ID: 915607851

View in Genome Browser
Species Human (GRCh38)
Location 1:156964815-156964837
Sequence GGTCTGAGAGCCCCAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 370}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915607844_915607851 -1 Left 915607844 1:156964793-156964815 CCCTACTCTCTGACCCTCTTGGG 0: 1
1: 0
2: 1
3: 13
4: 186
Right 915607851 1:156964815-156964837 GGTCTGAGAGCCCCAGAAGGTGG 0: 1
1: 1
2: 2
3: 36
4: 370
915607839_915607851 24 Left 915607839 1:156964768-156964790 CCTGAGTATCCTCCTCTCCGAAA 0: 1
1: 0
2: 0
3: 18
4: 289
Right 915607851 1:156964815-156964837 GGTCTGAGAGCCCCAGAAGGTGG 0: 1
1: 1
2: 2
3: 36
4: 370
915607840_915607851 15 Left 915607840 1:156964777-156964799 CCTCCTCTCCGAAACACCCTACT 0: 1
1: 0
2: 0
3: 10
4: 144
Right 915607851 1:156964815-156964837 GGTCTGAGAGCCCCAGAAGGTGG 0: 1
1: 1
2: 2
3: 36
4: 370
915607846_915607851 -2 Left 915607846 1:156964794-156964816 CCTACTCTCTGACCCTCTTGGGG 0: 1
1: 0
2: 1
3: 19
4: 201
Right 915607851 1:156964815-156964837 GGTCTGAGAGCCCCAGAAGGTGG 0: 1
1: 1
2: 2
3: 36
4: 370
915607842_915607851 7 Left 915607842 1:156964785-156964807 CCGAAACACCCTACTCTCTGACC 0: 1
1: 0
2: 0
3: 19
4: 230
Right 915607851 1:156964815-156964837 GGTCTGAGAGCCCCAGAAGGTGG 0: 1
1: 1
2: 2
3: 36
4: 370
915607841_915607851 12 Left 915607841 1:156964780-156964802 CCTCTCCGAAACACCCTACTCTC 0: 1
1: 0
2: 0
3: 8
4: 145
Right 915607851 1:156964815-156964837 GGTCTGAGAGCCCCAGAAGGTGG 0: 1
1: 1
2: 2
3: 36
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915607851 Original CRISPR GGTCTGAGAGCCCCAGAAGG TGG Intronic
900188491 1:1343689-1343711 GGTCTGAGAGTCCTTGTAGGTGG - Intronic
900592363 1:3465723-3465745 GGTCTGGGGGCCCCAGCAGGAGG - Intronic
900754138 1:4421873-4421895 GATCTGAGAGCCTCGGAATGGGG - Intergenic
900802743 1:4747432-4747454 GGCCTGAAAGCCCAAGGAGGAGG - Intronic
900883135 1:5396376-5396398 GATCTCAGAGCCCATGAAGGTGG - Intergenic
901671130 1:10856916-10856938 GGACAGAGAGTCCCAGGAGGGGG - Intergenic
902463291 1:16596279-16596301 TGTCAGAGAGCGCAAGAAGGGGG - Intronic
902604764 1:17562908-17562930 GGTCTGGGAGCCACAGCAGGCGG + Intronic
903369545 1:22826357-22826379 GGTCTGCAAACCCCAGAATGGGG + Intronic
904402443 1:30265748-30265770 AGTCTGAAACCCACAGAAGGAGG + Intergenic
904563155 1:31412267-31412289 GGTGTGAGAGACCCAGAAGTAGG - Intronic
904806747 1:33137587-33137609 AGACTGAGATCCCCAGAGGGGGG + Intergenic
904962954 1:34349234-34349256 GGCCTGAGAGACCCAGAAAATGG + Intergenic
907048719 1:51315568-51315590 GGTCTGAAAGGACCAGAAAGTGG - Intronic
907821243 1:57971779-57971801 GGTCTGAAATCCACAGAAGAGGG + Intronic
909425061 1:75514268-75514290 GCTTTGAGAGGCTCAGAAGGTGG - Intronic
910513757 1:88036158-88036180 GGCCTGAGAGCCCCAGCTGGGGG - Intergenic
912576253 1:110674980-110675002 GGGCGGAGAGCGCGAGAAGGAGG - Exonic
913010234 1:114676049-114676071 GGACTGATAGCCCCAGTATGAGG + Intronic
913233327 1:116760036-116760058 GCTCTGAGAGGTCCAGTAGGTGG - Intronic
913991397 1:143615732-143615754 TGTCTGAGACCGCAAGAAGGGGG - Intergenic
915607851 1:156964815-156964837 GGTCTGAGAGCCCCAGAAGGTGG + Intronic
916635034 1:166659163-166659185 AGTCTGAAAGCCCCAGAACTGGG - Intergenic
917679319 1:177349959-177349981 GGTGTGTGTGCCCCAGGAGGTGG + Intergenic
919730172 1:200908771-200908793 GGTGGGAGAGGCCGAGAAGGTGG - Exonic
920875135 1:209827815-209827837 GTTCTCAGAGCCCTAGAACGTGG - Intergenic
922788341 1:228294891-228294913 GGTCTGAGACCCTCAGAGGTGGG + Exonic
924488514 1:244512152-244512174 ATTTTGAGAGCTCCAGAAGGTGG - Intronic
1064396625 10:14987387-14987409 CCTCTGAGAGTCCCAGGAGGAGG + Intronic
1064399417 10:15008768-15008790 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1064973474 10:21089536-21089558 GGGCAGAGAGACCGAGAAGGAGG + Intronic
1067085413 10:43235523-43235545 GGTTTGAGAGCCCCATCTGGAGG - Intronic
1067136198 10:43609100-43609122 GGTCAGAGAGGCCTAGAGGGTGG - Intronic
1067531147 10:47074515-47074537 AGTCTAGGAGCCCCACAAGGTGG - Intergenic
