ID: 915612637

View in Genome Browser
Species Human (GRCh38)
Location 1:157006836-157006858
Sequence CACTGGGGCCCTTCATCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915612637_915612646 29 Left 915612637 1:157006836-157006858 CCAGAAGATGAAGGGCCCCAGTG 0: 1
1: 0
2: 1
3: 15
4: 168
Right 915612646 1:157006888-157006910 TGTGCCACAGGCCTAGTGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 156
915612637_915612645 28 Left 915612637 1:157006836-157006858 CCAGAAGATGAAGGGCCCCAGTG 0: 1
1: 0
2: 1
3: 15
4: 168
Right 915612645 1:157006887-157006909 CTGTGCCACAGGCCTAGTGAGGG 0: 1
1: 0
2: 1
3: 20
4: 169
915612637_915612644 27 Left 915612637 1:157006836-157006858 CCAGAAGATGAAGGGCCCCAGTG 0: 1
1: 0
2: 1
3: 15
4: 168
Right 915612644 1:157006886-157006908 TCTGTGCCACAGGCCTAGTGAGG 0: 1
1: 0
2: 2
3: 14
4: 139
915612637_915612643 17 Left 915612637 1:157006836-157006858 CCAGAAGATGAAGGGCCCCAGTG 0: 1
1: 0
2: 1
3: 15
4: 168
Right 915612643 1:157006876-157006898 CAGCATGAGCTCTGTGCCACAGG 0: 1
1: 0
2: 2
3: 20
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915612637 Original CRISPR CACTGGGGCCCTTCATCTTC TGG (reversed) Intronic
900484376 1:2914496-2914518 CATTGGGGCCCTTTTCCTTCAGG + Intergenic
900761038 1:4470642-4470664 CACTGGGGCCCTTCATGCCACGG - Intergenic
901875228 1:12163676-12163698 CACTGGAGGCCTTCATGTCCTGG - Intergenic
904753246 1:32754104-32754126 CGCTGGGGGCCTTCCTCTTGTGG - Intronic
906016782 1:42588967-42588989 GAGTTGAGCCCTTCATCTTCTGG - Intronic
906284302 1:44576585-44576607 CACTGGGGCCCATCCTGTCCTGG - Intronic
907918303 1:58890672-58890694 AAATGGGGCCCCTCATCTCCAGG - Intergenic
907922295 1:58924863-58924885 CACTGGGATGCTTCTTCTTCAGG + Intergenic
907987744 1:59549197-59549219 CTCTGGAGCCCTTCCTCTCCAGG + Intronic
909190535 1:72543306-72543328 CTCTGGGTCTCTTCATCTTCTGG - Intergenic
911845522 1:102746980-102747002 CTCTGGGGCAATGCATCTTCCGG + Intergenic
913104017 1:115595294-115595316 CATTGAGGACCTGCATCTTCTGG - Intergenic
915612637 1:157006836-157006858 CACTGGGGCCCTTCATCTTCTGG - Intronic
916830488 1:168485731-168485753 CAGTCAGGCCCTTCTTCTTCAGG - Intergenic
920293289 1:204939492-204939514 CACTGTGGCCCCTCTTCTTCAGG + Intronic
924359211 1:243218357-243218379 CACTGGGGCCCTTGCCCCTCTGG - Intronic
1063161359 10:3421129-3421151 CTCTGGGACCCATCATATTCTGG - Intergenic
1064564328 10:16624579-16624601 CACTGGTGCCCTTCCTGCTCTGG - Intronic
1064790930 10:18957446-18957468 CACTGTTGCCATTCATTTTCAGG + Intergenic
1067220324 10:44339536-44339558 CACTGGGGCCCTGCAGCCTTGGG - Intergenic
1070750600 10:78961906-78961928 CCCTGGGGCCCTGCATCCTGTGG - Intergenic
1071528522 10:86372329-86372351 CTCTGTGGCACTTCATGTTCTGG - Intergenic
1073567993 10:104551932-104551954 CAATGGGGACCTTGATGTTCAGG + Intergenic
1076581313 10:131513796-131513818 CACTGCGGCACTTCATGCTCTGG + Intergenic
