAGGG - Intronic
1168651220 19:58093491-58093513 GTGGAGTGTGTGAGGAGAGAGGG - Intronic
925053840 2:840078-840100 CTGGTGAGGCTGTGGAGAGATGG + Intergenic
925226975 2:2191597-2191619 CTGGTGTGCATGTGGACAGTTGG + Intronic
926207099 2:10841568-10841590 CTGGTGTGCAGGAGCAGTGATGG - Intergenic
927641418 2:24847955-24847977 CTGGTGTGCTTGAGGCTCGCGGG + Intronic
928370712 2:30738285-30738307 CTGGAGGTCCTGAGGAGAGAAGG + Exonic
929078911 2:38103094-38103116 CTGGTGTGGTTGTGGAGAAAAGG + Intronic
929215077 2:39403824-39403846 GTCTTCTGCTTGAGGAGAGAAGG + Intronic
929267622 2:39936958-39936980 CTGGTGAGATTGTGGAGAAAAGG + Intergenic
929272955 2:39993748-39993770 CTGGAGTGGTTGGGGAGACAGGG + Intergenic
929557868 2:42936753-42936775 CTGGGGTCCTTGAGGAATGAGGG + Intergenic
929661557 2:43790905-43790927 GTGGTGTGGTTGAGAAGAGATGG + Intronic
930770556 2:55126533-55126555 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
930808863 2:55519944-55519966 CTGGTGTGAGAGAGGAGAAAAGG - Intronic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
932291297 2:70582283-70582305 GGGATGTGCTTGAGGAGAGATGG + Intergenic
932371531 2:71193069-71193091 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
932845097 2:75126997-75127019 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
933085490 2:78049508-78049530 CTGGTGAGGTTGAGGAGAAAAGG - Intergenic
933996194 2:87671755-87671777 CTGGTGTGATGGTTGAGAGAAGG + Intergenic
935384393 2:102485779-102485801 CTTGGGGGCTTGAGGAAAGAGGG - Intronic
935982275 2:108639074-108639096 CTGGTGTTCTTAAGGAGATGAGG + Intronic
936297660 2:111279157-111279179 CTGGTGTGATGGTTGAGAGAAGG - Intergenic
936400869 2:112163561-112163583 CTGATGTGGTTGGAGAGAGACGG - Intronic
937996676 2:127699371-127699393 CTGCAGTGCTAGAGGAGAGTGGG + Intergenic
938415447 2:131100259-131100281 CAGGTGGGCTGGAGGAGAAAGGG + Intergenic
938866656 2:135428891-135428913 CTGGTGGGGTTGAAGAGAAATGG + Intronic
939099219 2:137875653-137875675 CTGGTGTGGAGGAGGAGGGATGG + Intergenic
939183261 2:138828529-138828551 CAGATATGTTTGAGGAGAGAAGG - Intergenic
939930308 2:148226259-148226281 CTGTTGTGGGTGGGGAGAGAGGG - Intronic
940374269 2:152939896-152939918 CTGGTGAGATTGCGGAGAAAAGG + Intergenic
940447326 2:153791435-153791457 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
941018124 2:160380157-160380179 CTGTGGTGAGTGAGGAGAGATGG - Intronic
941119883 2:161515982-161516004 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
941879874 2:170470252-170470274 TTGGTGGGATTGAGGAGAAAAGG - Intronic
942532773 2:176929852-176929874 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
943353843 2:186826155-186826177 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
943968181 2:194366477-194366499 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
944222945 2:197320496-197320518 CTGGTGGGGATGAGGAGAGCAGG - Intergenic
944649710 2:201817262-201817284 CTGGTAAGCTTGAGAAGAAAAGG - Intronic
945393700 2:209296194-209296216 ATGGCTTGCTTCAGGAGAGAAGG - Intergenic
945727845 2:213494814-213494836 CTGGTGTCATTGAGGAGATAGGG - Intronic
947438390 2:230093776-230093798 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
948251933 2:236536280-236536302 GTGGTCTGCCTGAGGACAGAAGG + Intergenic
948708751 2:239812240-239812262 CTACTGTGCTTCAGGAGAGCAGG + Intergenic
1168845920 20:944669-944691 CTGGAAGGCTTGAGCAGAGAGGG - Intergenic
1169340947 20:4795797-4795819 CAGGGGTGAGTGAGGAGAGACGG - Exonic
1169466335 20:5844058-5844080 GTTATGTGCTTCAGGAGAGAAGG + Intronic
1171057653 20:21923083-21923105 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1171206382 20:23284498-23284520 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1171776946 20:29377667-29377689 CTGGTGAGCATGTGGAGTGAAGG - Intergenic
1171993997 20:31718298-31718320 GTGGTGTGCGTGTGGGGAGAAGG - Intronic
