ID: 915604122

View in Genome Browser
Species Human (GRCh38)
Location 1:156940113-156940135
Sequence TGCACCCTCCACCTTCCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 370}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915604122_915604132 20 Left 915604122 1:156940113-156940135 CCTTCGGGAAGGTGGAGGGTGCA 0: 1
1: 0
2: 4
3: 29
4: 370
Right 915604132 1:156940156-156940178 GGGTGTGCGACTGGGGACCAGGG 0: 1
1: 0
2: 2
3: 19
4: 188
915604122_915604129 12 Left 915604122 1:156940113-156940135 CCTTCGGGAAGGTGGAGGGTGCA 0: 1
1: 0
2: 4
3: 29
4: 370
Right 915604129 1:156940148-156940170 TTCACACTGGGTGTGCGACTGGG 0: 1
1: 0
2: 0
3: 3
4: 58
915604122_915604134 28 Left 915604122 1:156940113-156940135 CCTTCGGGAAGGTGGAGGGTGCA 0: 1
1: 0
2: 4
3: 29
4: 370
Right 915604134 1:156940164-156940186 GACTGGGGACCAGGGGCTGACGG 0: 1
1: 0
2: 0
3: 55
4: 515
915604122_915604128 11 Left 915604122 1:156940113-156940135 CCTTCGGGAAGGTGGAGGGTGCA 0: 1
1: 0
2: 4
3: 29
4: 370
Right 915604128 1:156940147-156940169 GTTCACACTGGGTGTGCGACTGG 0: 1
1: 0
2: 1
3: 2
4: 66
915604122_915604125 0 Left 915604122 1:156940113-156940135 CCTTCGGGAAGGTGGAGGGTGCA 0: 1
1: 0
2: 4
3: 29
4: 370
Right 915604125 1:156940136-156940158 GGCGCCTGCCAGTTCACACTGGG 0: 1
1: 0
2: 1
3: 10
4: 81
915604122_915604131 19 Left 915604122 1:156940113-156940135 CCTTCGGGAAGGTGGAGGGTGCA 0: 1
1: 0
2: 4
3: 29
4: 370
Right 915604131 1:156940155-156940177 TGGGTGTGCGACTGGGGACCAGG 0: 1
1: 0
2: 1
3: 18
4: 236
915604122_915604133 21 Left 915604122 1:156940113-156940135 CCTTCGGGAAGGTGGAGGGTGCA 0: 1
1: 0
2: 4
3: 29
4: 370
Right 915604133 1:156940157-156940179 GGTGTGCGACTGGGGACCAGGGG 0: 1
1: 0
2: 0
3: 9
4: 137
915604122_915604130 13 Left 915604122 1:156940113-156940135 CCTTCGGGAAGGTGGAGGGTGCA 0: 1
1: 0
2: 4
3: 29
4: 370
Right 915604130 1:156940149-156940171 TCACACTGGGTGTGCGACTGGGG 0: 1
1: 0
2: 0
3: 8
4: 103
915604122_915604124 -1 Left 915604122 1:156940113-156940135 CCTTCGGGAAGGTGGAGGGTGCA 0: 1
1: 0
2: 4
3: 29
4: 370
Right 915604124 1:156940135-156940157 AGGCGCCTGCCAGTTCACACTGG 0: 1
1: 0
2: 0
3: 15
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915604122 Original CRISPR TGCACCCTCCACCTTCCCGA AGG (reversed) Intronic
900488575 1:2935197-2935219 AGCACCCTCCACCTGCCTGAGGG + Intergenic
900716544 1:4148710-4148732 GGCACTCTCCACCTGGCCGATGG - Intergenic
901019518 1:6248856-6248878 TGTACCCTCCCCCCCCCCGAAGG + Exonic
901829343 1:11882617-11882639 TGCAGCCTCGACCTTCCGCAAGG - Intergenic
901883624 1:12208148-12208170 TGCACCCTCCGCCTTCACTCCGG + Exonic
902354080 1:15883498-15883520 TGCAACCTCCACCTCCCGGGTGG + Intronic
902975683 1:20086542-20086564 TGGACAATCCACCTTCCAGATGG + Intronic
903871231 1:26436319-26436341 TGCAACCTCCACCTTTCGGGAGG - Intronic
903875926 1:26472905-26472927 TGCCCCCTCCCCCATCGCGAGGG + Intronic
904383557 1:30127282-30127304 TGTCCCCTCCACCTGCCCCAGGG - Intergenic
904502938 1:30927293-30927315 TGCAACCTCCACCTGCCTGCTGG - Intergenic
906024668 1:42663473-42663495 TGCAACCTCCACCTCCCGGGTGG + Intronic
906414390 1:45608952-45608974 GGCCCCCCCCACCTTCCCCAAGG + Intronic
908056834 1:60296980-60297002 TGCCCCCTCCTCCTTCTCTAAGG - Intergenic
908395870 1:63725270-63725292 TCCACCCTCCACCATCCCCCAGG + Intergenic
908819843 1:68074191-68074213 TCCACCCTCCACCCTCCAGTAGG + Intergenic
908956454 1:69635078-69635100 TCCACCCTCCACCCTCCAAAAGG + Intronic
909255857 1:73420547-73420569 TCCACCCTCCACCCTCCAGTAGG - Intergenic
909411257 1:75354563-75354585 TGCAGCCTCCACACTCACGATGG + Intronic
909962263 1:81861093-81861115 TGCAACCTCCACCTACCGGGTGG + Intronic
910753055 1:90655144-90655166 CCCACCCTCCACCTTCCAGTAGG - Intergenic
914231060 1:145764830-145764852 GGCACCCCCCACCTCCCGGACGG - Intronic
914908931 1:151769245-151769267 CGCACCCCCCACCTCCCGGAGGG + Intronic