1076994342 11:290852-290874 CACTGAGGCCCTGCAGCTGCAGG + Exonic
1077298258 11:1835978-1836000 CAGCGGGGCCCTTCACCTCCTGG - Exonic
1081421532 11:42878098-42878120 CACAGGGAACCTTCATCATCTGG - Intergenic
1083708616 11:64533743-64533765 CAATCTGGCCATTCATCTTCTGG + Intergenic
1084118716 11:67056721-67056743 GGCTGGGGCCCTTCCTCTCCAGG - Intergenic
1086414404 11:86574477-86574499 CACTGAGGCCCCTCTTCTGCAGG + Intronic
1086443247 11:86849005-86849027 CCCAGGGGGCCTTCATCCTCTGG - Intronic
1087693534 11:101349586-101349608 CACAGGGGCCCTTAATTCTCGGG + Intergenic
1088613870 11:111603209-111603231 CCATGGGGCCCTTCCTCGTCGGG - Intronic
1088915066 11:114221346-114221368 CACTGGGGTCTTTCATCCTTTGG + Intronic
1089304366 11:117517452-117517474 CAGTTGGGCCCCTCATGTTCTGG - Intronic
1089789112 11:120929717-120929739 GCATGGGGCCCTTCCTCTTCTGG + Intronic
1091297132 11:134481942-134481964 CCCTGGGGCCCTGCCTCTTCAGG + Intergenic
1094676777 12:32628257-32628279 CTCTGAGGCCCATCATCATCTGG - Intronic
1094683212 12:32684551-32684573 CACTGCAACCCTTCACCTTCCGG + Intronic
1097766624 12:63533952-63533974 CACTGGGGCCATCCATCCTCAGG - Intergenic
1097782962 12:63728879-63728901 AACTGGGGCCATCCATCCTCAGG - Intergenic
1099690826 12:85949137-85949159 CACTGCTGCCCTTCCTCTCCGGG + Intergenic
1100134721 12:91541562-91541584 ATCTGGCCCCCTTCATCTTCAGG + Intergenic
1101428401 12:104606478-104606500 TACTGGAGACCTTCCTCTTCGGG - Intronic
1103980679 12:124735015-124735037 CCCTTGGGCCTTCCATCTTCTGG - Intergenic
1104512611 12:129394318-129394340 CACGGGCTCCCTTCATGTTCAGG - Intronic
1104905286 12:132210154-132210176 CCCTGGGGCCCGTCGTCTGCAGG + Intronic
1110397595 13:75049608-75049630 CACTGGAGCTCTTGATTTTCAGG + Intergenic
1112560856 13:100512567-100512589 CACTGGAGCGAGTCATCTTCCGG + Intronic
1113719840 13:112546863-112546885 CAATGGGGCCCTGCAGATTCTGG + Intronic
1118127906 14:62929492-62929514 CACCAGGGCCCTTCATGGTCTGG + Intronic
1118760533 14:68878218-68878240 CTCTGTGCCACTTCATCTTCTGG - Intronic
1119874084 14:78042266-78042288 CAATGGGGCCAGTTATCTTCAGG - Intergenic
1121822889 14:96985751-96985773 CCTTGAGACCCTTCATCTTCTGG + Intergenic
1123029782 14:105446241-105446263 CACTGAGGCCCTTCATGTGTCGG + Intronic
1123406411 15:20021755-20021777 CACTGGGGCACCTCAGCTCCAGG - Intergenic
1123515741 15:21028403-21028425 CACTGGGGCACCTCAGCTCCAGG - Intergenic
1123910112 15:24957274-24957296 CACTGGACCTCTTCATCTTCTGG + Intronic
1124593815 15:31077498-31077520 CAATGGGGCCCTTCAGATGCAGG - Intronic
1127096370 15:55515597-55515619 CACGGGGGGCCTTTATATTCAGG + Intergenic
1129458628 15:75688934-75688956 CACTGGGGCCCTGCAGTTTGGGG - Exonic
1134166803 16:11936868-11936890 CAGTTGTGCCCTTCACCTTCTGG + Intronic
1134438973 16:14286203-14286225 CCCTGGGGCGCTTCATCCCCTGG + Intergenic