1070091673 10:73291987-73292009 GGTCCGTGAGCCCCAGAATCTGG - Exonic
1070462168 10:76681197-76681219 AGGCTGAGAGTCCAAGAAGGTGG + Intergenic
1070592295 10:77809820-77809842 GTTCTGAGACCCCAAGAAGCAGG - Intronic
1070647215 10:78210432-78210454 GGTCTGGGCTCCCTAGAAGGTGG - Intergenic
1070756863 10:78998669-78998691 GGCCTGAGGGGCCCAGGAGGTGG + Intergenic
1072426101 10:95332219-95332241 GGTGTCAGAGCCCCAGTATGAGG - Intronic
1072757883 10:98032371-98032393 GGTCTGTGATCCCCAAAAGGAGG - Intergenic
1075895873 10:125994123-125994145 GGTGGGTGAGCCCCAGGAGGTGG + Intronic
1075919384 10:126197867-126197889 GGCCTGAAAGCCCCAGACAGCGG + Intronic
1076705967 10:132301750-132301772 GGACTGAGAGGAACAGAAGGAGG + Intronic
1076725499 10:132411073-132411095 GGTCTCAGAGCCCCAGTGTGTGG - Intronic
1076739751 10:132477407-132477429 GGCCTGAGACCCCAGGAAGGAGG - Intergenic
1077338059 11:2014222-2014244 GGGCTGGGAGGCCCAGAAGGAGG - Intergenic
1077604632 11:3600555-3600577 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1077945459 11:6892443-6892465 CATCAGAGAGTCCCAGAAGGAGG + Exonic
1078467461 11:11560755-11560777 GGTCTGAGGGCCCAAGAAAATGG - Intronic
1078832218 11:14988572-14988594 CCTCTGAGAGTCCCAGGAGGAGG + Intronic
1079181263 11:18195583-18195605 GGTCTGAGTGCCACTGAAGGAGG - Intronic
1079259589 11:18865438-18865460 GGTCTGAGTGCCGCTGAAAGAGG + Intergenic
1079268387 11:18957967-18957989 GGTCTGAGTGCCACTGAAGCAGG + Intergenic
1080467543 11:32511897-32511919 TGTCTGAGAGCCTGAGAAAGGGG + Intergenic
1082615715 11:55356923-55356945 GCTCTGAGATCCCCTGAAGAGGG + Intergenic
1082666317 11:55980022-55980044 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1083225307 11:61281097-61281119 GGCCCTGGAGCCCCAGAAGGAGG + Exonic
1083680320 11:64348742-64348764 GGCCTGTGTGCCCCAGAGGGAGG - Intronic
1084008825 11:66336605-66336627 GCTCTGAGGGCCCCAGCTGGGGG + Intronic
1084227090 11:67723370-67723392 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1084260529 11:67975143-67975165 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1084812243 11:71620105-71620127 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
1084845215 11:71893499-71893521 CCTCTGAGAGTCCCAGGAGGAGG - Intronic
1085038721 11:73314520-73314542 GGTCTGTGAGGCTCAGAAGGAGG + Intronic
1087081316 11:94173636-94173658 GATCTGAGAGCAACAGATGGGGG - Intronic
1089262353 11:117231968-117231990 GGTCAGGGGGCCCCAGAAGTGGG - Intronic
1089456315 11:118627922-118627944 TGACTGAGAGCACCAGAAGCTGG - Exonic
1089581425 11:119483971-119483993 GGTCCTAGAGCCGCAGGAGGCGG - Intergenic
1090393829 11:126406378-126406400 GGTCGGAGGGACTCAGAAGGGGG + Intronic
1091236747 11:134027105-134027127 GGTCTGAGAGGCCAGGGAGGGGG + Intergenic
1202821043 11_KI270721v1_random:69404-69426 GGGCTGGGAGGCCCAGAAGGAGG - Intergenic
1092058391 12:5525375-5525397 GCTATGTGAGCCCTAGAAGGCGG - Intergenic
1092431789 12:8415691-8415713 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1092434740 12:8438311-8438333 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1092445882 12:8556716-8556738 GGTCTGAGAGCCCCAGGGCTGGG - Intergenic
1092783426 12:12007643-12007665 GCTCACAGAGCCCCAGAAGCTGG - Intergenic
1094212231 12:27904706-27904728 AGTCAGAGAGGCCCAGAAGGAGG - Intergenic
1096243067 12:49969688-49969710 AGTCTGAGAGCCCAGGAAGGAGG + Intronic
1096665044 12:53158791-53158813 GGTGTGCTACCCCCAGAAGGTGG - Intronic
1096967030 12:55636927-55636949 GGTCAGAGAATCCCAGAAGGAGG - Exonic
1101734810 12:107455122-107455144 GGTCAGAGAGCCCAAGCATGTGG + Intronic
1101921605 12:108937603-108937625 GGTCTGAGGGGCCAGGAAGGAGG - Intronic
1102026954 12:109719091-109719113 GGTCAGAGAGACCCAGATGGTGG - Intronic
1102236409 12:111296988-111297010 GGCCTGAGAGGGCCAGAGGGTGG - Intronic
1104071576 12:125350289-125350311 GGTCAGAGAGACCAAAAAGGTGG - Exonic
1104163953 12:126207905-126207927 GGTCTAAAAGACCTAGAAGGAGG + Intergenic
1104421073 12:128635925-128635947 ATTCGGAGAGCCCCAGAAGTCGG + Intronic