915235274 1:154475852-154475874 TGCAACCTCCACCTCCCGGTTGG + Intronic
915294173 1:154908552-154908574 TGCAGCCTCCACAATCGCGATGG + Intergenic
915604122 1:156940113-156940135 TGCACCCTCCACCTTCCCGAAGG - Intronic
916033585 1:160901053-160901075 TCCACCCTCCACCCTCCAGTAGG - Intergenic
916037408 1:160933522-160933544 GGCACCCCCCACCTCCCGGACGG - Intergenic
916131606 1:161616544-161616566 GGCACCCCCCACCTCCCGGACGG + Intronic
916387564 1:164293004-164293026 CCCACCCTCCACCTTCTCAAAGG + Intergenic
917869987 1:179232788-179232810 TCCAACCTCCACCTTTCCTATGG + Intergenic
918930400 1:190847866-190847888 TGCACCCTCCACCTTCAAATAGG - Intergenic
919195397 1:194278524-194278546 CCCACCCTCCACCTTCAAGAAGG - Intergenic
919606710 1:199692411-199692433 TGCAGCCTCCACCTCCCAGGTGG - Intergenic
920306120 1:205019181-205019203 TGCACCCTCCTCTTCCCCAAAGG - Exonic
921101152 1:211930589-211930611 TGCTCACTCCACCTTCCACAGGG + Intergenic
921368574 1:214398842-214398864 TGCAACCTCCACCTCCCAGCAGG + Intronic
921898322 1:220424105-220424127 TGCACCTTCCCCCTTACCGCAGG - Intergenic
923393431 1:233536370-233536392 TGCTCCCTCCATCTTTCCGGGGG - Intergenic
923627073 1:235622794-235622816 TGCAACCTCCACCTCCCAGCAGG - Intronic
1063247348 10:4235688-4235710 TGCCCTCTTCACCTTCCCGGGGG + Intergenic
1063319033 10:5035346-5035368 TGCAGCCTCCACCCTGGCGATGG + Intronic
1063369610 10:5512536-5512558 GGCACCTGCCACCTTTCCGAGGG + Intergenic
1063563196 10:7148282-7148304 TGCACCCTCCTTCTTCCCTCTGG + Intergenic
1063822685 10:9855663-9855685 GGCACCCCCCACCTCCCAGACGG + Intergenic
1064668872 10:17687408-17687430 TGCAACCTCCGCCTCCCAGAGGG - Intronic
1065169769 10:23014796-23014818 TCCACCCTCCACCCTCCAGTAGG - Intronic
1065297300 10:24289295-24289317 TTCACAGTCCACCTTCCAGAAGG - Intronic
1065327225 10:24559901-24559923 TGCACCCCCCACCACCCCCAGGG + Intergenic
1065791554 10:29265024-29265046 TCCACCCTCCACCTTCCAATAGG - Intergenic
1065950183 10:30644407-30644429 TCCACCCTCCACCCTCCGAAAGG + Intergenic
1067056982 10:43058169-43058191 TGCACCCTCCACCTCAAGGATGG + Intergenic
1068087709 10:52395491-52395513 TGCAACCTCCACCTCCCAGGTGG + Intergenic
1070165200 10:73892263-73892285 TGCAGCCTCGACCTCCCAGACGG - Intergenic
1070800998 10:79244220-79244242 GGCACCCACCACCTTTGCGAAGG - Intronic
1070834512 10:79439714-79439736 TGCAACCTCCACCTCCCCCCAGG - Intronic
1072480908 10:95809492-95809514 GGCACCCCCCACCTCCCAGACGG + Intronic
1073714696 10:106091009-106091031 TGCACCCCCCACCTCCCCACAGG + Intergenic
1074481279 10:113823160-113823182 TGCAACCTCCACCTCCCAGGGGG - Intergenic
1074874397 10:117602833-117602855 GGCACCCCCCAACTTCCCCAAGG - Intergenic
1074971104 10:118539765-118539787 GGCACCCTCCCCCACCCCGATGG + Intergenic
1075243406 10:120798714-120798736 TGCCCCCCCCACCTCCCGGACGG - Intergenic
1077207176 11:1350218-1350240 TGCCTCCTCCACCTCCCCCAGGG + Intergenic
1077417448 11:2431305-2431327 TGGACCCTCCGCCTTGCCCAGGG - Intergenic
1078437284 11:11335862-11335884 TGCTCCCTCCAGCATCTCGAGGG - Intronic
1080735378 11:35008948-35008970 TGCAACCTCCACCTCCCGGGGGG + Intronic
1081223020 11:40485986-40486008 TTCACCCTTCACCTTCCCATAGG - Intronic
1081580506 11:44348547-44348569 TTCACCCTCCCCGTTCCAGATGG - Intergenic
1081616936 11:44596665-44596687 TCCCCCCTCCACCATCCTGATGG - Intronic
1081849706 11:46266518-46266540 TGCATCCTCCACCTCCCGGGTGG + Intergenic
1082166338 11:48955461-48955483 GGCACCCCCCACCTCCCAGACGG + Intergenic
1082798017 11:57392361-57392383 TGCAGCCTTCACCATCACGAAGG - Intronic
1083213362 11:61203318-61203340 GGCACCCTCCCCCCTCCCCATGG + Intronic
1083216244 11:61222154-61222176 GGCACCCTCCCCCCTCCCCATGG + Intergenic
1083219126 11:61240980-61241002 GGCACCCTCCCCCCTCCCCATGG + Intergenic
1083852605 11:65376944-65376966 TGCAGCCTCCATCTTCCGGGAGG - Exonic
1084330085 11:68425080-68425102 TTCACCCGCCACCCTCCCGCAGG + Exonic
