ID: 915615121

View in Genome Browser
Species Human (GRCh38)
Location 1:157031692-157031714
Sequence TTTGCCACTCCCCTTGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915615121_915615126 9 Left 915615121 1:157031692-157031714 CCAATTTCAAGGGGAGTGGCAAA 0: 1
1: 0
2: 0
3: 10
4: 159
Right 915615126 1:157031724-157031746 ACAGAACCCCAGAACTGCATGGG 0: 1
1: 0
2: 1
3: 23
4: 196
915615121_915615125 8 Left 915615121 1:157031692-157031714 CCAATTTCAAGGGGAGTGGCAAA 0: 1
1: 0
2: 0
3: 10
4: 159
Right 915615125 1:157031723-157031745 AACAGAACCCCAGAACTGCATGG 0: 1
1: 0
2: 1
3: 58
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915615121 Original CRISPR TTTGCCACTCCCCTTGAAAT TGG (reversed) Intronic
906016731 1:42588461-42588483 TCTCCCTCTCCCCTGGAAATGGG - Intronic
906830675 1:49027957-49027979 TATGCCACTGCCCTAGAACTGGG - Intronic
907251619 1:53143278-53143300 TGTGCCACTCACCGGGAAATGGG + Intergenic
908657243 1:66401226-66401248 TTTAACACTCTCCTTGACATGGG - Intergenic
909428423 1:75555673-75555695 TTTGTGACTACCCTTCAAATTGG - Intronic
909485136 1:76164249-76164271 TTTCCCTCTCTCCTTGGAATGGG - Intronic
910250782 1:85196707-85196729 ATTGCTACTCACCTTGAAAAGGG + Intronic
913421557 1:118675514-118675536 TTTGCCTCTCTGCTTGATATTGG - Intergenic
915615121 1:157031692-157031714 TTTGCCACTCCCCTTGAAATTGG - Intronic
915894176 1:159798448-159798470 TTTGACCCTCCACCTGAAATTGG - Intergenic
919244411 1:194961574-194961596 TCTGCCTCTTCTCTTGAAATAGG - Intergenic
922209564 1:223477146-223477168 TTTCCCACTCCCCTTAACTTTGG + Intergenic
922731257 1:227949742-227949764 TGGGCCACCTCCCTTGAAATGGG + Intergenic
923569657 1:235102246-235102268 GTTGCCACTAGACTTGAAATTGG + Intergenic
924560067 1:245150912-245150934 TTTGCCAGTCCCCTCTAACTTGG - Intergenic
1065269439 10:24012235-24012257 TTTTAAACTCCCATTGAAATGGG + Intronic
1067251992 10:44594274-44594296 TTCTCCACTCCCCTGGAAAGGGG + Intergenic
1069088932 10:64175973-64175995 TTTCCCACTCCCTTACAAATAGG - Intergenic
1070976889 10:80612641-80612663 GTTGCCACACCCTTTGACATAGG - Intronic
1073846449 10:107561161-107561183 TTTGCCACTGGATTTGAAATGGG + Intergenic
1074274163 10:111985254-111985276 TATGTCAATCCTCTTGAAATGGG + Intergenic
1076719358 10:132386509-132386531 TCTCCCGCTCCCCTTGAAATGGG - Intergenic
1079333265 11:19550693-19550715 TTGCCCACTCCCCTTGAGGTAGG + Intronic
1079775499 11:24520824-24520846 TTTGCTATTCCCCATGCAATGGG - Intronic
1081338987 11:41904043-41904065 TGGGACACTCCCCTTGGAATTGG - Intergenic
1081633047 11:44702353-44702375 TTTGCCACTGCCCTTGAGGCTGG + Intergenic
1083075341 11:60031590-60031612 TTTGCCACCCTCCATGCAATGGG - Intergenic
1084848968 11:71923050-71923072 TTTGCCAGTGCCCTTCAAACTGG + Intronic
1085847178 11:80079148-80079170 TGTGCCTCTCACCTTGAACTTGG - Intergenic
1087828296 11:102791247-102791269 TTTGAGACTCACTTTGAAATGGG + Intronic
1093570266 12:20659410-20659432 TTTGTCACCCCCATAGAAATTGG + Intronic
1096752302 12:53768596-53768618 TTTGCCAATCCCCTTGTCTTTGG + Intergenic
1096781784 12:53996037-53996059 TTTCCTTCTCCCCCTGAAATGGG - Intronic
1096839073 12:54370014-54370036 TTTCCCTCTCCCCTAGAAAAGGG - Exonic
1103255677 12:119539671-119539693 ACTGCCACTCCCCTGGAAAGGGG - Intronic
1108184714 13:47877089-47877111 TTTGCCATTCCCTGTGAGATTGG - Intergenic
1108930184 13:55807852-55807874 TTTGCCCCTACCCTAGAGATCGG - Intergenic
1109847782 13:68019569-68019591 TTTGGCACTATCATTGAAATAGG - Intergenic