1104717253 12:131024256-131024278 GGTCAGAGAGGCCCACATGGAGG + Intronic
1104838904 12:131810941-131810963 GGACTGAGAGCCCGAGCGGGTGG + Intergenic
1107991264 13:45820761-45820783 GTTCTGAGGGCCCCAGAACCTGG - Intronic
1108629618 13:52268953-52268975 GGTCTGAGTTCCCCGGGAGGTGG - Intergenic
1108656440 13:52537535-52537557 GGTCTGAGTTCCCCGGGAGGTGG + Intergenic
1109839330 13:67902291-67902313 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
1111180150 13:84653415-84653437 GGTCAGAGAACCCCAGTAAGAGG + Intergenic
1113484639 13:110645257-110645279 GGTTTCAGAGCACCAGCAGGTGG - Intronic
1114484528 14:23055005-23055027 GGTGAGAGAGCTCCAGAAGACGG + Intronic
1114652043 14:24291379-24291401 GGTCTGAGAGCCTTAGGAGCAGG - Intronic
1115641778 14:35339845-35339867 GGGCTGAGAGCCCTGGAAGCTGG - Intergenic
1116902852 14:50378257-50378279 GGTCCGTGGGCCCTAGAAGGAGG - Intronic
1117039531 14:51757052-51757074 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
1117823599 14:59677123-59677145 GGTCAGAAAGCATCAGAAGGAGG - Intronic
1118059143 14:62116777-62116799 GGGAGGAGAGTCCCAGAAGGCGG + Intergenic
1118259732 14:64235730-64235752 GCTCAGAGAGCTCCAGATGGTGG - Intronic
1118312297 14:64703207-64703229 GGTCTGGCAGGCCCAGAAAGCGG - Intergenic
1119537002 14:75410640-75410662 GCTCTCAGAGCCACAGAAGCTGG - Intergenic
1121695676 14:95909949-95909971 GGGGTTAGAGCCCCAGCAGGCGG + Intergenic
1122088093 14:99320778-99320800 GCTATCAGAGCCCCAGGAGGGGG + Intergenic
1122405300 14:101497142-101497164 GGTCTGATGGCCCCTGAATGTGG - Intergenic
1124240122 15:28021553-28021575 CCTCTGAGAGCCACAGATGGAGG + Intronic
1124559085 15:30755554-30755576 AGTCTGAGGTCCCCAGAGGGTGG - Intronic
1124672174 15:31650171-31650193 AGTCTGAGGTCCCCAGAGGGTGG + Intronic
1126425621 15:48524253-48524275 GGTCTGAGAGTCTCAGAATGTGG + Intronic
1127144234 15:56008199-56008221 GCTCTCAGGGCCTCAGAAGGGGG + Intergenic
1127977888 15:64011926-64011948 GGGCTGAGGGCCCAAGAAGAGGG - Intronic
1128635936 15:69302468-69302490 GGTCTGAGAGCCCCTGTAGTTGG + Intronic
1128845811 15:70893143-70893165 GATCTGGGCTCCCCAGAAGGTGG + Intronic
1129063602 15:72881560-72881582 GGTCTAAGAGTCCCAGAAAAAGG - Intergenic
1129194361 15:73955346-73955368 GGTCTGTGCAGCCCAGAAGGAGG - Intergenic
1129842412 15:78751869-78751891 GGGCTGCCAGCCCCAGCAGGTGG - Intergenic
1131569729 15:93522536-93522558 GCTCTGAGAGTCCCAGGAGGTGG - Intergenic
1132299108 15:100765576-100765598 GGCCTGAGAGCTCCAGAAGGTGG - Intergenic
1132398359 15:101489928-101489950 GTCCCGAGAGCCCCAGAAGTCGG - Intronic
1132814043 16:1817531-1817553 GGTCTCAGAGCCACAGTTGGTGG - Intronic
1132823558 16:1890605-1890627 GGTCTGTGAGCAGCAGAAAGCGG - Intergenic
1134092355 16:11398356-11398378 GGTCACAGAGCCCCAGGTGGAGG + Exonic
1134108397 16:11499646-11499668 GATCTGAGAGCCCCTGGAGCTGG - Intronic
1135471884 16:22738420-22738442 GGTCCAAGAGCCCCAGAACAAGG - Intergenic
1136560292 16:31034968-31034990 AGCCATAGAGCCCCAGAAGGAGG + Exonic
1136630804 16:31488321-31488343 GGTCTGGGAATCCCAGGAGGTGG - Intronic
1137427564 16:48392390-48392412 GGTCAGAGAGACCCAGAAAGGGG + Intronic
1137617597 16:49856632-49856654 GATCCGAGAGCCAGAGAAGGGGG - Intronic
1137802119 16:51271043-51271065 CATCTGGGAGCCCCAAAAGGGGG + Intergenic
1142312538 16:89322494-89322516 GGCCTCAGAGGCCCAGGAGGAGG + Intronic
1142808922 17:2386298-2386320 GGTCAGAGAGCCCCAGGCTGAGG + Exonic
1142917633 17:3154783-3154805 GGTCTGAGAGTCCCCAGAGGAGG + Intergenic
1143023668 17:3929155-3929177 GGTCTGGGAGCTCCTGAAGGTGG + Intronic
1143405021 17:6671561-6671583 GGTCTGAAAGAGCCAGAAAGTGG + Intergenic
1143780549 17:9226570-9226592 GGACTGAGTGCCCCAGGAGAGGG - Intronic
1146625239 17:34430377-34430399 GGCATGAGACGCCCAGAAGGTGG + Intergenic
1146912960 17:36659846-36659868 GGTCTGAGGGTCCCAGAGGAGGG + Intergenic
1147169457 17:38609466-38609488 GTTCAGAAAGCCCCAGAAGCAGG - Intergenic
1148160300 17:45445962-45445984 GATCTGTGAGGCCCAGAGGGAGG - Intronic
1149547372 17:57513697-57513719 GGTTTGAGAGCCCGGGAGGGGGG - Intronic