1085097893 11:73775371-73775393 GGCACCCCCCACCTCCCGGACGG - Intergenic
1085509808 11:77082520-77082542 TGCACCCTCCATCTGCCCCAAGG - Intronic
1087259203 11:95991968-95991990 TGGAACCTCCACATTCCAGAAGG + Intronic
1087512776 11:99119293-99119315 TCCACCCTCCACCTTCAAGTAGG + Intronic
1088146811 11:106690514-106690536 TTCACCCTCCACCCTCCAAAAGG - Intronic
1088265831 11:107986743-107986765 TCCACCCTCCACCTTCTGAAAGG - Intergenic
1088943540 11:114485285-114485307 TGCATCCTCCACCTCCCAGGTGG + Intergenic
1089395863 11:118136055-118136077 TGCACCCTCCAACCTCCCATTGG - Exonic
1089617692 11:119704299-119704321 TGCAACCTCCACCTCCCAGGCGG + Intronic
1089683408 11:120132162-120132184 TGCTCCCTTCACCTTGCAGATGG + Intronic
1090446577 11:126769729-126769751 TGCACCCTCCACCTTGCCCCTGG - Intronic
1091966795 12:4750342-4750364 TCCACCCTCCACCCTCCAAAAGG + Intronic
1093038532 12:14354845-14354867 TGCCCCCCCCACCTCCCGGACGG - Intergenic
1095818744 12:46453517-46453539 TCCATCCTCCCCCTTCCCAAAGG - Intergenic
1096106707 12:49000235-49000257 TGCACTCTCACCCTTCCAGAGGG + Intergenic
1096645535 12:53032744-53032766 TGCAACCTCCGCCTCCCCGGTGG + Intronic
1096708385 12:53437699-53437721 GGCACCCCCCACCTCCCGGACGG - Intergenic
1101284333 12:103294918-103294940 TTCACCCTCCACCCTCCAAAAGG + Intronic
1101512709 12:105407283-105407305 AGGACACTCCACCTTCCCAAGGG - Intergenic
1101954220 12:109199278-109199300 TGTACCCTCTACATTCCCAAAGG - Intronic
1102660399 12:114522166-114522188 TCCACCCTCCACCCTCCAAAAGG - Intergenic
1102916697 12:116759754-116759776 TGCACCCTCCACCACCTCCATGG - Intronic
1103323433 12:120104707-120104729 TGCACCCTTGACCTTCCCCCAGG + Intronic
1103666321 12:122569016-122569038 TTCACCCTCCACCTTCTGAAAGG - Intronic
1106379782 13:29224999-29225021 TGCTTCCTCCACCTTTCCTAGGG + Intronic
1107120582 13:36791103-36791125 TGCAACCTCCACCTCCCGGGAGG - Intergenic
1108370446 13:49762274-49762296 GGCACCCCCCACCTCCCGGACGG - Intronic
1113099980 13:106706941-106706963 TCCACCCTCCTCCTTTCCAAGGG + Intergenic
1115232721 14:31178718-31178740 TGCAACCTCCATCTCCCGGAAGG - Intronic
1116191619 14:41673755-41673777 GGCACCCTTCACCTCCCGGACGG + Intronic
1116360645 14:43992176-43992198 TGCACCCTCCACCTTCCCATAGG - Intergenic
1116498074 14:45586864-45586886 TGTACCCTCCACCACCCCCATGG - Intergenic
1116903528 14:50383472-50383494 TGCAACCTCCTCCTCCCCGCAGG - Intronic
1118054005 14:62059063-62059085 CCCACCCTCCACCTTCCCAAAGG - Intronic
1119535607 14:75400408-75400430 TGCACCCTCCCCCTGCCCCCAGG + Intergenic
1120015809 14:79471991-79472013 CCCACCCTCCACCCTCCCAAAGG + Intronic
1120331800 14:83102687-83102709 TCCACCCTCCACCCTCCAAAAGG - Intergenic
1120359306 14:83476472-83476494 TGCACCCTCCACCTCCCAGGTGG - Intergenic
1121831399 14:97055404-97055426 TGCACCTTTCAGCTTCCGGACGG - Intergenic
1122581849 14:102776588-102776610 TGCACCCTCCACCAGGCCGCTGG - Intergenic
1122629822 14:103102517-103102539 CGCGCCCTCCGCCTCCCCGAAGG - Exonic
1122841512 14:104466457-104466479 TGCACCTTGCAAGTTCCCGATGG + Intergenic
1123984379 15:25632257-25632279 AGCTTCCTGCACCTTCCCGAAGG - Intergenic
1124193602 15:27601077-27601099 TGCACTGTGCACCTTCCCCAGGG + Intergenic
1126442974 15:48711769-48711791 TCCACCCTCCACCCTCCAAAAGG + Intergenic
1127602026 15:60547400-60547422 TGCAACCTCCACCTCCCCCAGGG + Intronic
1127826547 15:62708861-62708883 GGCAGCCTTCACCTTCCCTATGG - Intronic
1128474000 15:67981565-67981587 TGCACGCTCCACCTCTCCAATGG + Intergenic
1128607224 15:69046112-69046134 TGCTTCCTTCACCTTCCAGAAGG + Intronic
1129437211 15:75551216-75551238 TGCACCAACCACCCTGCCGAGGG + Intronic
1130189461 15:81719102-81719124 CCCACCCTCCACCTTCCAGTAGG + Intergenic
1130324454 15:82868417-82868439 TCCACCCTCCACCCTCCAGTAGG - Intronic
1131975246 15:97938924-97938946 GGCACCTTCCACCTTCCTAAAGG + Intergenic
1132534637 16:472006-472028 TGCCACCTCCACCTTCCCGGCGG - Intronic