1113053475 13:106240488-106240510 CTTCCCACTCCCCTGGAATTAGG + Intergenic
1115908608 14:38230264-38230286 ATTGCCACTGCCTTTGAAAGAGG + Intergenic
1117326439 14:54673230-54673252 TGTGCTGCTCCCATTGAAATTGG - Intronic
1117760407 14:59021232-59021254 GTTTCTCCTCCCCTTGAAATTGG - Intergenic
1119259665 14:73230280-73230302 TGTGCCACTCCCCTTCAGAGAGG + Intergenic
1122063114 14:99150155-99150177 TCTGCCTTTCCCATTGAAATGGG + Intergenic
1125509963 15:40287577-40287599 TTTGGAACTCCCCCTAAAATAGG + Intronic
1127664894 15:61136110-61136132 TTTTCCACTCTTCTTGAAAGGGG + Intronic
1131930839 15:97439128-97439150 TTAGCCACATCCCTAGAAATTGG - Intergenic
1134868138 16:17627388-17627410 CTTGCCCCTTCCCCTGAAATGGG + Intergenic
1135599922 16:23774069-23774091 TTTGCCACCCCCGGTAAAATTGG - Intergenic
1139626002 16:68188614-68188636 TTTGGCAATCCCCTTGCAATAGG + Intronic
1142516968 17:438321-438343 TTTTCCAGTCCCCTTTTAATAGG - Intergenic
1146286019 17:31574669-31574691 TTTGGCTTTCCCTTTGAAATGGG + Intronic
1151204150 17:72493127-72493149 TTTGCCACTCGGCTTGACCTGGG + Intergenic
1153435199 18:5061512-5061534 TTTGCCACTGGCTTTGAAAATGG - Intergenic
1156539025 18:37891782-37891804 TTTGCCACAACCCTGGAATTAGG + Intergenic
1157884670 18:51355059-51355081 TATGCCACTGGCTTTGAAATTGG + Intergenic
1158281421 18:55832606-55832628 TTTCCCACTCCCCTTCAAAATGG + Intergenic
1161094221 19:2379798-2379820 TGTGCCACTGCACTTGAGATGGG - Intergenic
1162906285 19:13825959-13825981 TGAGCCACTCCCCTGGGAATGGG + Intronic
1168519880 19:57041134-57041156 ATTTCCAATCCACTTGAAATTGG - Intergenic
926739761 2:16101644-16101666 TTTGCCAAGCCCCATGAAGTAGG + Intergenic
930739038 2:54810657-54810679 ATTGCCTCTCCCCCTGCAATAGG - Intronic
940627004 2:156187613-156187635 TTTCCCAGCCCCCTTGAAGTTGG + Intergenic
941675294 2:168337548-168337570 TTGTCCCCTCCCCTTGAAACTGG - Intergenic
942300271 2:174554544-174554566 TTTGTCACTCTCCTTGGAGTTGG - Intergenic
942733439 2:179083295-179083317 TTTGCCCCTGCCCTAGAGATTGG - Intergenic
942802660 2:179893261-179893283 TATTCCACTCCCCTTGAATTTGG - Intergenic
942821410 2:180120179-180120201 TGTTGCACTCCACTTGAAATAGG + Intergenic
942853282 2:180516535-180516557 TCTGCCATGCCACTTGAAATGGG + Intergenic
943646942 2:190416594-190416616 TTTGGCACCACCCTTGAACTAGG - Intronic
944381301 2:199113826-199113848 TTTGCCTATCCCCTTCACATAGG + Intergenic
945943114 2:215969448-215969470 TTTGCCAGCACCCATGAAATTGG - Intronic
946847012 2:223868407-223868429 TGTGTCCCTCCCCTTGAATTGGG - Intronic
948925169 2:241091572-241091594 ATTCCCACTCCTCTTTAAATGGG - Intronic
1169376543 20:5071040-5071062 ATTGCCATTCACCTGGAAATGGG - Intronic
1169986613 20:11452147-11452169 TCTGCCACTCCCTTTGAAACAGG + Intergenic
1170528995 20:17270623-17270645 TTTTCCATTCCCCCTGAAAAGGG + Intronic
1172804046 20:37598461-37598483 GTTTCCCATCCCCTTGAAATGGG - Intergenic
1173611868 20:44374330-44374352 TTTGACACTGTCCTTGAACTTGG + Intronic
1174065722 20:47863916-47863938 TCAGCCATTCCCCTGGAAATGGG + Intergenic
1177201518 21:17962122-17962144 TTTCCCACACCCCTGAAAATAGG - Intronic
1177784122 21:25651739-25651761 TTAGCCAATCCCCTATAAATGGG - Intronic
1182575293 22:31268882-31268904 TTAGCCACTGCCCTTCACATGGG + Intronic
951205417 3:19921462-19921484 TTTGCCCCTCCCTTTCAAACTGG - Intronic
951205686 3:19923706-19923728 TTTGCCCCTCCCTTTCAAACTGG - Intronic
951263845 3:20544022-20544044 TGTGGCACTCCCCTAGAATTTGG - Intergenic
952109120 3:30102391-30102413 TTTTTCACTTCCCTTGAAATTGG + Intergenic
