ID: 915610256

View in Genome Browser
Species Human (GRCh38)
Location 1:156986248-156986270
Sequence TCAAAAGGGGCCCTGAGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915610252_915610256 0 Left 915610252 1:156986225-156986247 CCTTGTAGTAGATGGAGGCTCTG 0: 1
1: 0
2: 1
3: 14
4: 123
Right 915610256 1:156986248-156986270 TCAAAAGGGGCCCTGAGTCTTGG 0: 1
1: 0
2: 1
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915610256 Original CRISPR TCAAAAGGGGCCCTGAGTCT TGG Intronic
902837182 1:19054630-19054652 ACAGAAGGGGAACTGAGTCTTGG + Intergenic
903029331 1:20451757-20451779 TCAACCTGGGCGCTGAGTCTGGG + Intergenic
904454603 1:30639924-30639946 TCAAAAGGGCCCCTGAGACAAGG + Intergenic
904880708 1:33694770-33694792 TAAAAATGGTCCCTGAGTGTAGG + Intronic
906076954 1:43058837-43058859 TCCAAAGGGCCCCTAAGCCTGGG - Intergenic
906167458 1:43697469-43697491 TCAATAGGTGCCCTGAGGCCTGG - Intronic
907060258 1:51415305-51415327 TGAAAAAGGGCAGTGAGTCTGGG - Intronic
907939645 1:59075201-59075223 TCAAAAGAGGCCCTAACACTGGG + Intergenic
908949567 1:69543814-69543836 TGTAAAGGGGCCTTGAGGCTGGG + Intergenic
909389533 1:75103990-75104012 TCAAAAAAGTCCCTGAGGCTGGG + Intergenic
909675624 1:78236217-78236239 TCCACAGGTGCACTGAGTCTTGG - Intergenic
915610256 1:156986248-156986270 TCAAAAGGGGCCCTGAGTCTTGG + Intronic
916378251 1:164179797-164179819 TGAAAGGGGGCCGTGAGCCTGGG - Intergenic
923653109 1:235892204-235892226 TCAACAGTGGGCCTAAGTCTGGG - Intergenic
1068041840 10:51834866-51834888 GGAAAAGGGTCACTGAGTCTTGG + Intronic
1069664456 10:70145557-70145579 CCCACAGGGGCCCGGAGTCTCGG + Exonic
1072387734 10:94948861-94948883 TAAAAAGGAGGTCTGAGTCTAGG + Intronic
1073602715 10:104862332-104862354 TCAAGAGTGGCCCAGAGTGTGGG + Intronic
1074900290 10:117810593-117810615 GCAAAAAGAGTCCTGAGTCTAGG + Intergenic
1083181510 11:60988826-60988848 TCAGGAGGGGCCCTGGTTCTAGG - Intronic
1083743918 11:64724800-64724822 TCAGAGTGGGCCCTAAGTCTGGG - Intergenic
1084531862 11:69732191-69732213 TCAAGAGGGGCCCCCAGTCCTGG + Intergenic
1085450755 11:76630675-76630697 ACAAGAGTGGCCCTGAGTCGGGG - Intergenic
1091208358 11:133835772-133835794 TCAACTTGGGTCCTGAGTCTGGG - Intergenic
1096810096 12:54163925-54163947 TCACAGTGGGCCCTGAATCTAGG + Intergenic
1099334300 12:81333958-81333980 TCAAAATGGGGCCTGAGTGCTGG - Intronic
1103598723 12:122040620-122040642 TCAACAGGGCACCTGTGTCTGGG - Intronic
1104724093 12:131065604-131065626 TCAAAAGGGACCCAGAGCCTGGG - Intronic
1104802884 12:131566703-131566725 TCAAAAGGGACCCAGAGCCTGGG + Intergenic
1106378467 13:29212725-29212747 TCCAGAGGGGTCCTGAGTGTGGG + Intronic
1109224103 13:59671558-59671580 TCAACAGTGGCCCTGAATATTGG - Intronic
1109842346 13:67935747-67935769 TTCAAAGGGGCCCTAAGGCTGGG - Intergenic