1132703134 16:1230423-1230445 AGAACCCACCACCTTCCCGCTGG + Intergenic
1132705186 16:1240445-1240467 GGAACCCACCACCTTCCCGCTGG - Intergenic
1132708315 16:1255808-1255830 GGAACCCACCACCTTCCCGCTGG - Intergenic
1133019199 16:2959451-2959473 AGCTCCCTCCACCCTCCCCAAGG + Intergenic
1133446331 16:5864052-5864074 TTCACCTTCCACCCTCCAGAAGG + Intergenic
1134155054 16:11836205-11836227 CACAGCCTCCACCATCCCGATGG + Exonic
1134587659 16:15426014-15426036 TGCAACCTCCACCTCCCGGGAGG + Intronic
1135224990 16:20648025-20648047 TGCAGCCTCCACAGTCGCGATGG + Intronic
1135962923 16:27012756-27012778 TGCAACCTCCTCCTGCCCGCAGG + Intergenic
1139162037 16:64521738-64521760 GCCACCCTCCACCGTCCAGAAGG + Intergenic
1140412419 16:74748951-74748973 TGGACCCCCCACCTTCCCCCTGG - Intronic
1140581845 16:76240255-76240277 CCCACCCTCCACCCTCCCAAAGG - Intergenic
1141450177 16:84094198-84094220 TCCACCCCCCACCTTCTCGGAGG + Intronic
1141693324 16:85608362-85608384 TGCACAGTCCACCCTCCCCAAGG - Intergenic
1141960581 16:87404952-87404974 GGCACCCTCCACCTTGGCCAAGG + Intergenic
1203140990 16_KI270728v1_random:1765767-1765789 TGCAACCTCCGCCTTTCTGATGG + Intergenic
1142559762 17:803045-803067 TGCACCCTGCACCCTGCAGACGG - Intronic
1143696784 17:8626701-8626723 TACACACTCCACCTTTCAGAAGG + Intronic
1144168555 17:12636038-12636060 CCCACCCTCCACCTTCCAAAAGG + Intergenic
1144819930 17:18065414-18065436 TGCTCCCTCCACCTGCCCCACGG - Exonic
1144953475 17:19005865-19005887 TGCATCCTCCTCCTGCCCCAGGG + Intronic
1148385447 17:47231138-47231160 TGCAGCCTCAACCTTCCCAGGGG - Intergenic
1148609399 17:48954380-48954402 TGCACCCACCTCTTTCACGACGG + Intergenic
1150403011 17:64874506-64874528 GGCACCCCCCACCTCCCGGACGG - Intronic
1151301588 17:73231429-73231451 TGCACTCGCTACCTTCCCGAGGG - Intronic
1151325893 17:73379611-73379633 TGCAGCCTCCACCCTCCCTGGGG - Intronic
1151963488 17:77419527-77419549 TGACCCCTCCCCCTTCCCCAGGG + Intronic
1152145336 17:78564990-78565012 TCCATCCTCCACCATCCCGCAGG + Intronic
1152157747 17:78646042-78646064 CGCACCCTTCACCCTTCCGAGGG - Intergenic
1152582522 17:81172683-81172705 TGCAACCTCCACCTCCCGGCTGG - Intergenic
1152873870 17:82774634-82774656 GGCACCCCCCACCTCCCAGACGG + Intronic
1154080307 18:11249835-11249857 TGATCCCTCCACCTTCCCATGGG + Intergenic
1158356198 18:56621939-56621961 TGCAACCTCCACCGTCCCCCTGG - Intronic
1159173476 18:64803622-64803644 TCCACCCTCCACCTTCACATAGG + Intergenic
1159275796 18:66219911-66219933 TGCAACCTCCACCTCCCAGGTGG - Intergenic
1159691086 18:71488034-71488056 CCCACCCTCCACCATCCCAAAGG - Intergenic
1159849252 18:73507212-73507234 TTCACCCTCCACCCTCCAAAAGG + Intergenic
1160673896 19:378442-378464 TGCACCCGGCACCTTCTCGGGGG + Intergenic
1160756717 19:761278-761300 TGCAACCTCCACCTCCCGGATGG - Intronic
1161399418 19:4060802-4060824 GCCACCCGCCACCTTCCCGAAGG + Intronic
1161416603 19:4150567-4150589 TGCAGCCTCAACCTTCCGGACGG - Intergenic
1161911922 19:7200279-7200301 TGACACCTCCACCTCCCCGATGG - Intronic
1162111017 19:8399792-8399814 TGCCCCCACAACCTTCCCGCCGG - Intronic
1162934579 19:13975281-13975303 TGCAACCTCCACCTTCAGGGTGG - Intronic
1163870451 19:19816896-19816918 TGCAACCTCCACCTCCCAGTGGG + Intronic
1163906412 19:20152617-20152639 GGCACCCCCCACCTCCCGGACGG + Intergenic
1164054031 19:21607103-21607125 GGCACCCCCCACCTACCAGACGG + Intergenic
1164239279 19:23369415-23369437 GGCGCCCTCCACCTCCCGGACGG - Intronic
1164659205 19:29948924-29948946 GGCACCCCCCACCTCCCAGACGG + Intronic
1165382852 19:35493586-35493608 TGCAACCTCCACCTCCCAGGAGG + Intronic
1165611982 19:37162820-37162842 TTCACCCTCCACTTTCCAAAAGG - Intronic
1165812053 19:38617720-38617742 TGCAGCCTCCTCCCTGCCGAGGG + Intronic
1166169305 19:41016319-41016341 TGCAACCTCCACCTCCCAGGTGG - Intronic
1166420710 19:42633901-42633923 TGGTCACTCCACCTTCCCCAAGG + Intronic