1173337846 20:42127259-42127281 CAGGCCTGCTTGAGGAAAGATGG + Intronic
1173478987 20:43384393-43384415 CTGGTGAGCATGGGGACAGACGG - Intergenic
1174563636 20:51448735-51448757 TTGGGGTGTTTGAGGACAGAGGG + Intronic
1174779390 20:53374620-53374642 CTGGTGAGCTTGCAGAGAAAAGG - Intronic
1175190502 20:57209147-57209169 ATGGTGTGATTTAGTAGAGATGG - Intronic
1175282407 20:57812935-57812957 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1176113577 20:63421650-63421672 CACGTGTGCTTGAGAAGAGGAGG + Intronic
1176332565 21:5561652-5561674 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1176395192 21:6259299-6259321 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1176441965 21:6729805-6729827 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1176466227 21:7056874-7056896 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1176489788 21:7438652-7438674 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1177750855 21:25282436-25282458 CTGGTGAGGTTGTGGAGAAACGG + Intergenic
1177870622 21:26568939-26568961 CTGGTGAGCCTGTGGAGAAAAGG + Intronic
1178188486 21:30253296-30253318 CTGGTGAGAATGAGAAGAGAAGG + Intergenic
1180799175 22:18623855-18623877 CAGGTGGGGTTGAGGAGGGAAGG - Intergenic
1181222543 22:21371411-21371433 CAGGTGGGGTTGAGGAGGGAAGG + Intergenic
1181638305 22:24184400-24184422 CAGGTGGGGTTGAGGAGGGAAGG + Intronic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1181879112 22:25963495-25963517 CTGGTGTCCTTGAGGACACATGG - Intronic
1182474827 22:30571329-30571351 ATGGGGTGCTGGAGCAGAGAGGG + Intronic
1182591219 22:31381836-31381858 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1183877256 22:40793982-40794004 GTGGTGTGTGTAAGGAGAGAAGG + Intronic
1185060114 22:48602291-48602313 CTGGTGTGCTTGTGGGGGGGTGG - Intronic
949128841 3:477270-477292 CAGTTCTACTTGAGGAGAGAAGG - Intergenic
949391544 3:3567928-3567950 CTGGTGAGGCTGAGGAGAAACGG - Intergenic
950165785 3:10797575-10797597 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
950644407 3:14368432-14368454 TGGGTGTGCTAGAGGAGAGAAGG - Intergenic
951208676 3:19950165-19950187 ATGGTGTGCTTGAGCAGATGAGG + Intronic
951271379 3:20628838-20628860 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
951839860 3:27022782-27022804 CTGGGGTGATTTAGGATAGAAGG + Intergenic
952413697 3:33071778-33071800 CTGGCTTGCTTTGGGAGAGAGGG - Intronic
952544223 3:34401187-34401209 CTGGTGAGATTGTGGAGAAAAGG + Intergenic
952666813 3:35916684-35916706 CTGGTGAGGCTGAGGAGAAATGG - Intergenic
953008773 3:39003663-39003685 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
953030104 3:39174225-39174247 CTGGTGAGGTTGCGGAGAAAAGG - Intergenic
953407412 3:42666304-42666326 CTGCTGTCCTGGGGGAGAGAAGG + Intergenic
953486499 3:43302574-43302596 CTGGGGATATTGAGGAGAGAAGG + Intronic
953921617 3:46955791-46955813 CTGCTGTCCTTGGGGTGAGAAGG - Intronic
954041696 3:47892622-47892644 CTCAACTGCTTGAGGAGAGAGGG - Intronic
954618236 3:51981214-51981236 CTGGTGTGCTGTGGGAAAGACGG + Intronic
955005615 3:54965850-54965872 GGGGTGTGAGTGAGGAGAGAGGG + Intronic
955726034 3:61933799-61933821 CTGGTATCATTGAGGAGACAAGG - Intronic
955851483 3:63224725-63224747 CTGGAGAAATTGAGGAGAGAAGG + Intergenic
956156431 3:66303272-66303294 CAGTTGTGCTTGACTAGAGAGGG - Intronic
956554471 3:70503302-70503324 CTGATGAGGTTGAGGAGAAAAGG + Intergenic
956689909 3:71866609-71866631 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
956728977 3:72179158-72179180 ATGGTGTGCTTCAGGGGAGAAGG - Intergenic
957131964 3:76234517-76234539 CTGGTGAGGTTGTGGAGAGAAGG - Intronic
957380400 3:79420741-79420763 CTGGTGAGCTTGCAGAGAAAAGG + Intronic
957446472 3:80318414-80318436 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
957655550 3:83069546-83069568 CTGGTGAGATTGTGGAGAAAAGG - Intergenic