1137402919 16:48167740-48167762 CACCAGGGCCCTTCCTCTCCAGG + Intronic
1137760628 16:50937315-50937337 CACTGGGGCCCTTCCACAACAGG - Intergenic
1138615842 16:58165629-58165651 CCCTGAGGCCCTAGATCTTCTGG - Exonic
1141352750 16:83313548-83313570 GCCTGGGGCCCTTCAACTTTGGG - Intronic
1141818326 16:86428108-86428130 CAATGTGGCCCTTCATTTTATGG + Intergenic
1142027546 16:87822692-87822714 CTCTGGGGCTCTTCGTCTCCAGG - Intergenic
1142031671 16:87841580-87841602 CACTAGGGCCCTGCTTCTTGGGG + Intronic
1142217166 16:88835491-88835513 AACTGAGGCCATTCCTCTTCTGG - Intronic
1143319053 17:6056089-6056111 AACTGGGGACCTTTAACTTCAGG + Intronic
1144221583 17:13104696-13104718 CCCTGGGGCAGTCCATCTTCTGG + Intergenic
1145074483 17:19840406-19840428 CATTTGGGCCCCTCTTCTTCTGG + Intronic
1145165863 17:20613012-20613034 CATTGGGGTCCTTCAGCTCCTGG - Intergenic
1148200924 17:45749593-45749615 CTCAGGGGCCCTTCATCTCTTGG - Intergenic
1150814024 17:68378559-68378581 GACTCGTGCCCTTCTTCTTCGGG - Intronic
1152264268 17:79284902-79284924 GCTTGGGGCCCTTCATCCTCTGG + Intronic
1153782967 18:8510272-8510294 CTCTGGAGTCCTTCATCATCTGG + Intergenic
1159983433 18:74813602-74813624 CACTGGAGCCCTTCATCTTAGGG + Intronic
1160397052 18:78580244-78580266 CCCGGGGGCCCTTCATCTGCAGG - Intergenic
1162088514 19:8262533-8262555 CCCTGGGGCCCTGCATCCTTGGG - Intronic
1162183281 19:8885467-8885489 TACTGGAGACCTTCATCCTCAGG - Intronic
1163312021 19:16520521-16520543 CACTGGGGCACCTGATCATCAGG - Exonic
1164469860 19:28520927-28520949 CACATGGCCCCGTCATCTTCTGG - Intergenic
1164558429 19:29270911-29270933 CCCGGGGGCCCCTCAACTTCAGG - Intergenic
1167981812 19:53282192-53282214 GAGTGGGGCCCTTCCTCTGCAGG + Intergenic
1167984280 19:53301470-53301492 GAGTGGGGCCCTTCCTCTGCAGG - Intergenic
933881399 2:86673562-86673584 CACTGCTGCCCTGCTTCTTCAGG + Intronic
935974064 2:108560093-108560115 CCCTGTGGCCCATCATCTGCTGG - Intronic
938451302 2:131423971-131423993 CTCTGGGGTCCATCATATTCTGG + Intergenic
938593434 2:132762574-132762596 CAGTGGGGCCTTTCCCCTTCAGG + Intronic
942728061 2:179032259-179032281 CTCTGGGACCATTGATCTTCTGG + Intronic
942916306 2:181311978-181312000 CACTGGGGCATTTAATCTTCTGG - Intergenic
943000248 2:182318591-182318613 CCCTGGAGCTCTTCATCTTGAGG + Intronic
944968581 2:204965184-204965206 CACTGGGGCTCTCAATCTTGTGG - Exonic
945022296 2:205585691-205585713 CACTTAGGCCCTGCCTCTTCAGG + Intronic
946293216 2:218761666-218761688 GATTTGGGCCTTTCATCTTCTGG - Intergenic
946474550 2:219994856-219994878 CATTGGAGCCATTCATGTTCTGG + Intergenic
946629691 2:221653560-221653582 CAATGAGTCCTTTCATCTTCAGG + Intergenic
947817273 2:233046395-233046417 CACTGGGACCCTTGAGCTTCTGG - Intergenic
948621901 2:239240727-239240749 CACTGGGGCACATCATGTGCTGG - Intronic
1169771693 20:9208161-9208183 CCCTGGGACCCTTCCTCTTAAGG - Intronic
1171395284 20:24829184-24829206 CTCTGGGGCCCTGCATCACCTGG - Intergenic