1166749650 19:45158837-45158859 TGCAACCTCCACTGTCCCCAAGG - Exonic
1167365044 19:49050382-49050404 AGCCCCCTCCACCTACCCCACGG + Intergenic
1167804059 19:51767080-51767102 CTCACCCTCCACCTTCCGGTAGG + Intronic
1167913097 19:52720342-52720364 GGCGCCCCCCACCTCCCCGACGG + Intronic
925816376 2:7754914-7754936 TCCACCCTCCACCCTCCAAAAGG - Intergenic
926252718 2:11165117-11165139 GGCACCCCCCACCTCCCGGACGG + Intronic
926674800 2:15611646-15611668 GGCACCCCCCACCTCCCGGACGG + Intronic
928329348 2:30345964-30345986 TGCAACCTCCGCCTCCCCGGGGG - Intergenic
928710680 2:34001717-34001739 TGCATGCTCCACCTTCCATAAGG + Intergenic
929344403 2:40863442-40863464 TCCACCCTCCACCCTCCAAAAGG - Intergenic
932043025 2:68319677-68319699 TGCGCCCTCCACGCACCCGAAGG + Exonic
932780612 2:74556352-74556374 TGGAACCTTCACCTTCCAGACGG + Exonic
934319868 2:91962123-91962145 TGCCCCCTCTACCTTCCCAGAGG - Intergenic
934998447 2:98988764-98988786 GGCACCCCCCACCTTCTGGACGG + Intergenic
935011589 2:99141274-99141296 CGCCCCCTCCTCCTTCCCGCGGG - Intronic
935210156 2:100932679-100932701 TGCATCCCCCACCTTCTCTATGG - Intronic
937540742 2:122949636-122949658 CCCACCCTCCACCTTCCAAAAGG + Intergenic
938019396 2:127893609-127893631 TGCTCCCTCCTCCTTCCCGGTGG - Intergenic
938836295 2:135106166-135106188 GGCACCCCCCACCTCCCGGACGG - Intronic
939053737 2:137336515-137336537 TCCATCCTCCACCTTCTGGATGG + Intronic
940810263 2:158234969-158234991 TCCACCCTCCACCCTCTGGAAGG - Intronic
941263097 2:163321413-163321435 TGCAACCTCCACCTCCCCGCAGG - Intergenic
941686116 2:168450775-168450797 TGCAACCTCCACCTCCCAGGTGG - Intergenic
944293076 2:198030163-198030185 TTCACCCTCCACCCTCCAGTAGG + Intronic
944791099 2:203128161-203128183 TGCAACCTCCATCTCCCAGAAGG + Intronic
945633688 2:212319273-212319295 TACACCCACCTCCTTCCCGCAGG + Intronic
945790864 2:214304007-214304029 CCCACCCTCCACCTTCCAGTAGG + Intronic
946103243 2:217345687-217345709 CCCACCCTCCACCTTCCAGTAGG + Intronic
948199011 2:236116189-236116211 TGCATCCTCCACCCTCCACAAGG + Intronic
948572876 2:238928286-238928308 TGCTCCCTCCACATTCCCAGGGG - Intergenic
1169869628 20:10237055-10237077 TGCACCCTCGTCCTTCACTAAGG - Intronic
1171265596 20:23769592-23769614 TCCACCCTACACCATCCAGAGGG - Intergenic
1171317802 20:24210788-24210810 TGCACCCTCCAGATACCCCATGG - Intergenic
1173596949 20:44264571-44264593 TGCAGCCCCCACCTCCCCCAGGG - Intronic
1175109481 20:56636816-56636838 TTCCCCCTCCACAGTCCCGATGG + Intronic
1175763955 20:61580375-61580397 TGCAGCCTCCACCTCCCGGGTGG - Intronic
1175839767 20:62019587-62019609 TGCACGCTGCTCCTTCCCCAGGG - Intronic
1176181157 20:63750109-63750131 TCCAGCCTCCACTTTCACGATGG - Intronic
1177172847 21:17672811-17672833 TGCTCCCTCCACCTGCAAGATGG + Intergenic
1179098343 21:38335322-38335344 TGCAGCCACCACCGTCCCAAGGG - Intergenic
1179568122 21:42261664-42261686 CTCACCCGCCAGCTTCCCGAGGG - Intronic
1180067006 21:45417604-45417626 TGCTCCCTCCAGCTCCCTGATGG + Intronic
1180606620 22:17063880-17063902 TGCAGCTTCCACCCTCACGATGG + Intergenic
1181902031 22:26164160-26164182 AGCCTCCTCCACGTTCCCGATGG + Intergenic
1182292408 22:29291151-29291173 TGCACCCTCAACCTCTCCCAAGG - Intronic
1183315521 22:37135039-37135061 TGCACCTCCCACCTTCCCCTCGG + Intronic
1184201423 22:42971918-42971940 GGCACCCCCCACCTTCCAGACGG - Intronic
1184373936 22:44099891-44099913 TGCCCCATCCACCTTCCAGAAGG + Intronic
1184546321 22:45171273-45171295 TGCAACCTCCACCTCCCGGAGGG + Intronic
1184622836 22:45695566-45695588 TGCAACCACCGCCTTCCCGCCGG + Intronic
949346754 3:3083968-3083990 TGCACCCTCCACCTCCCATGGGG - Intronic
949560562 3:5198121-5198143 TGCACCCTCCACCTTCCCAGGGG + Intronic
949841215 3:8322133-8322155 TGCACTGTCCACCTTCCCAGGGG - Intergenic
950777649 3:15364508-15364530 TGCAGCCTCCACAATCGCGATGG + Intergenic
950905740 3:16536310-16536332 TGCCCCTTCCGCCTTCCGGATGG + Intergenic