1110819689 13:79900171-79900193 AGAAAGGGGGCCCTGAGTCAAGG + Intergenic
1111496406 13:89056205-89056227 AAAAAATGGGACCTGAGTCTTGG - Intergenic
1115154460 14:30322114-30322136 CCAAAACAGGCCCTGAGTTTGGG - Intergenic
1115310448 14:31973925-31973947 TCTCAGGGGTCCCTGAGTCTGGG - Intergenic
1117730096 14:58713538-58713560 ACTAAAAGGGCCCTGAGTCCTGG + Intergenic
1118432326 14:65731788-65731810 TCAAAAGGGTACCTAAGGCTGGG - Intronic
1119395963 14:74326658-74326680 ACAAAAGGCGCCCTGAGTCTGGG + Intronic
1120212468 14:81647049-81647071 TGAAAAGTGGCCCTGTGACTAGG + Intergenic
1125686369 15:41565833-41565855 CCAGAAGGGGCCCTAAGCCTTGG + Intronic
1126804753 15:52336423-52336445 TCAAGACGGTCACTGAGTCTTGG - Intronic
1130647288 15:85740375-85740397 ATAAATGGGGCCCTCAGTCTAGG + Intronic
1130907187 15:88249127-88249149 TCATAAGTGTCCCAGAGTCTGGG - Intronic
1132548984 16:546619-546641 GCAAGAGGGGCCCTGAGCCATGG + Intronic
1133418863 16:5628402-5628424 TCAAAAGGAGCTCTGAGTTTTGG + Intergenic
1137264866 16:46860332-46860354 TATAAATGGGCCCTGAGACTGGG + Intergenic
1137289763 16:47043995-47044017 TGAAAAGGAGCCCTGAGCTTAGG - Intergenic
1139113606 16:63922191-63922213 TCAAAAGGTCTCCTGAGTCATGG - Intergenic
1144055512 17:11537219-11537241 TCCAAGGGGACCCTGAGTCAGGG + Intronic
1145714893 17:27010077-27010099 TGAAGAGGAGTCCTGAGTCTGGG + Intergenic
1146278108 17:31528260-31528282 TTAGACGGAGCCCTGAGTCTTGG - Intronic
1147053385 17:37815096-37815118 ACAAAGGGGTCCCTGAGTATAGG - Intergenic
1147272438 17:39284677-39284699 TAAAAAGGGTCCCTGAGGCCAGG - Intronic
1149354937 17:55829870-55829892 TAAAAAAGGGCCATGAGTCATGG + Intronic
1149384370 17:56127031-56127053 TTAAAAGGGGCACTGAAGCTAGG + Intronic
1153195337 18:2589619-2589641 TCACAAGAAGCCCTGAGTTTTGG + Intronic
1154999158 18:21669871-21669893 TCAAAAGGGGCCCTGAAGCAAGG + Intronic
1155043194 18:22082282-22082304 ACAAAAGGGGCCCAGTGGCTGGG - Intergenic
1159976812 18:74723594-74723616 GCCAAAGGAGCCCTGATTCTGGG - Intronic
1165062496 19:33211679-33211701 ACAACAGGGTCCCTGTGTCTCGG - Intronic
1165361621 19:35340573-35340595 TCAAATGGGGTCCTGAGGCCGGG - Intronic
926114649 2:10204768-10204790 GGAAAAGGGACCCTGAGGCTTGG - Intronic
929448986 2:42024116-42024138 TAAAAAGGAACCCTGAGGCTGGG + Intergenic
929829658 2:45336534-45336556 TCAAAGGCTGCCCTGAGGCTTGG - Intergenic
931038934 2:58275338-58275360 TCAAGAAGGGACCTGAGTCATGG + Intergenic
933700430 2:85251539-85251561 TCAAGCGGGGCCCAGAGACTTGG - Intronic
937299473 2:120830349-120830371 ACATAGGGGGCCCTCAGTCTAGG + Intronic
937904179 2:127044800-127044822 CCAGAAAGGGCCCTGAGACTAGG - Intergenic
938103194 2:128512269-128512291 TCAGAAGGGGGCCTGAGGCCTGG - Intergenic
944682785 2:202092088-202092110 TCAAGAGGGGCCTTCATTCTGGG - Intronic