1150391592 17:64792841-64792863 GATCTGTGAGGCCCAGAGGGAGG - Intergenic
1150410413 17:64936979-64937001 GATCTGTGAGGCCCAGAGGGAGG - Intergenic
1152280390 17:79381826-79381848 GACTTGAGAGCCCCAGGAGGAGG + Intronic
1152361157 17:79833778-79833800 GGTCTGACAGCCGCCGCAGGGGG + Exonic
1156144291 18:34157700-34157722 GGTCAGAGAGCACAAGAAGATGG + Intronic
1157565565 18:48676943-48676965 GGCCTGGCAGCCCCAGCAGGTGG + Intronic
1158506033 18:58045963-58045985 GGTAGGAGAGCCGCAGAAAGCGG - Intronic
1158734220 18:60061591-60061613 AGTCAGTGAGCACCAGAAGGAGG + Intergenic
1159129143 18:64260068-64260090 GGTCTCAAGGCCCCAGAGGGTGG + Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1162229136 19:9251133-9251155 CCTCTGAGAGTCCCAGGAGGAGG - Exonic
1163162642 19:15474585-15474607 GGTCTGAGAGCCCTGGACGAAGG + Intronic
1163468602 19:17484034-17484056 GGACTGTGAACCCCAGAGGGTGG + Intronic
1163520567 19:17789187-17789209 GCTTTGGGAGCCCCAGGAGGAGG + Intergenic
1165008125 19:32823175-32823197 GTGCTGAGAGCCCCAGAGGGTGG + Intronic
1165901017 19:39169395-39169417 GGGCAGGGAGACCCAGAAGGAGG + Intronic
1166843685 19:45713395-45713417 GGCTTGAGGGCCGCAGAAGGCGG + Exonic
1166863226 19:45821545-45821567 GGTCTGAGTTCCCCAGATCGGGG + Intronic
1167041697 19:47026580-47026602 GGTGTGAGAGACACAGAGGGCGG + Intronic
1167464220 19:49641778-49641800 ATTCTGAGAGCCCCAGAATGTGG + Intergenic
1167623169 19:50569705-50569727 GGGCGGAGAAACCCAGAAGGAGG + Intergenic
1202678953 1_KI270711v1_random:33722-33744 TGTCAGAGAGCGCAAGAAGGGGG - Intergenic
925293304 2:2762599-2762621 GGTCCAAGAGCCCCAGGAGGAGG + Intergenic
926735862 2:16072881-16072903 GCTCTGAGACACGCAGAAGGGGG + Intergenic
926811202 2:16756744-16756766 GGTCAGAGAATTCCAGAAGGCGG + Intergenic
926933621 2:18065077-18065099 AATCTGAGACCCACAGAAGGAGG + Intronic
927132395 2:20071611-20071633 GGGCTGTGAGAGCCAGAAGGGGG + Intergenic
927633649 2:24795549-24795571 GGTTTGAGAGCCTGAGAAGAGGG + Intronic
927812898 2:26189994-26190016 GGTCTGAGAGAGCCTGAAGCCGG - Intergenic
928441278 2:31294280-31294302 TGCCTGAGAGCAACAGAAGGAGG - Intergenic
930245578 2:48980104-48980126 GATCTGAAAGCCCCAGAAAGGGG + Intronic
930263687 2:49175858-49175880 GGTCTGAGAGACCCAAGAGTTGG + Intergenic
932350682 2:71028964-71028986 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
932354176 2:71055227-71055249 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
933700375 2:85251037-85251059 GGCCTGAGGCCACCAGAAGGTGG + Intronic
934590577 2:95546622-95546644 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
934847522 2:97671818-97671840 GGGCTGAGAACCCCTGGAGGAGG - Intergenic
935589933 2:104836741-104836763 GGTCTAAGAGCCTCACAAGTGGG + Intergenic
935795662 2:106639085-106639107 TCTCAGAGAGCCGCAGAAGGTGG + Intergenic
936156336 2:110049742-110049764 GGTCAGAGAAACCCAGAAAGGGG + Intergenic
936188353 2:110321700-110321722 GGTCAGAGAAACCCAGAAAGGGG - Intergenic
936840563 2:116763569-116763591 GGTTTCAGAGCCACAGAAGATGG - Intergenic
936985615 2:118309396-118309418 GGTCGGAGATCAACAGAAGGGGG - Intergenic
937554910 2:123142016-123142038 TGTGGGAGAGCCCCAGTAGGAGG + Intergenic
940870207 2:158853642-158853664 CCTCTGAGAGTCCCAGGAGGAGG - Intronic
940872919 2:158874731-158874753 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
941635446 2:167930791-167930813 GCTGTGAGAGCCCCAGGAAGGGG + Intergenic
945005670 2:205402941-205402963 GGGCTGAGAGCCACGGATGGTGG + Intronic
947348665 2:229220323-229220345 GGTGAGAGAGCCCCAGATGGAGG + Intronic
947567176 2:231201613-231201635 GGTCTGAGACCTGCTGAAGGAGG - Intronic
948519198 2:238524793-238524815 GGTGTGTGAACCCCAGAAGCTGG + Intergenic
948780767 2:240320281-240320303 CGTCTGAGGGCCCCAGCGGGAGG + Intergenic
1169066045 20:2694454-2694476 GGTCTGGGAGTCTCAGTAGGGGG + Intronic
1169767511 20:9163385-9163407 TCTCTTAGAGCCCCAGCAGGTGG + Intronic
1169769126 20:9182310-9182332 ACTGTGAGAGCCCCAGAAGCAGG - Intronic
1169970753 20:11267335-11267357 GGGCAGAGTGCCCCCGAAGGAGG - Intergenic