957984647 3:87558192-87558214 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
958087691 3:88833047-88833069 CTGGGGCCTTTGAGGAGAGAGGG + Intergenic
958268160 3:91464445-91464467 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
958589486 3:96136293-96136315 CTGGTGAGATTGTGGAGAAAAGG - Intergenic
959326762 3:104946654-104946676 CTGGTGAGGTTGCAGAGAGAAGG - Intergenic
960056805 3:113281895-113281917 CTGGTGTGCATGATGGAAGAGGG - Intronic
960121749 3:113954166-113954188 CTGGAGTGCCTGAGCAGAAAAGG + Exonic
960684213 3:120280701-120280723 GTGGTGTGAGTAAGGAGAGAAGG - Intronic
961180829 3:124875982-124876004 CTGGTGGGGTTGAGGTGGGATGG + Intronic
961870122 3:129981369-129981391 TTGGTCTGGTTGAGGAAAGAAGG + Intergenic
962453830 3:135547050-135547072 CTTGTGTGATTTAGGAAAGATGG + Intergenic
962954832 3:140255157-140255179 CTAGTGAGATTGTGGAGAGAAGG + Intronic
963963170 3:151333379-151333401 CTGGTGAGGTTGTGGAGAGAAGG - Intronic
963993798 3:151683791-151683813 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
964313866 3:155422882-155422904 CTGGTGAGGTTGTGGAGAGAAGG + Intronic
964529912 3:157656332-157656354 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
965187084 3:165478433-165478455 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
965308936 3:167104130-167104152 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
966341729 3:178932654-178932676 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
966410845 3:179644411-179644433 GTGGTGGGCATGAGGAGCGATGG + Intergenic
967750598 3:193110669-193110691 CTGGTGAGGATGTGGAGAGAGGG - Intergenic
968486493 4:865563-865585 CTGGTGGGTTTTAGGAGAGGCGG - Intronic
968594425 4:1474906-1474928 CTGGTGTGTGTCAGGAGAGAAGG + Intergenic
969091759 4:4699228-4699250 TTGATGTGGTTGAGGTGAGATGG - Intergenic
969160224 4:5250698-5250720 CTGGAGAGGTTGAGGAGAAAAGG - Intronic
969235112 4:5860112-5860134 CTGGTGAGGTTGGGGAGGGAAGG - Intronic
969627848 4:8316720-8316742 ATGGTGGGCAGGAGGAGAGATGG - Intergenic
970654155 4:18212948-18212970 CTGCTGTGCTGGAGGAGCCAAGG + Intergenic
971004054 4:22354266-22354288 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
971798418 4:31258222-31258244 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972651828 4:41025363-41025385 CTGGTGAGATTGCGGAGAAAAGG + Intronic
973182744 4:47289656-47289678 CTGGTGTACTGGATGAGTGATGG + Intronic
973781431 4:54291635-54291657 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
973838738 4:54839250-54839272 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
974352469 4:60767217-60767239 CTGGTGAGGATGTGGAGAGAAGG - Intergenic
975105666 4:70566102-70566124 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
975644589 4:76533705-76533727 CTGATTTGGTTTAGGAGAGAAGG - Intronic
976047765 4:80972305-80972327 CATGTGTACTTGAGGATAGAAGG + Intergenic
977211835 4:94227187-94227209 CTGGTGTTTTTGAGGAAAGTGGG + Intronic
977412345 4:96684052-96684074 CTGGTGAGGTTGCGGAGAAAAGG - Intergenic
978006200 4:103620252-103620274 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
978043447 4:104098135-104098157 CTGGTGAGGTTGAAGAGAAAGGG + Intergenic
978049119 4:104173396-104173418 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
978802277 4:112766650-112766672 CTGCTGGGCTTGAGGGTAGAGGG - Intergenic
979201285 4:117982028-117982050 CTGGTGAGGCTGAGGAGAAAGGG + Intergenic
979281864 4:118877712-118877734 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
979892346 4:126114468-126114490 CTGGTGAGGATGAGGAGAAAGGG - Intergenic
979980042 4:127243554-127243576 CTGGCGTTCTTTAGAAGAGATGG - Intergenic
979988849 4:127350079-127350101 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
980095610 4:128487138-128487160 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
980456544 4:133051410-133051432 CTGGTGAGCTTGTAGAGACAAGG + Intergenic