948215732 2:236228945-236228967 TCAAAAGTGACCCAGAGGCTGGG + Intronic
949049467 2:241889415-241889437 TCAAAAGTGGCCCTAAGTATGGG + Intergenic
1169184741 20:3604914-3604936 TAAAATGGGGCCATGGGTCTCGG - Intronic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1172008687 20:31834052-31834074 TCAACGGGGGCCTGGAGTCTGGG - Exonic
1173710796 20:45153860-45153882 TCAGAAGGGGAGCTGAGACTGGG - Intergenic
1174146761 20:48457457-48457479 TCAGAGGAGGCCCAGAGTCTTGG - Intergenic
1176046781 20:63097003-63097025 CCAACAGGGGCCCTGGGCCTGGG - Intergenic
1176244328 20:64090311-64090333 TCACACGTGTCCCTGAGTCTTGG + Intronic
1179553678 21:42159452-42159474 TCTGAAGGGGCCCTGGGTCCTGG + Intergenic
1180929458 22:19579135-19579157 AGAAAAGGGACCCTGAGACTAGG + Intergenic
1182471080 22:30548677-30548699 CCCAAAAGGGCCTTGAGTCTAGG - Intergenic
1182941252 22:34279834-34279856 TCAACATGGGCCCAGAGTCAAGG - Intergenic
1184088026 22:42277428-42277450 ACAATAGGGACCCTGAGCCTTGG + Intronic
1185192391 22:49446996-49447018 CCAACAAGGGCCCTGAGTCAGGG + Intronic
950187733 3:10955795-10955817 TCAGAAGGGTCCCTGGGCCTGGG + Intergenic
950282829 3:11721383-11721405 TCACAAGGGGCCCCAAGTTTCGG - Intergenic
950500230 3:13359025-13359047 TCAAGATGGGCCCTGAGCCATGG - Intronic
953223600 3:40997286-40997308 TCAAAAGCGTCCCTGATGCTGGG - Intergenic
954364235 3:50137843-50137865 TCAGATGGGCGCCTGAGTCTAGG - Intergenic
961611386 3:128142686-128142708 TGGAAAGGGGACCTGAGTCCAGG - Intronic
963086253 3:141439162-141439184 TCTCAAGGAGCCCAGAGTCTAGG - Intronic
964723479 3:159791006-159791028 TCAGAATGTGGCCTGAGTCTGGG + Intronic
965898723 3:173612625-173612647 TTAGAAAGGGCCCTAAGTCTAGG - Intronic
969689241 4:8695062-8695084 TGCAAAAGGGCCCTGAGGCTGGG + Intergenic
971506030 4:27367492-27367514 CTCAAAGGGGCCCTGAGTCAAGG - Intergenic
972575083 4:40344073-40344095 AAAGAAGGGGCCCTGAGTCATGG + Intronic
973286282 4:48420373-48420395 GCAGAAGGGGCACTGGGTCTGGG - Exonic
975265409 4:72359598-72359620 TCAAATGGAGTCCAGAGTCTGGG - Intronic
982803098 4:159728879-159728901 GCAACAGGGGGCATGAGTCTTGG - Intergenic
983123325 4:163916294-163916316 TTAAAAAGGTCCCTGACTCTGGG - Intronic
983354286 4:166636258-166636280 TCGAAATAGGACCTGAGTCTTGG + Intergenic
984227538 4:177053003-177053025 TCATGAGGGGCCCTTATTCTGGG - Intergenic
984810304 4:183790313-183790335 TCAACTGGGGCCATCAGTCTGGG + Intergenic
984837085 4:184032313-184032335 TCAATAGGAGCCCTCTGTCTTGG + Intergenic
985492973 5:190006-190028 TGGAAAGGGGCCGTGTGTCTGGG + Intergenic
986313094 5:6569136-6569158 TCAACAGGGGCCCTGCCTCCTGG + Intergenic
987112616 5:14701503-14701525 TGAAATGGGGTCCTGAGTCCTGG - Intergenic
996876467 5:128245930-128245952 ACAAAAGGGGCCGTGAGCCGAGG - Intergenic
997208793 5:132065931-132065953 TCAAATGGGGGCTTGAGTCCAGG - Intergenic