951394754 3:22152003-22152025 TCCACCCTCCACCTTCAAGTAGG + Intronic
951750850 3:26034767-26034789 TCCACCCTCCACCATCCAGTAGG - Intergenic
951974580 3:28490661-28490683 TCCACCCTCCACCCTCACGTAGG - Intronic
952548052 3:34444129-34444151 TTCACCCTCCACCTTCCAAAAGG + Intergenic
953003183 3:38953250-38953272 TCCACCCTCCACCTTCCCATGGG - Intergenic
953084904 3:39656015-39656037 GGCACCCCCCACCTCCCAGACGG - Intergenic
953583539 3:44178717-44178739 TCCACCCTCCACCTTCCCAAGGG + Intergenic
954193588 3:48982648-48982670 TCCACCCTCCACACTCCCAAAGG - Intronic
955375023 3:58387512-58387534 TGCCCCCGCCTCCTTCCCCAAGG - Intronic
955839240 3:63094558-63094580 TCCACCCTCCACCCTCCAGTAGG + Intergenic
959021693 3:101194418-101194440 TCCACCCTCCACCCTCCGAAAGG + Intergenic
959326718 3:104946168-104946190 CCCACCCTCCACCTTCCAGTAGG + Intergenic
960770715 3:121190639-121190661 GGCACCCCCCACCTCCCAGATGG + Intronic
961470363 3:127107563-127107585 AGCAGCCTCCACCTTCCAGGAGG + Intergenic
961587184 3:127941663-127941685 TGCAACCTCCATCTCCCAGACGG + Intronic
961910637 3:130312727-130312749 CCCACCCTCCACCTTCCAGTAGG - Intergenic
962688870 3:137872936-137872958 GGCACCCCCCACCTCCCGGACGG - Intergenic
964375268 3:156043074-156043096 TTCACCCTCCACCTTCAAGGAGG + Intronic
965136969 3:164784668-164784690 GGCACCCCCCACCTCCCAGATGG - Intergenic
965150878 3:164973312-164973334 TCCACCCTCCACCCTCAAGATGG - Intergenic
965647729 3:170901635-170901657 TGCAACCTCCACCTCCCTGGTGG + Intronic
966832908 3:184025960-184025982 TGCAACCTCCACCTCCCAGTTGG - Intergenic
967223587 3:187270377-187270399 TTCATCCTCCACCATCCCCACGG + Intronic
967254677 3:187577692-187577714 TCCACCCTCCACCCTCCAGTAGG - Intergenic
967637910 3:191825829-191825851 TCCACCCTCCACCCTCAAGAAGG - Intergenic
968582487 4:1401547-1401569 CGCCCCCTCAACCTGCCCGATGG + Intergenic
969538136 4:7769208-7769230 TGGAGCCTCCACCTGCCCGTCGG - Intronic
969594919 4:8143421-8143443 TGCACCCTGCACCCTACCCAGGG + Intronic
969674313 4:8606672-8606694 CCCACCCTCCTCCTTCCAGATGG - Intronic
970045733 4:11851043-11851065 TCCACCCTACACCCTCCCAAAGG - Intergenic
970055382 4:11965411-11965433 TGCACCCCACACCCTCCCCATGG - Intergenic
971528701 4:27656930-27656952 TGCACCCTCCCCCTGCCCCAAGG - Intergenic
972592234 4:40498592-40498614 TGCAACCTCCACCTTCTGGGTGG - Intronic
974663472 4:64925379-64925401 TGCATCCTCCACCTTCCGATAGG - Intergenic
975574410 4:75848554-75848576 TGCAACCTCCGCCTCCCCGGGGG + Intergenic
977256535 4:94747055-94747077 TCCACCTTCCACCTTCCAAAAGG - Intergenic
977635047 4:99287594-99287616 TGCAACCTCCACCTCCTCAATGG + Exonic
978224956 4:106321606-106321628 GGCGCCCTCCACCTCCCAGACGG - Intronic
979638164 4:122979817-122979839 TGCAGCCTCAACATTCCCCAGGG - Intronic
980667007 4:135953616-135953638 TGCAACCTCCACCTCCAAGATGG + Intergenic
981295693 4:143128290-143128312 TGCAACCTCCACCTTCTCTGAGG + Intergenic
982723559 4:158882407-158882429 GGCACCCCCCACCTCCCGGACGG - Intronic
983689771 4:170454063-170454085 TCCACCCTCCACCTTCCAATAGG + Intergenic
983834197 4:172369531-172369553 TGCAGCCTGAACCTCCCCGACGG - Intronic
984216772 4:176922999-176923021 TGCATCCTCCACCTCCCGGGTGG + Intergenic
985659096 5:1146928-1146950 TGCACCCGCCCACCTCCCGAGGG + Intergenic
985893630 5:2736177-2736199 TGCACACATCACCTACCCGAGGG - Intergenic
986546731 5:8905904-8905926 TGCAGCCTGCATCTTCACGAAGG + Intergenic
986679724 5:10221835-10221857 TGCACCCTACATCATCCTGAAGG - Intergenic
986716505 5:10527901-10527923 CGCACCCTCCATCTTCTTGATGG + Intergenic
987593983 5:19971685-19971707 TCCACCCTCCACCTTCGGAAAGG - Intronic
988250269 5:28748467-28748489 TGCAGCCTCCACAATCACGATGG - Intergenic
989339931 5:40362793-40362815 TCCACCCTCCACCCTCCAGTAGG + Intergenic
989372340 5:40722803-40722825 TGCGCCCCCCACCTCCCGGATGG - Intronic
990298973 5:54431769-54431791 TGCTACCTCCACCTTACTGAAGG + Intergenic