1170534506 20:17326773-17326795 TGTCTCAGAGTCCCAGAAGAGGG - Intronic
1170897223 20:20426519-20426541 GGGCTGAGAACCCCACAAGGTGG + Intronic
1173150892 20:40565791-40565813 GCTCTGACAGCCCCACAAGGTGG - Intergenic
1174094659 20:48078741-48078763 GGTCCTGGAGCCCCAGCAGGTGG - Intergenic
1174130679 20:48341609-48341631 TGGCTGAGACCCCCAGGAGGGGG - Intergenic
1174396779 20:50251445-50251467 GGCCTCAGAGCCCCAGAGCGTGG - Intergenic
1175174919 20:57105683-57105705 GATCTGAGAGCCCCTGATTGTGG - Intergenic
1175187522 20:57189019-57189041 GGTCAAAGCTCCCCAGAAGGGGG + Intronic
1175497661 20:59425938-59425960 GTTCTGAGGGCCCCAGGTGGTGG + Intergenic
1176017853 20:62945812-62945834 GGACGCAGAGCCCCAGCAGGTGG + Exonic
1180996579 22:19968749-19968771 GGTGAGAGAGCCCGAGAGGGGGG - Exonic
1181086147 22:20440320-20440342 GGTCTGAGACCCACAGAGTGGGG + Intronic
1181465876 22:23110388-23110410 GGTGGGAGGGCCCCAGAACGTGG - Intronic
1181551581 22:23641958-23641980 GGTTTTAGAGTCTCAGAAGGTGG - Intergenic
1182240753 22:28914205-28914227 GGCCTAAGAGTCACAGAAGGTGG - Intronic
1182959994 22:34462991-34463013 GGTCTCAGAGCACCAGTGGGGGG - Intergenic
1183265790 22:36824264-36824286 GGGCTGAGGGCGCAAGAAGGAGG + Intergenic
1183978272 22:41525566-41525588 TGGCTGAGGGCCCCAGACGGAGG - Intronic
1184108713 22:42383208-42383230 GGTCAGAGAGGCCCAGGAGGTGG + Exonic
1184514836 22:44955604-44955626 GGCCTGAGAGCAGGAGAAGGAGG - Intronic
1184927103 22:47650619-47650641 TGTCTGGCTGCCCCAGAAGGTGG + Intergenic
1185179390 22:49350338-49350360 GGTGTGAGAGCCCAGGGAGGAGG + Intergenic
1185344654 22:50306011-50306033 GGGTTGAGGGCCCCAGGAGGAGG - Intronic
949158122 3:851223-851245 AGTGTGAAAGCCCCAAAAGGTGG + Intergenic
949895852 3:8767236-8767258 GGGCTGGGAGACCCAGGAGGAGG - Intronic
950532508 3:13560466-13560488 GGTGTGAGACCCCAAGGAGGAGG - Intronic
950697797 3:14716916-14716938 GGTCTGAGAGCCCCAGTCTAGGG + Intronic
952955659 3:38555781-38555803 CCTCTGAGAACCCCAGAATGAGG - Intronic
953030418 3:39176293-39176315 AATCTGAGAGCCCAGGAAGGAGG - Intergenic
953198207 3:40753859-40753881 GGACTGTGAGCCTCAGAAGCGGG - Intergenic
953223780 3:40998364-40998386 GGACGGAGAGCCTCAGCAGGTGG - Intergenic
953378983 3:42452261-42452283 GGTGTGTGACCCCCAGGAGGTGG - Intergenic
954316782 3:49805791-49805813 GGTGTGAGGGGCCCAGAATGGGG + Intronic
954334069 3:49905980-49906002 GGTCTGTGAGACCCAGGAGAGGG - Intronic
954363260 3:50133529-50133551 AGACTGAGAGCTCCAGCAGGGGG - Intergenic
954447024 3:50552317-50552339 GGACTGAGAGCCCTGTAAGGTGG - Intergenic
954556304 3:51520136-51520158 GGGCTGAGAGTCCCAGAGGAGGG - Intergenic
954839275 3:53496085-53496107 GGTCTGAAAGCCTGAGAAGAGGG - Intronic
956778417 3:72585892-72585914 GGTCTGAGGACCCCAGAAACTGG + Intergenic
956876803 3:73471697-73471719 GGACTGAGAGGCCAAGAAGCAGG - Intronic
957075481 3:75599562-75599584 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
959531626 3:107440285-107440307 GGTCTGAGGGTCCCAGAGTGAGG + Intergenic
960342194 3:116487115-116487137 GGCTTGATAGCCCCAGCAGGGGG - Intronic
961272958 3:125703410-125703432 CCTCTGAGAGTCCCAGAAGGAGG - Intergenic
961275706 3:125724572-125724594 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
961278621 3:125747167-125747189 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
961402723 3:126658356-126658378 GGGCTGCGAGCCCCAGAGGCAGG + Intergenic
961455725 3:127023007-127023029 GGCCTGACAGCCTCAGAAGGAGG - Intronic
961875781 3:130022466-130022488 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
962876958 3:139542409-139542431 GATCTTAAAGCCCCAGAAGAGGG - Intergenic
963452749 3:145505527-145505549 GGTCTTGGAGCTCCTGAAGGAGG - Intergenic
964927224 3:161974528-161974550 GGTCTGAGCTCCCCAAAGGGTGG + Intergenic
967336491 3:188350111-188350133 GGTCTGAGAGCCACAGTTCGTGG - Intronic
967523328 3:190462100-190462122 GGCCTGAGAGCCTGGGAAGGAGG + Intergenic
968988140 4:3890213-3890235 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