980578806 4:134721402-134721424 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
981453330 4:144924722-144924744 CTGGTGAGGATGTGGAGAGAAGG - Intergenic
981605939 4:146540376-146540398 CTGGTGTGGTTGCAGAGAAAAGG - Intergenic
982415892 4:155131539-155131561 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
982430590 4:155317714-155317736 CATGTGTGTTTGGGGAGAGAGGG - Intergenic
982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG + Intergenic
982677251 4:158390035-158390057 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
983255103 4:165390139-165390161 ATGGTGACCTTGAGGAGAGGTGG + Intronic
983679930 4:170341730-170341752 TTGGTGAGGTTGAGGAGAAAAGG - Intergenic
983778093 4:171633512-171633534 CTGGTGAAGTTGAGGAGAAAAGG - Intergenic
983855717 4:172641456-172641478 CTGGTGTGTTTTAGGATAGGAGG - Intronic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
985623791 5:972827-972849 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
986123476 5:4865032-4865054 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
986193123 5:5515089-5515111 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
986194926 5:5529415-5529437 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
986289206 5:6385312-6385334 CTGCTGGTCTTGAGCAGAGAAGG - Intergenic
986463027 5:7992856-7992878 CTTTTGTGCGTGTGGAGAGAGGG + Intergenic
986548662 5:8927644-8927666 CTTGGGTGCTGGAGGAAAGAAGG + Intergenic
986904170 5:12473337-12473359 CTAGTGAGGTTGAGGAGAAAAGG + Intergenic
987484767 5:18511222-18511244 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
987661097 5:20877352-20877374 CTGGTGAGGTTGTGGAGAAAGGG + Intergenic
988056411 5:26103381-26103403 CTGGTGAGGTTGGGGAGAAAAGG + Intergenic
988401295 5:30763667-30763689 TGGGTGTGAGTGAGGAGAGATGG + Intergenic
988598313 5:32615853-32615875 CTGGTGGGATTGAGGTGAAAGGG + Intergenic
988762547 5:34328341-34328363 CTGGTGAGGTTGTGGAGAAAGGG - Intergenic
989111566 5:37911762-37911784 CTGGTGAGGATGTGGAGAGAAGG + Intergenic
989161100 5:38392589-38392611 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
989553707 5:42766271-42766293 CTGGTGAGGATGTGGAGAGAAGG + Intronic
989738464 5:44738417-44738439 CTGGTGTGGTTGCAGAGAAAAGG - Intergenic
990003614 5:50922139-50922161 CTGGTGTGCACGAGCTGAGAGGG - Intergenic
990020324 5:51118657-51118679 CTGGTGAGCCTGAAGAGAAAAGG + Intergenic
990056562 5:51587853-51587875 CTGCTGTCCTTGGGGAGTGATGG + Intergenic
990534251 5:56704434-56704456 CTGGTGGGGCTGAGTAGAGATGG - Intergenic
990840300 5:60072154-60072176 CTGGTGAGCTTGTGGAGAAAAGG - Intronic
992966100 5:82002145-82002167 CTGGTGAGGTTGAAGAGAAAAGG + Intronic
993606362 5:89995023-89995045 CTGGTGTGATTGAGGCAATATGG + Intergenic
993894805 5:93521720-93521742 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
993923563 5:93837644-93837666 CTGGTGAGATTGGGGAGAAAAGG - Intronic
994045222 5:95301386-95301408 CTGGTGAGGATGAGGAGAAACGG - Intergenic
994346307 5:98691253-98691275 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
994643858 5:102445204-102445226 CTGGTGTGGTTGCAGAGAAAAGG - Intronic
994971401 5:106744196-106744218 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
995147483 5:108802977-108802999 CTCGTGAGGTTGTGGAGAGACGG - Intronic
995633124 5:114155521-114155543 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
996142389 5:119928281-119928303 CTGGTGAGGTTGTGGAGAAACGG - Intergenic
996195097 5:120595455-120595477 TTGGTGTGGTTGTGGAGAAAAGG + Intronic
996345560 5:122484739-122484761 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
996597309 5:125220184-125220206 CTTTTGTGCTTGATGAAAGAAGG - Intergenic
997022278 5:130015594-130015616 CTGGTGAGATTGTGGAGAAAGGG + Intronic
997477451 5:134152889-134152911 TTGGTGTAGTTCAGGAGAGAAGG - Exonic