991465203 5:66905226-66905248 TGCAACCTCCACCTTCTGGGTGG - Intronic
991983193 5:72255115-72255137 TGCAACCTCCACCTCCCAGGTGG + Intronic
994636206 5:102346778-102346800 GGTACTCTCCACCTTCCCTAGGG + Intergenic
995432232 5:112093233-112093255 TGCAACCTCCACCTCCCAGCAGG + Intergenic
997982809 5:138479902-138479924 TGCAACCTCCACCTCCCGGGTGG - Intergenic
998092037 5:139377038-139377060 TGCAACCTCCACTTCCCGGAGGG - Intronic
998553032 5:143095645-143095667 TGCAACCTCCACCTCCCAGCTGG + Intronic
998720146 5:144936083-144936105 TGCAGCCTCCACCTTCCTGGTGG - Intergenic
998951077 5:147393615-147393637 TGCACCCTCCACCTTGCTCCAGG + Exonic
999270390 5:150293513-150293535 GGCACCCCCCACCTTCCTGAGGG + Intergenic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
1001051525 5:168418263-168418285 TGCCTCCCCCTCCTTCCCGAGGG + Intronic
1002638530 5:180619726-180619748 GGCTTCCACCACCTTCCCGAAGG + Exonic
1003147452 6:3520703-3520725 TGAACCCTCCAGTTTCCCCATGG - Intergenic
1004226081 6:13785439-13785461 TGCACACTTCACCTTCCCTGAGG - Intergenic
1004384167 6:15158203-15158225 TGCAACCTCCACCTCCCAGATGG + Intergenic
1004618171 6:17310137-17310159 TGCAGCCTCCACCTTGTTGATGG - Intergenic
1005384861 6:25276077-25276099 TCCACCCCCCACCATCCCTATGG + Intergenic
1007295193 6:40815933-40815955 GGCACCCCCCACCTCCCAGACGG - Intergenic
1008594146 6:53024483-53024505 AGCACCCTCCAGCTTGCAGAAGG + Intronic
1008853469 6:56052892-56052914 TCCACCCTCCACCTTCCAGTAGG - Intergenic
1008909937 6:56721189-56721211 TGCGCCCCCCACCTCCCAGATGG + Intronic
1011468971 6:87688672-87688694 TGCAACCTCCACCTCCCCCCGGG - Intronic
1012284568 6:97373439-97373461 TTCACCCTCCACCCTCCAGTAGG + Intergenic
1013183786 6:107739914-107739936 TGCTTCCTCCACTTTCCCCAAGG + Intronic
1013211486 6:107990845-107990867 TGCAGCCTCCACACTCGCGATGG + Intergenic
1014813312 6:125908638-125908660 TACCCCATCCACCTTCCCGATGG + Intronic
1015769774 6:136756542-136756564 TGCAACCTCCGCCTCCCGGAAGG + Intronic
1016123585 6:140373806-140373828 GGCACCCCCCACCTCCCGGATGG + Intergenic
1017075352 6:150612672-150612694 TGCACCCTCACCCTTCCCTTTGG - Intronic
1017264596 6:152427876-152427898 TGGACCCTCCAACTTCACAAAGG - Intronic
1018878661 6:167851427-167851449 TCCACCCTCCACCCTCCAGTGGG + Intronic
1019427905 7:986017-986039 TGCAGCCTCCATCTTCCAGGTGG - Intronic
1021523175 7:21556673-21556695 TCCACCCTCCACCCTCAAGAAGG + Intronic
1022865321 7:34412294-34412316 TCCACCCTCCACCCTCCAAAAGG - Intergenic
1024398671 7:48898217-48898239 TCCACCCTCCAACTTCCAAAAGG - Intergenic
1024707796 7:51979856-51979878 TGCAACCTCCACCTCCTCGGAGG - Intergenic
1026516118 7:71074055-71074077 TGCAGCCTCCACACTCGCGATGG + Intergenic
1026960623 7:74405202-74405224 TGCAGCCTCCACCTCGCCGCTGG + Exonic
1028173625 7:87628494-87628516 GGCGCTCTCCTCCTTCCCGAGGG - Exonic
1028359686 7:89952879-89952901 TCCACCCTCCACCTTCCAGAAGG + Intergenic
1029482698 7:100822780-100822802 TCTTCCCTCCACCTTCCCCAGGG + Intronic
1029940678 7:104477589-104477611 TTCACCCTCCACCCTCCGAAAGG - Intronic
1030308296 7:108041737-108041759 CCCACCCTCCACCTTCCAAAAGG - Intronic
1030397565 7:109006584-109006606 CCCACCCTCCACCTTCCAAAAGG - Intergenic
1032673060 7:134102797-134102819 TGCAACCTCCACCTCCCAGTTGG + Intergenic
1033085667 7:138339414-138339436 TGCAGCCTCCACACTCGCGATGG + Intergenic
1033232947 7:139616027-139616049 TCAACCCTCCACATTCCCCATGG + Intronic
1034374286 7:150629062-150629084 GGCCCCCTCCAGCTTCCCCAAGG + Intronic
1035774511 8:2177944-2177966 TCCACCCTCTACCCTCCAGAGGG + Intergenic
1036619454 8:10415069-10415091 TGCACCCTCCACCCGCAGGATGG - Intronic
1037134548 8:15445908-15445930 GGCGCCCCCCACCTTCCGGACGG + Intronic
1038278251 8:26139778-26139800 TGCCCCCTCCCTCTTCCCCATGG + Intergenic
1038539537 8:28380922-28380944 TGCAGCCTCCACCTTCTGCAGGG + Intronic
1039900257 8:41746736-41746758 TTCCTCCTCCACCTTCCCCAGGG - Intronic