969730048 4:8949681-8949703 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
969734914 4:8981486-8981508 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
969786215 4:9459311-9459333 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
969794132 4:9512961-9512983 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
969840709 4:9879607-9879629 GGTCTGAGCACCCCAGAAGATGG - Intronic
969972291 4:11060367-11060389 GTTGTGAGAGCCAGAGAAGGTGG + Intergenic
975050566 4:69858974-69858996 GGTCTGAGAGGCAAAGTAGGTGG + Intronic
977722360 4:100254445-100254467 GGTCTGACACCTGCAGAAGGAGG + Intergenic
979594242 4:122515759-122515781 GGTGGGAGAGCTCCAGAATGAGG - Intergenic
985713212 5:1441927-1441949 CCTCTGAGGGCCCCAGAAGCTGG - Intronic
986619691 5:9659494-9659516 GGTTTGAGAGCCCCTGGAGATGG + Intronic
986744224 5:10730398-10730420 GGACTGAGAGCCCCGGTGGGGGG + Intronic
987132670 5:14872579-14872601 GGTCTGAGCGCCCCAGAAGGCGG - Intergenic
987780486 5:22427673-22427695 GGTCTGATATCCCTAGAATGTGG + Intronic
996759879 5:126976490-126976512 GGGCTGAGTGCCCCAGTAGAGGG - Intronic
997294127 5:132759426-132759448 GGTCTGAGGGCCAGTGAAGGTGG - Intronic
997735501 5:136209773-136209795 AGTCTGAGAGCCCCAGAGGCCGG - Intergenic
998332896 5:141345294-141345316 AGTCTGAGAGCCTCAGATGGGGG + Exonic
998762589 5:145449127-145449149 GTTCTGAAAGCCCCAGAGGAAGG + Intergenic
999144819 5:149385511-149385533 GGCCTGACAGCCCCACATGGGGG - Intronic
999267059 5:150273321-150273343 GGCCAGAGAGACCCAGAAGATGG + Intronic
1000973860 5:167743318-167743340 GGACTGAGGGCCTTAGAAGGAGG + Intronic
1002006521 5:176238748-176238770 GGCCCGAGAGGCCCGGAAGGAGG - Intronic
1002219857 5:177671888-177671910 GGCCCGAGAGGCCCGGAAGGAGG + Intergenic
1004185621 6:13419009-13419031 AGTTTGGGAGCCCCAGCAGGTGG + Intronic
1004950301 6:20662758-20662780 GATCTGACAGACACAGAAGGTGG - Intronic
1005226868 6:23653375-23653397 GCTCTGAGAGTCACTGAAGGCGG + Intergenic
1005804489 6:29461799-29461821 GTTCAGAGAAGCCCAGAAGGAGG - Exonic
1005819719 6:29587974-29587996 GTTCAGAGAAGCCCAGAAGGAGG - Exonic
1006009073 6:31027254-31027276 GGTCTCAGAGCCCATGATGGAGG - Exonic
1006030468 6:31173506-31173528 GCCCTGAGCACCCCAGAAGGGGG - Intronic
1007259938 6:40556299-40556321 GGTGTCAGAGCCCCAGAAAAGGG - Intronic
1012389661 6:98723265-98723287 GGTCTGGCAGCCCCTGAAAGAGG - Intergenic
1012870553 6:104668149-104668171 GGTCTGAGAGCCCCTGGTGTAGG - Intergenic
1014186676 6:118442763-118442785 GGTGAGAGAGACCCAGAGGGAGG - Intergenic
1015107420 6:129553222-129553244 GATCTGAAGTCCCCAGAAGGAGG - Intergenic
1015456790 6:133435491-133435513 GGACAGATAGTCCCAGAAGGAGG - Intronic
1016935983 6:149449975-149449997 TGTGTGAAGGCCCCAGAAGGTGG + Intronic
1017088470 6:150736919-150736941 GGAAGGAGAGGCCCAGAAGGGGG + Intronic
1019184657 6:170214081-170214103 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019184675 6:170214187-170214209 GTACTGAGAGATCCAGAAGGCGG + Intergenic
1019184685 6:170214240-170214262 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019184707 6:170214343-170214365 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019184729 6:170214447-170214469 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019184803 6:170214814-170214836 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019184814 6:170214867-170214889 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019184826 6:170214918-170214940 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019184855 6:170215075-170215097 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019184864 6:170215127-170215149 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019184884 6:170215232-170215254 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019184913 6:170215389-170215411 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019184924 6:170215442-170215464 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019184977 6:170215699-170215721 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019184988 6:170215752-170215774 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185010 6:170215856-170215878 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185047 6:170216011-170216033 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185058 6:170216064-170216086 CTACTGAGAGACCCAGAAGGCGG + Intergenic