1171721113 20:28564183-28564205 CACTGGCCTCCTTCATCCTCAGG - Intergenic
1172167223 20:32906783-32906805 CACTGGGGACCTTCACCCACTGG - Intronic
1172242648 20:33423519-33423541 CACATGGGCCCTTCCTCCTCAGG + Intronic
1173231621 20:41203248-41203270 CTCTGGAGCCCTTCAAGTTCCGG + Exonic
1178158238 21:29880006-29880028 CCCTGGGGGCCTTCATATTATGG + Intronic
1181609669 22:24004115-24004137 CACTGGAGGCCTCCAGCTTCTGG - Intergenic
1181891669 22:26068811-26068833 CATTGGGGCCATTCATCAGCAGG + Intergenic
1184388448 22:44189297-44189319 CGCTGGGGTCCTTCTGCTTCAGG + Intronic
1184522138 22:45001065-45001087 CTATGGGGCCCTTGCTCTTCCGG + Intronic
949595971 3:5547637-5547659 CACAGGGCCCCTTCATCTTTGGG - Intergenic
949884480 3:8682456-8682478 CACAGGGGGCCTTTATGTTCAGG - Intronic
950874064 3:16254364-16254386 CACTGGGACCCAACATCCTCTGG + Intergenic
954865602 3:53726930-53726952 TACGGGGGCCCATCCTCTTCAGG + Exonic
961985255 3:131125004-131125026 CACTAGGCCACTTCATCTTGAGG - Intronic
962383495 3:134914920-134914942 CACTGGGCCCCTTCACCAGCAGG - Intronic
963453488 3:145515292-145515314 CACTTGGCCCCTTCCACTTCGGG - Intergenic
963507101 3:146199906-146199928 CACTAAGGCCCTTCGTCCTCCGG - Exonic
967205726 3:187119030-187119052 TAAGTGGGCCCTTCATCTTCAGG - Intergenic
969025317 4:4168052-4168074 CACAGGAGGCCTTCATTTTCAGG + Intergenic
970329143 4:14961380-14961402 ATCTGGGCCCCTCCATCTTCAGG + Intergenic
970385324 4:15550172-15550194 CAATGGGGCCCTTCACCTCATGG + Intronic
976017881 4:80580950-80580972 TACTGCGGCTCTTCATCTTGGGG - Intronic
977411652 4:96673886-96673908 CAATGGGGTCCTACATCATCTGG + Intergenic
980730094 4:136812687-136812709 CACTGGAGCCCGTCATCCTGGGG - Intergenic
986569933 5:9154385-9154407 CTCTGAGGCCATTCAACTTCAGG + Intronic
988459612 5:31422014-31422036 CACTGCAGCCCTTGACCTTCAGG - Intronic
993057315 5:82996920-82996942 GGATGGGGCCCTTCATCTACAGG + Intergenic
995646760 5:114321343-114321365 CTTTAGTGCCCTTCATCTTCTGG + Intergenic
998436880 5:142117801-142117823 CACTGCAACCCTCCATCTTCAGG + Intronic
1000535304 5:162471378-162471400 CACTGGGACACTTCTTGTTCAGG - Intergenic
1001957128 5:175855632-175855654 CACTGTGACCCTGCAGCTTCAGG + Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1004318705 6:14615241-14615263 CAGTGGGGACCTTCATTTTTTGG - Intergenic
1006747974 6:36358324-36358346 CACTGGGGGCCTTCTGCTGCTGG + Intronic
1009858247 6:69291962-69291984 CTCTGTGACCCTTCATCTTCAGG - Intronic
1011649391 6:89491857-89491879 CTCTGTGACCCTTCATCTTCAGG - Intronic
1018000326 6:159572918-159572940 CACTGAGGCCCTTCTGCTTGAGG - Intergenic
1018723261 6:166589978-166590000 CCCAGGGGCCCTTCTTCCTCTGG - Intronic
1019388675 7:773296-773318 CACAGCGTCCCTTCCTCTTCTGG - Intronic
1019873313 7:3787856-3787878 CATTGGGGCCCTTCTACCTCAGG + Intronic
1020007874 7:4791996-4792018 CCCCGGTCCCCTTCATCTTCAGG - Intronic