997983885 5:138488530-138488552 TGATACGGGGCCCTGTGTCTTGG - Intergenic
1001021186 5:168183708-168183730 TCAAAAACGACCCTGAGTCACGG + Intronic
1002432480 5:179211497-179211519 CCAAAAGGGGCCCTGAGCACAGG - Intronic
1005357085 6:24995210-24995232 TCTAAAGGGGTCCTCAGCCTGGG + Intronic
1006213047 6:32413756-32413778 ACAAAAGAAGCCCTGAGTTTAGG + Intergenic
1008501739 6:52190392-52190414 TCCAAAGGAAGCCTGAGTCTAGG - Exonic
1009630121 6:66187036-66187058 TCAATAAGCGCCCTGAGACTGGG + Intergenic
1011166222 6:84449886-84449908 GCAAAAGAGGCCCAAAGTCTAGG + Intergenic
1017277672 6:152588847-152588869 TCAAAAGGTGCCCTTAGTGCTGG - Intronic
1017918276 6:158849798-158849820 TCAACAGGGGCAGTGATTCTAGG - Intergenic
1022179474 7:27904667-27904689 TTAAAAGGGGCTCAGAGTTTCGG - Intronic
1024576148 7:50766204-50766226 TCACAAGGGACCCTGAGTATAGG - Intronic
1024897294 7:54274943-54274965 GCAAGAGGGGCCCTGAGGTTAGG + Intergenic
1027240652 7:76325902-76325924 TCAAAAGGGGCCATAATTCTGGG + Intergenic
1029206437 7:98871767-98871789 TCTAAAGGGCCCCTGGCTCTGGG + Intergenic
1036625411 8:10467250-10467272 TCTGAAGAGGGCCTGAGTCTGGG - Intergenic
1036635977 8:10549683-10549705 TGAAAAGGGGCACTGAGCGTTGG - Intronic
1038695237 8:29800578-29800600 TCATGAGAGGTCCTGAGTCTGGG - Intergenic
1039432142 8:37533262-37533284 GCAGAAGGGGCCATGAGTCAAGG - Intergenic
1045555167 8:103208570-103208592 TCACAAGGGGCCCTGCGCTTAGG + Intronic
1048494283 8:134922332-134922354 AAAAACGGGGCCCTGGGTCTTGG + Intergenic
1049440195 8:142606117-142606139 CCACAAGGGCACCTGAGTCTTGG - Intergenic
1051131518 9:13866345-13866367 TCAACTGGGGCCCTATGTCTGGG - Intergenic
1051518902 9:17961868-17961890 TGAAAAGGAACCCTGATTCTTGG - Intergenic
1053064268 9:35056550-35056572 TCAAAATGGAGCCTGAGTCCTGG - Exonic
1053252774 9:36588672-36588694 TAAAAAGGGACCCTGAGGCAGGG - Intronic
1055494012 9:76836506-76836528 TCATAAATGGCCCTGAGTTTTGG - Intronic
1055814073 9:80185200-80185222 CCAAATGGGCTCCTGAGTCTAGG - Intergenic
1061008133 9:127939923-127939945 TTTAAAGGGGCCATGAGTCGGGG + Intergenic
1061399911 9:130362728-130362750 TCATGAGGGGCTCTGAGTCTGGG + Intronic
1061587815 9:131579841-131579863 ACAAACAGGGCCCTGAGGCTGGG + Intronic
1186953953 X:14659598-14659620 AGAAAGGGGACCCTGAGTCTGGG + Intronic
1188527297 X:31100032-31100054 TCCAAAGATGCCCTGAGCCTGGG + Intronic
1189088747 X:38055051-38055073 CCAAGAGGGGCCCTGAGACAAGG - Intronic
1189483193 X:41408736-41408758 TCAAAAGTGAGCCTGAATCTCGG + Intergenic
1196810588 X:119626057-119626079 GCAGAAGTGGCCCTGAATCTTGG - Intronic
1200378147 X:155806108-155806130 CAAAAAGGGTCCCTGGGTCTGGG - Intergenic
1200408853 Y:2842025-2842047 TCAAAACGGGGCTTGAGTATGGG + Intronic
1200960786 Y:8994031-8994053 CCCAAAGAGGCCCTGAGTTTGGG + Intergenic