998106382 5:139471748-139471770 CTGGGGTCCTGGAGGAGAGGGGG - Intergenic
998140843 5:139698632-139698654 GTGGGGTGCTTGAGGAGGCAGGG - Intergenic
998778823 5:145633456-145633478 TTGCTGTGGTTGACGAGAGAGGG - Intronic
999228999 5:150050485-150050507 ATGGTAGGCTTGAGGAGACATGG - Intronic
999279411 5:150355229-150355251 GTGGTTTGATTGAGGAGAGGAGG - Intergenic
999567345 5:152879344-152879366 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1000435852 5:161208008-161208030 CTGGCAAGGTTGAGGAGAGAAGG + Intergenic
1001189879 5:169620049-169620071 CTGGTGTGCTGGAGCCAAGATGG + Intergenic
1001890979 5:175338317-175338339 TTGGTGTATCTGAGGAGAGAGGG - Intergenic
1002198765 5:177515144-177515166 CTGGGGTCCTTGAGGAGGGCTGG - Intronic
1002337606 5:178490985-178491007 CTTGTCTGCTTGAGGGGAGTGGG + Intronic
1003055859 6:2819593-2819615 CTGGTGAGGCTGAGGAGAAAAGG + Intergenic
1003498961 6:6688307-6688329 CTGGAGAGGTTGAGGAGAAAGGG - Intergenic
1004766339 6:18732040-18732062 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1004766346 6:18732093-18732115 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1004766353 6:18732146-18732168 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1005510200 6:26505803-26505825 TTTGTTTACTTGAGGAGAGAAGG - Intronic
1005882032 6:30069309-30069331 CAGGAATGCTGGAGGAGAGAGGG - Exonic
1006042445 6:31267612-31267634 CAGGTGGGCTTGAGGGGAGTGGG - Intergenic
1006052033 6:31352701-31352723 CAGGTGGGCTTGAGGGGAGTGGG - Intronic
1006109373 6:31735456-31735478 CGGGTGTGGGTAAGGAGAGATGG - Intronic
1007024897 6:38561217-38561239 CTGGTGAGATTGTGGAGAAAAGG - Intronic
1007778781 6:44239083-44239105 CTGGTGGGCATGATGACAGAAGG + Intergenic
1007983285 6:46180826-46180848 CTGCTTTTCTTGAGGGGAGAGGG + Intergenic
1008021287 6:46580856-46580878 TTGGTGAGGTTGAGGAGAAAAGG + Intronic
1008203118 6:48617181-48617203 CTGGTGAGGTTGTGGAGAAAGGG - Intergenic
1008779481 6:55085726-55085748 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1008817174 6:55581968-55581990 TTGGTGGGATTAAGGAGAGAAGG - Intergenic
1008849493 6:56007561-56007583 CTGGCGAGGTTGAGGAGAAAAGG + Intergenic
1008987044 6:57557131-57557153 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1009175001 6:60449698-60449720 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1009183054 6:60541361-60541383 GTGGGGTGCTAGGGGAGAGATGG + Intergenic
1010136516 6:72560668-72560690 TTGGTGGGTTTGGGGAGAGAGGG + Intergenic
1010811927 6:80310732-80310754 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1010939842 6:81903825-81903847 CTGGTGTGGTTGTGGAGAAAAGG + Intergenic
1011248290 6:85342907-85342929 CTGGTGAGCATGTGGAGAAAAGG - Intergenic
1011938772 6:92816264-92816286 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1012141098 6:95627907-95627929 CTGGTGAGGTTGAAGAGAAAAGG + Intergenic
1012194776 6:96327781-96327803 CTGGTGAGTTTGTGGAGAAAAGG + Intergenic
1012982992 6:105849724-105849746 CTCTTCTGCTAGAGGAGAGAAGG + Intergenic
1013079129 6:106797161-106797183 CAGGACTGCTTGAGGAAAGAGGG + Intergenic
1013559737 6:111292343-111292365 CTGGTGTCCTTGATAAGAGGAGG + Intergenic
1014133486 6:117862124-117862146 CTGGCATGGTTGTGGAGAGAAGG + Intergenic
1014335426 6:120127719-120127741 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1014961253 6:127687958-127687980 CTGGTGAGGTTGCGGAGAAAAGG - Intergenic
1015528990 6:134201874-134201896 CTGATGTGCTGGAGAAGAAAGGG + Intronic
1015555078 6:134452534-134452556 CTGGACTGCTTGAGGAGTGAAGG - Intergenic
1016786639 6:148017828-148017850 CAAGTGTGATTAAGGAGAGATGG + Intergenic
1017865870 6:158442733-158442755 CTGGTCAGCTTGGGGATAGAAGG - Intronic
1019401464 7:856552-856574 CTGGGCTGCGTGAGGACAGAGGG + Intronic
1019530516 7:1500739-1500761 CTGGGGTGGGTGCGGAGAGAGGG - Intronic
1019887478 7:3918115-3918137 CTGTTGAGTTTGAGGTGAGAGGG - Intronic