1023186961 7:37542132-37542154 CACGTGTGCCCTTCATCTTGTGG + Intergenic
1024018987 7:45348285-45348307 CACTGGGCCCCCTCACCTTGAGG + Intergenic
1025301241 7:57821107-57821129 CACTGACTCCCTTGATCTTCTGG + Intergenic
1026201227 7:68216198-68216220 CACTGGCTGCCTTCAACTTCTGG - Intergenic
1026735542 7:72946378-72946400 CCCTGGGGCCCTTTCCCTTCTGG + Intronic
1026785880 7:73301308-73301330 CCCTGGGGCCCTTTCCCTTCTGG + Intergenic
1027108184 7:75418630-75418652 CCCTGGGGCCCTTTCCCTTCTGG - Exonic
1027869174 7:83684963-83684985 CACCTGCTCCCTTCATCTTCTGG - Intergenic
1028451754 7:90993063-90993085 CTCTGGGTCTCTTCATCCTCTGG - Intronic
1031141670 7:117949631-117949653 CACTGGTGCACTTCTTTTTCTGG - Intergenic
1032498440 7:132380488-132380510 TAATGTGGCCCTTCATCTCCTGG + Intronic
1033037042 7:137884820-137884842 CCCTGGGGCCCCTCATCCACTGG - Intronic
1033120451 7:138663294-138663316 CCCTGAGGCCCTTCATGTTCAGG + Intronic
1033715945 7:144002775-144002797 CTCTGGGGTCCTGCACCTTCTGG + Intergenic
1034562257 7:151888545-151888567 CAATAGGGCCCTTCCTCTACAGG + Intergenic
1035382233 7:158447491-158447513 CCCTGGGGCCCTGCTGCTTCTGG - Intronic
1040946781 8:52893097-52893119 CACTGGGCCACTCCATCTTCCGG - Intergenic
1041515617 8:58695941-58695963 CATGGGGGGCCTTCATATTCAGG - Intergenic
1042612069 8:70609967-70609989 GACTGGAGCCCTGCATCTACAGG + Intronic
1043758396 8:84032311-84032333 CTCTGGGGCTCTGCAGCTTCTGG + Intergenic
1043929127 8:86070115-86070137 CACTCATGACCTTCATCTTCCGG + Intronic
1046703872 8:117428565-117428587 CACTGGGGCCTTTCAGAGTCGGG + Intergenic
1049178878 8:141210266-141210288 CACTGTGGCCCTTCTTCTCTGGG - Intronic
1049485686 8:142858809-142858831 CACAGAGGCCCTTCCTCTCCAGG - Intronic
1057029300 9:91761835-91761857 CACTAGGCCCCTCCATCATCAGG + Intronic
1057182043 9:93035541-93035563 CCCGGGGGCCCTGCAGCTTCAGG + Exonic
1058700964 9:107599848-107599870 CACTGTGGCCCTTCCTGTCCTGG + Intergenic
1059303108 9:113331396-113331418 CAGAGGGGCCCTAAATCTTCAGG - Intronic
1059344201 9:113617025-113617047 CCCTGGGGCCCTTCACCTTGTGG - Intergenic
1059452818 9:114381353-114381375 ACCTGGGCCACTTCATCTTCAGG + Exonic
1060404898 9:123368320-123368342 CACTGAGTCCCACCATCTTCAGG - Intronic
1061872547 9:133528534-133528556 CACTGGGGCCTGCCATCTGCTGG - Intronic
1062261238 9:135664140-135664162 CACTGGAGCTCTTTGTCTTCAGG + Exonic
1190740977 X:53288516-53288538 GCCTGGGCCCCCTCATCTTCTGG + Intronic
1192850513 X:74951100-74951122 CACTGGGGCCTGTCATCTCCAGG - Intergenic
1193729321 X:85083129-85083151 GTCTGGTGCCCTTTATCTTCTGG + Intronic
1199104491 X:143847415-143847437 CACTGGGGCCCGTCATGGTGTGG + Intergenic
1200021747 X:153217589-153217611 CTCTGGGATCCTTCGTCTTCAGG + Intergenic
1200214253 X:154360470-154360492 CACAGGGGCCCTCCACCGTCAGG + Exonic
1200977278 Y:9226788-9226810 CACTGGGGCTCTCCAGTTTCTGG - Intergenic