1019185070 6:170216117-170216139 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185093 6:170216221-170216243 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185105 6:170216272-170216294 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185117 6:170216325-170216347 GTACTGAGAGACCCGGAAGGTGG + Intergenic
1019185160 6:170216530-170216552 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185193 6:170216683-170216705 GTACTGAGAGACCCAGAAGGCGG + Intergenic
1019185205 6:170216736-170216758 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185229 6:170216840-170216862 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185271 6:170217050-170217072 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185283 6:170217101-170217123 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185348 6:170217415-170217437 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185359 6:170217468-170217490 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185381 6:170217572-170217594 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185418 6:170217727-170217749 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185429 6:170217780-170217802 CTACTGAGAGACCCAGAAGGCGG + Intergenic
1019185441 6:170217833-170217855 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185484 6:170218038-170218060 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185517 6:170218191-170218213 GTACTGAGAGACCCAGAAGGCGG + Intergenic
1019185529 6:170218244-170218266 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185553 6:170218348-170218370 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185596 6:170218558-170218580 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185608 6:170218609-170218631 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185674 6:170218923-170218945 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185685 6:170218976-170218998 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185697 6:170219027-170219049 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185726 6:170219184-170219206 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185736 6:170219236-170219258 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185746 6:170219288-170219310 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185794 6:170219550-170219572 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185804 6:170219602-170219624 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185815 6:170219655-170219677 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185844 6:170219812-170219834 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185855 6:170219865-170219887 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185874 6:170219970-170219992 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185885 6:170220023-170220045 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185896 6:170220076-170220098 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185907 6:170220129-170220151 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185936 6:170220287-170220309 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185957 6:170220393-170220415 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185986 6:170220550-170220572 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019185997 6:170220603-170220625 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1019186026 6:170220757-170220779 GTACTGAGAGACCCGGAAGGCGG + Intergenic
1020310873 7:6867565-6867587 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1021900394 7:25279459-25279481 GGTCTGAAAGCCTCAGAACCAGG - Intergenic