1019937551 7:4266415-4266437 CTGGTGTGCACGAGGCGAGTCGG - Exonic
1020123743 7:5520731-5520753 CTGGTGGGCGTGTGGATAGAGGG + Intergenic
1020642366 7:10771316-10771338 CTGATGGGGTTGAGGAGACAGGG - Intergenic
1020733714 7:11918299-11918321 CAGGTGTGCTTGTGGTGAGGTGG - Intergenic
1022204355 7:28149185-28149207 TTGGGCTGCTTGAGGAGAGGAGG - Intronic
1022669771 7:32445071-32445093 CTGGTGAGGTTGAAGAGAAAAGG + Intergenic
1022935369 7:35169876-35169898 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1023114911 7:36853286-36853308 CTGGAGTGCCAGAAGAGAGAGGG + Intergenic
1023514485 7:40987295-40987317 CTGGTGGGGTGGAGGAGAGGAGG + Intergenic
1023885771 7:44354157-44354179 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1024340712 7:48255943-48255965 CTGGTGAGGTTGTGGAGAAACGG - Intronic
1024724125 7:52172904-52172926 CTGGATTTCATGAGGAGAGAGGG - Intergenic
1026105280 7:67416125-67416147 CTGGTGAGGTTGAGGAGTAAAGG - Intergenic
1026528952 7:71180804-71180826 ATGGTGTGCATGAGAAGGGAAGG + Intronic
1027429633 7:78097171-78097193 CTGGTGAGGTTGTGGAGAAAGGG + Intronic
1028239764 7:88405241-88405263 GTGGTGTGTTTGGGGAGAGTTGG - Intergenic
1028346320 7:89788396-89788418 CTGGTGAGGTTGCAGAGAGAAGG - Intergenic
1028740717 7:94271258-94271280 CTGTTGTGGGTGAGGGGAGAGGG + Intergenic
1028978019 7:96935630-96935652 GTGGTGTGTATGTGGAGAGAGGG - Intergenic
1029057107 7:97758258-97758280 ATGGCCTGCTTGAGGAGAGAGGG + Intergenic
1029161222 7:98553520-98553542 CTGGTCTGCATGAGGAGTCATGG + Intergenic
1029591267 7:101508615-101508637 CGGGCATGCTTTAGGAGAGAGGG - Intronic
1029831327 7:103262652-103262674 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1029901342 7:104043548-104043570 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1030133927 7:106228007-106228029 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1030407796 7:109136636-109136658 CTGGTGGGGATGAGGAGAAAAGG - Intergenic
1030733821 7:113020153-113020175 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1031651699 7:124299331-124299353 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1031963315 7:128008937-128008959 ATGGTGTGGTAGAGTAGAGAAGG + Intronic
1032510130 7:132465819-132465841 CTGCAGAGCTGGAGGAGAGAGGG + Intronic
1032647581 7:133842287-133842309 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1032782049 7:135171072-135171094 CTCGTGTGCTTGAGGAGGATGGG + Intergenic
1032969267 7:137140017-137140039 CTGGTGGGGTTGTGGAGAAAAGG + Intergenic
1033234713 7:139629190-139629212 TTGGTGTGGATGAAGAGAGAAGG - Intronic
1034216695 7:149413026-149413048 CTGGTGAGGTTGCGGAGAAAAGG + Intergenic
1034483431 7:151341328-151341350 CTGGTGGGCTTGTGGAGGGCGGG + Intergenic
1037372979 8:18200020-18200042 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1037645322 8:20787596-20787618 ATGGTGTGCTTGATGATACAGGG + Intergenic
1039001728 8:32988745-32988767 GTGGTGGGGTTGGGGAGAGATGG - Intergenic
1039309416 8:36299494-36299516 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1039755819 8:40520956-40520978 CTGGTGTGGATGTGGAGAAAGGG - Intergenic
1040370394 8:46765343-46765365 ATGGTCTGCTTGAGGAGAGAGGG - Intergenic
1041011424 8:53547479-53547501 CAGGACTGCTGGAGGAGAGAAGG + Intergenic
1041180667 8:55244698-55244720 CTGGTGTGATTGCGGAGAAAAGG - Intronic
1041586091 8:59521589-59521611 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1041987361 8:63938790-63938812 CTTTTGAGCTTGAGGAGTGAAGG - Intergenic
1041996458 8:64065890-64065912 CTGGTGAGCATGTGGAGAAAGGG + Intergenic
1042200017 8:66272445-66272467 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1042212505 8:66394887-66394909 CTGGTGTGATGGAGGGCAGAAGG + Intergenic
1042401065 8:68347595-68347617 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG + Intergenic
1042981700 8:74536742-74536764 CTGGTGAGTTTGTGGAGAAATGG - Intergenic