1040966661 8:53088711-53088733 CCCACCCTCCACCTTCCAGTAGG + Intergenic
1041916138 8:63141028-63141050 TCCACCCTCCACCCTCCCAAAGG - Intergenic
1042189498 8:66171242-66171264 TCCACCCTCCACCCTCCGAAAGG + Intronic
1042751662 8:72164084-72164106 CCCACCCTCCACCTTCCAGTAGG + Intergenic
1042764226 8:72302848-72302870 CCCACCCTCCACCTTCCAGTAGG + Intergenic
1043784077 8:84374700-84374722 TGCACCCTCCACCCTCAAGTAGG - Intronic
1044964945 8:97565573-97565595 TGCACCCTCAACCCTCACGTGGG + Intergenic
1045532808 8:103000653-103000675 GGCACCCTCCACATGCCCCAGGG + Intergenic
1045589603 8:103578909-103578931 TGCAACCTCCACCTTCCAGTTGG - Intronic
1046447960 8:114347708-114347730 TCCACCCTCCACCTTCCTAAAGG - Intergenic
1046628393 8:116599334-116599356 CCCACCCTCCACCTTCCAAAAGG + Intergenic
1046775548 8:118159792-118159814 TGCAACCTCCACCTCCCCTCTGG + Intergenic
1046936756 8:119892075-119892097 TGCAACCTCCACCTCCCGGGTGG + Intronic
1047159100 8:122356543-122356565 TGCACCCTCCACCCTCAAGTAGG + Intergenic
1047169121 8:122473479-122473501 CCCACCCTCCACCTTCCAGTAGG - Intergenic
1047609539 8:126507629-126507651 TGCACCCCCCACCCTCCAGTAGG - Intergenic
1048236159 8:132692753-132692775 CGCAACCTCCACCTTGCCAAGGG + Intronic
1049932080 9:467270-467292 TGCACCCTTGACCTTGCTGAAGG - Intergenic
1051086853 9:13359752-13359774 TGCAACCTCCACCTCCCAGGTGG - Intergenic
1051918070 9:22230891-22230913 TGCAGCCTCCACAATCGCGATGG - Intergenic
1057731398 9:97612012-97612034 TCCACCCTCCACCCTCCAAAAGG + Intronic
1058244127 9:102603301-102603323 GGCACCCCCCACCTCCCAGACGG + Intergenic
1059059646 9:111021883-111021905 TGCAACCTCCACCTCCCGGGTGG - Intronic
1059378196 9:113902105-113902127 TGCACTCTCCACCCTCACGTAGG - Intronic
1059751239 9:117249605-117249627 TTCACCCACCACCTTCCCCCTGG + Intronic
1062357308 9:136170942-136170964 TGCCCCATCCATCTTCCCCACGG + Intergenic
1062478354 9:136740565-136740587 TGCACCCGCCACCATCCTGGTGG + Intronic
1062658062 9:137614342-137614364 CGCACCCTCCACCTCCGCAATGG - Exonic
1062694658 9:137867262-137867284 AGCACCCTGCCCCTTCCCGTTGG + Intronic
1185730180 X:2455285-2455307 CCCACCCTCCACCTTCCAGCAGG - Intronic
1186455886 X:9709520-9709542 TGCACCCTCCACCCTGCCCTGGG + Intronic
1186854473 X:13612631-13612653 GGCACCCCCCACCTCCCAGACGG + Intronic
1187136693 X:16554558-16554580 TCCACCCTCCACCCTCCAGTAGG - Intergenic
1187471373 X:19572636-19572658 TGCAACCTCCACCTCCCAAATGG + Intronic
1188735195 X:33704317-33704339 TCCACCCTCCACCCTCCAAAAGG + Intergenic
1188818649 X:34746560-34746582 TGCACTCTTCACATTCACGAAGG - Intergenic
1189085568 X:38019706-38019728 TGCACCCTCCACCTCCCACGTGG + Intronic
1190460997 X:50675165-50675187 CCCACCCTCCACCTTCCAAAAGG - Intronic
1192058783 X:67801452-67801474 TCCACCCTCCACCCTCCAGAAGG - Intergenic
1192296438 X:69854156-69854178 TCCACCCTCCACCTTCCGACAGG + Intronic
1192922937 X:75726670-75726692 TTCACCCTCCACCCTCAGGAAGG + Intergenic
1193085164 X:77442404-77442426 TCCACCCTCCACCTTCAAGTAGG + Intergenic
1193863639 X:86701857-86701879 TGTACCCTCCACCCTCCAGTAGG - Intronic
1194110571 X:89828422-89828444 TCCACCCTCCACCATCCAAAAGG + Intergenic
1194714550 X:97275228-97275250 TGCCCCCCCCACCTCCCAGACGG + Intronic
1194904901 X:99562741-99562763 CCCACCCTCCACCTTCAAGAAGG - Intergenic
1195060490 X:101189633-101189655 TGCAGCCTCCACACTCGCGATGG - Intergenic
1196010551 X:110882981-110883003 CCCACCCTCCACCTTCAAGAAGG + Intergenic
1196663486 X:118293177-118293199 TGCAGCCTCCACACTCGCGATGG - Intergenic
1196664348 X:118300498-118300520 TGCAGCCTCCACACTCGCGATGG - Intergenic
1196736192 X:118982852-118982874 TGCCTCCTCCACCTTGCCTAGGG - Exonic
1200463232 Y:3483164-3483186 TCCACCCTCCACCATCCAAAAGG + Intergenic
1200604870 Y:5250605-5250627 CCCACCCTCCACCTTCCAGTAGG - Intronic
1201282296 Y:12352332-12352354 GGCACCCCCCACCTCCCGGATGG - Intergenic