1023723909 7:43122453-43122475 GGACTCAGAGACCCAGAAAGGGG + Intronic
1023886382 7:44360215-44360237 GGTTTGATAGCCCCAGCAGCAGG + Intergenic
1024259494 7:47563217-47563239 GGTTTGAGAGTCCTTGAAGGGGG - Intronic
1024382086 7:48708641-48708663 GGTCTGAGAGACAAACAAGGAGG - Intergenic
1024435737 7:49352932-49352954 GATCTAAGAGGCCCAGAAGCAGG + Intergenic
1025901936 7:65751506-65751528 TGTCTGGAAGCCCAAGAAGGCGG - Intergenic
1026982145 7:74533068-74533090 GGTCTGAGAGTCTGAGAGGGCGG - Intronic
1027268205 7:76505373-76505395 GGTCCTAGAGCTCCTGAAGGTGG + Exonic
1029077578 7:97947875-97947897 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1031199913 7:118668917-118668939 AGTCTGACAGCCTGAGAAGGGGG - Intergenic
1032083869 7:128873509-128873531 GGGCTGAGAGCCCCAGCCGCTGG - Intronic
1032186848 7:129734058-129734080 GGTCAGAGAGCTCCACAAGTGGG - Intronic
1032193567 7:129777855-129777877 GGGCTGAGAGCGACCGAAGGTGG - Intergenic
1033228878 7:139581527-139581549 AGACTGAGAGCCACAGGAGGGGG + Intronic
1033601826 7:142894075-142894097 GGACAGAGAGACCCAGAAGCAGG + Intergenic
1035074085 7:156166896-156166918 GGTATGAGAGCCAGGGAAGGAGG - Intergenic
1035270782 7:157718846-157718868 GGTCTGAGGGCCCCAGAGGTCGG - Intronic
1035271077 7:157720344-157720366 GGTCTGAGGGCCCCAGAGGTCGG - Intronic
1035828301 8:2668222-2668244 GGCCTGATGGCACCAGAAGGCGG + Intergenic
1036261847 8:7247529-7247551 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1036304746 8:7592023-7592045 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
1036313887 8:7706074-7706096 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1036355595 8:8040015-8040037 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
1036780819 8:11645979-11646001 TGTGTGGGAGCCCCAGGAGGAGG + Intergenic
1036832746 8:12034528-12034550 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1036902921 8:12685051-12685073 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1040772434 8:50993735-50993757 AGTGTGAGAGTCTCAGAAGGAGG - Intergenic
1048957368 8:139548064-139548086 GGTATGGAAGCCCCACAAGGTGG - Intergenic
1049218804 8:141419541-141419563 GGGGTGGGACCCCCAGAAGGAGG - Intronic
1049472256 8:142781744-142781766 GTCCTGAGTGCCCCTGAAGGAGG - Intergenic
1053123021 9:35560331-35560353 GGTGTGGGTGCCTCAGAAGGTGG + Exonic
1053183234 9:35992225-35992247 GGGCAGAGAGCCCCAGGAGAAGG + Intergenic
1056762969 9:89427891-89427913 GGTCTGAGAGCTCCAGGAGGGGG + Intronic
1056866550 9:90232190-90232212 CCTCTGAGAGTCCCAGGAGGAGG - Intergenic
1056916609 9:90752126-90752148 CCTCTGAGAGTCCCAGGAGGAGG + Intergenic
1057799587 9:98182131-98182153 GGTCTGTGAGCCCTCAAAGGCGG + Intronic
1058072151 9:100612227-100612249 GGTCTAGGAACCCCAGGAGGTGG - Intergenic
1058895455 9:109397030-109397052 AGGCTGAGAACCCAAGAAGGGGG + Intronic
1058903198 9:109459791-109459813 TGTCTGAGAATCCCAGCAGGAGG - Intronic
1059376037 9:113882422-113882444 GGTCTGAGGGCCTGAGTAGGTGG + Intronic
1061113411 9:128591771-128591793 GGTCTGAGACCCACACAGGGAGG - Intronic
1062500756 9:136851070-136851092 GGTCTGGGGGCCCCCGGAGGTGG - Intronic
1062568370 9:137173162-137173184 GGTCGGAGGACCCCAGCAGGAGG - Intergenic
1186365721 X:8891183-8891205 GGTCTGAAAGCCTAAGAAGAAGG - Intergenic
1186516800 X:10172332-10172354 GTTTTGAGACCCACAGAAGGTGG - Intronic
1188907855 X:35809623-35809645 GGACTGTGAGACCCAGCAGGTGG - Intergenic
1189716452 X:43871439-43871461 GGCCTCAGAGGCCCTGAAGGAGG - Intronic
1190897981 X:54639900-54639922 GGATGGAGGGCCCCAGAAGGAGG + Intergenic
1192179634 X:68908436-68908458 GGTCTGTGAGCCCCAGACATGGG - Intergenic
1192624671 X:72714762-72714784 GAGCTGGCAGCCCCAGAAGGCGG + Intergenic
1194539766 X:95156207-95156229 GGACTGAGAGCCCCAGTGGAGGG - Intergenic
1195208332 X:102625892-102625914 GGCCTAAGAGCCCTAGTAGGGGG + Intergenic
1196032312 X:111103781-111103803 AGTCTGACAGGCCCAGAAGCAGG - Intronic
1199987861 X:152965218-152965240 GGACTGAGGGCCCCAGAAAGGGG - Intronic