1043120620 8:76318363-76318385 CGTGTGTGCATGCGGAGAGAGGG - Intergenic
1043586487 8:81775982-81776004 CTAGTGTGGTTGTGGAGAAAAGG - Intergenic
1043737920 8:83770051-83770073 CTGGTGAGGTTGAAGAGAAAAGG + Intergenic
1043967973 8:86500547-86500569 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1044193574 8:89348294-89348316 CTGGTGAGGTTGCGGAGAAAAGG - Intergenic
1044214071 8:89586495-89586517 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1044219868 8:89657526-89657548 CTGGTGAGACTGTGGAGAGAAGG + Intergenic
1044521874 8:93208129-93208151 CTAGTGAGGTTGAGGAGAAAAGG + Intergenic
1044526967 8:93263226-93263248 CTGGTGAGCTTGTGGTGAGGAGG - Intergenic
1044881265 8:96725590-96725612 CTGGTGAGGCTGAGGAGAAAAGG + Intronic
1044911381 8:97063115-97063137 CTGGTGAGGTTGAGGAGAAAAGG - Intronic
1045066130 8:98446615-98446637 CTGGTGAGGTTGCGGAGAAAAGG + Intronic
1045405951 8:101867053-101867075 CTGGTGTGCTTGAGGAACGGTGG - Intronic
1046756351 8:117976837-117976859 CTGGTGGGGTTAGGGAGAGAGGG + Intronic
1046779667 8:118201690-118201712 CTGGTCTGCATGTGGAGAGTGGG + Intronic
1046790621 8:118318055-118318077 GTGGTGTGGTTGTGGTGAGAGGG + Intronic
1047171141 8:122493458-122493480 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1047264841 8:123296752-123296774 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1047869616 8:129068226-129068248 CTGGAGGACTTGAGGAGAGTAGG + Intergenic
1048640782 8:136358145-136358167 CTGGTGAGGTTGCGGAGAAAAGG - Intergenic
1048871719 8:138804429-138804451 CTGCTGTGCTTGAGCAGAGCAGG - Intronic
1049100902 8:140578228-140578250 CATGTGTGTTTGAGGAGGGAAGG - Intronic
1049446254 8:142632890-142632912 CTGCTGTGGTTGCGGGGAGAGGG + Intergenic
1049635774 8:143688368-143688390 CTGCTGTGCTGGAGGTGGGAGGG + Intronic
1049652726 8:143780960-143780982 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1051133787 9:13894606-13894628 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1051671584 9:19516009-19516031 TTGGTGAATTTGAGGAGAGATGG - Exonic
1051831751 9:21286881-21286903 CTGGTGAGGTTGCGGAGAAAAGG - Intergenic
1052320606 9:27163470-27163492 CTGGTGAGGCTGAGGAGAAAAGG + Intronic
1053167059 9:35852484-35852506 ATGGTGAGCATGAGGAGACAGGG + Intronic
1053278292 9:36799656-36799678 CTGGAGTCCTTGAGGACAGTGGG + Intergenic
1055178536 9:73352187-73352209 CTGGTGTGGTTGATGAGAATGGG + Intergenic
1055190256 9:73511490-73511512 CTAGTGTGGTTGTGGAGAAAAGG - Intergenic
1055532342 9:77196977-77196999 CTGGTGTGACTGTGGAGAAAGGG - Intronic
1055992545 9:82123061-82123083 CTGGGGTGGTCAAGGAGAGAAGG + Intergenic
1056776628 9:89517785-89517807 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1057527414 9:95815278-95815300 GTGGTTTGGTTGGGGAGAGAAGG + Intergenic
1058238376 9:102523009-102523031 CTGGAGTGGTTGTGGAGAAAAGG - Intergenic
1059055886 9:110978910-110978932 CTGGGGTGGTTGTGGGGAGAGGG + Intronic
1059095955 9:111415021-111415043 GGGGTATACTTGAGGAGAGAGGG + Intronic
1059597340 9:115735766-115735788 CTGGTGTGGATGTAGAGAGAGGG - Intergenic
1060502226 9:124168093-124168115 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1060572301 9:124653516-124653538 CTTGTGAGGGTGAGGAGAGAGGG - Intronic
1061311972 9:129769490-129769512 CATGGGTGCTTGAAGAGAGAAGG + Intergenic
1061616351 9:131782219-131782241 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1062141394 9:134961044-134961066 CTGGTGTGTGTGATGGGAGAGGG + Intergenic
1062445384 9:136591719-136591741 CTTGTGTGCCAGAGGACAGACGG + Intergenic
1203429526 Un_GL000195v1:78680-78702 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1185660515 X:1724993-1725015 CTGATGAGCTTGAATAGAGATGG - Intergenic
1185731501 X:2465382-2465404 TTGGCGTGATTGAGGAGGGATGG - Intronic
1187292075 X:17964303-17964325 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1187605667 X:20880078-20880100 CTGGTGAGGTTGTGGAGAAATGG + Intergenic
1188351164 X:29132640-29132662 GTGGTGTGCTTCTGGAGAAATGG + Intronic
1188516674 X:30994802-30994824 CTGGTGAGGTTGCAGAGAGAAGG - Intergenic
1188645133 X:32556321-32556343 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1188710801 X:33395217-33395239 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1188828900 X:34872066-34872088 CTGGTGAGGTTGTGGAGAAAGGG + Intergenic
1188977274 X:36690722-36690744 TTGGTGTGATTGAGGAGAGCAGG - Intergenic
1189921349 X:45905930-45905952 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1189935705 X:46066371-46066393 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1190324024 X:49195615-49195637 GTGGTGTGATGGAGGAGAGGTGG + Intronic
1190379992 X:49829845-49829867 CTGGTGGGCTTCAGGAGGGTCGG + Intronic
1190804961 X:53826393-53826415 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1190810174 X:53875510-53875532 CTGGTGAGCTTATGGAGAAAAGG - Intergenic
1191685911 X:63890672-63890694 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1191738420 X:64411533-64411555 CTGGTGAGTTTGTGGAGAAAAGG - Intergenic
1191818792 X:65279274-65279296 CTGGTAAGGTTGCGGAGAGAAGG - Intergenic
1192494037 X:71602091-71602113 CTGGTGAGAATGAGGAGAAAAGG - Intronic
1192901401 X:75501590-75501612 CTGGTGAGATTGTGGAGAAAAGG - Intronic
1193232237 X:79061448-79061470 CTGGTGAGGTTGTGGAGAGAAGG - Intergenic
1193252449 X:79308132-79308154 TTGGTGTCCTTGTGGAGAAAGGG - Intergenic
1193294091 X:79813640-79813662 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1193482029 X:82038541-82038563 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1193494381 X:82192519-82192541 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1193566793 X:83086569-83086591 CTGGTGAGGTTGAGGAGAAAAGG - Intergenic
1193609830 X:83617303-83617325 CTGATGTGCATGTGGAGAAAAGG - Intergenic
1193704422 X:84803829-84803851 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1193708255 X:84849550-84849572 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1193739564 X:85202095-85202117 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1193748794 X:85317409-85317431 CTGGTATGGTTGTGGAGAAAAGG - Intronic
1193820950 X:86164061-86164083 CTGGTGAGGTTGCGGAGAAAAGG - Intronic
1193857087 X:86616406-86616428 TTGGTGAGCTTGTGGAGAAAAGG - Intronic
1194093992 X:89613943-89613965 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1194857546 X:98952520-98952542 CTGGTGTGGATGTGGAGAAAAGG - Intergenic
1195612158 X:106880048-106880070 CTGGTGTGAATGTGGAGAAAGGG + Intronic
1195803677 X:108737989-108738011 CTGGGGTGGTGGGGGAGAGAGGG - Intergenic
1196010597 X:110883460-110883482 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1196946727 X:120833834-120833856 CTGGTGAGGTTGCGGAGAAAGGG - Intergenic
1197052068 X:122071756-122071778 CTGGTGAGCATGTGGAGAAAAGG - Intergenic
1197106751 X:122725890-122725912 CTGCTGTGCTGGAGGGGACAAGG - Intergenic
1197142824 X:123135446-123135468 CTGGTGAGCTTGTGGAGAACAGG + Intergenic
1197263735 X:124344291-124344313 CTCGTGTGTATGGGGAGAGAAGG + Intronic
1197356394 X:125441042-125441064 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1197391127 X:125866302-125866324 CTGGTGAGGTTGTGGAGAAACGG + Intergenic
1198086200 X:133284963-133284985 GTGGTGGGCTTGGGGAGGGATGG + Intergenic
1198890596 X:141391384-141391406 CTGGTGAGGTTCAGGAGAAAAGG - Intergenic
1199479190 X:148279216-148279238 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1200446613 Y:3270087-3270109 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1200687684 Y:6271929-6271951 CTGGTGAGGATGAGGAGAAAAGG - Intergenic
1200777384 Y:7181563-7181585 TTGGTCTGCTTGGGGAAAGATGG + Intergenic
1201047586 Y:9902774-9902796 CTGGTGAGGATGAGGAGAAAAGG + Intergenic