955123190 3:56082644-56082666 TTTGTCAGTCCCCTTGATGTGGG + Intronic
955357016 3:58239297-58239319 ATTGCCACTACCCTTTAAAGTGG - Intronic
955489355 3:59466692-59466714 TTGGCCCCTTCCTTTGAAATGGG - Intergenic
956039180 3:65128359-65128381 TTCTCTACTCCCCTTGAGATGGG + Intergenic
964627397 3:158772507-158772529 ATTTCCCTTCCCCTTGAAATTGG - Intronic
964922528 3:161914728-161914750 TGTGACAGACCCCTTGAAATGGG + Intergenic
965305621 3:167059835-167059857 TTTGCCCCTGCCCTAGAGATAGG - Intergenic
965475540 3:169150484-169150506 TTTAGCACTGCCCTTGAAATGGG + Intronic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
967356529 3:188578189-188578211 GTGGCCACTCCACTTGAAAGGGG - Intronic
973182851 4:47290742-47290764 TTTGCCCCTGCCCTAGAGATCGG + Intronic
975317880 4:72976674-72976696 TCTGCCACTTCCCTTAAAAAGGG + Intergenic
976320339 4:83707281-83707303 CTTGCCCCTCCCCTTGAACCTGG + Intergenic
976576273 4:86675818-86675840 TTTGACAATTCCTTTGAAATCGG + Intronic
977916044 4:102594607-102594629 TTAGCCTCTCCCCTTCACATAGG + Intronic
978060623 4:104333130-104333152 TTTGTCACTGCCTGTGAAATAGG - Intergenic
978894374 4:113869905-113869927 TTTTCCTCTGCCCTTGAATTTGG + Intergenic
979247401 4:118524707-118524729 TTTTCCCCTTCCCTTGAAAAAGG + Intergenic
979432634 4:120649194-120649216 TTTCCCACTCCCATTTAAAGTGG + Intergenic
980453059 4:133000027-133000049 TTTGCCACTCCTCGTGACTTTGG - Intergenic
984299279 4:177894206-177894228 TATCCCTCTCCCCTTGAATTTGG - Intronic
985562017 5:592806-592828 TTAGCCACTGCTCCTGAAATTGG + Intergenic
987026689 5:13934018-13934040 ATTTCCCCTCCCCTTGAATTTGG + Intronic
987611082 5:20203462-20203484 TTTGGGACTTCCCATGAAATGGG + Intronic
987965753 5:24869985-24870007 TTTCCCACTCCTTTTGATATAGG + Intergenic
988774957 5:34469247-34469269 TCTTTCACTCCCCTGGAAATGGG + Intergenic
990190610 5:53256042-53256064 TTTGCCAATCTCCATGAAACTGG + Intergenic
990439077 5:55825690-55825712 TTTGCCAATACTGTTGAAATGGG + Intergenic
991726885 5:69544669-69544691 ATGGCTACTCCCCTTTAAATTGG + Intronic
991868072 5:71083205-71083227 ATGGCTACTCCCCTTTAAATTGG - Intergenic
991990036 5:72328480-72328502 TTTTCCCCTCCCCTTGACTTTGG - Intronic
994524127 5:100882296-100882318 TTTGCCCCTGCCCTAGAGATTGG + Intronic
994976070 5:106808533-106808555 ATTGACACTTCCCTTTAAATTGG - Intergenic
995133156 5:108651763-108651785 TTTGTTATTCCTCTTGAAATAGG - Intergenic
995755354 5:115497571-115497593 TTTTCCACATCCCTTGAAGTGGG - Intergenic
996384056 5:122891907-122891929 TTTGCTTCTCTCATTGAAATAGG + Intronic
996643367 5:125786041-125786063 TTTGACACTCCTCCTTAAATAGG + Intergenic
997400074 5:133595511-133595533 TTTACCACTCCACTGGAAAGAGG + Intronic
998120719 5:139574716-139574738 TTTGCCACCCCACCTGATATTGG - Intronic
998607588 5:143650672-143650694 TTTGGCACTCCGCTTAATATTGG - Intergenic
998787095 5:145724448-145724470 TTTGCCAATCACCTTAATATTGG - Intronic
1004802243 6:19162162-19162184 TTTTCAATTCTCCTTGAAATGGG - Intergenic
1006651130 6:35552758-35552780 GTTTCCCCTCCCCTTGAATTTGG - Intergenic
1008336256 6:50308155-50308177 TTTTCTACTACCCTTGAATTTGG - Intergenic
1008969747 6:57353530-57353552 TTTACCACTCCTCTTGAGACAGG + Intronic
1009158711 6:60255355-60255377 TTTACCACTCCTCTTGAGACAGG + Intergenic
1011136349 6:84104931-84104953 TTTGCCTCTGCCCTAGAGATTGG - Intergenic
1011808757 6:91104673-91104695 ATTGCCATTCTCCATGAAATGGG - Intergenic
1011916338 6:92511122-92511144 TTTGCCCCTGCCCTAGAGATCGG + Intergenic
1015879162 6:137853710-137853732 CTTGGCTCTACCCTTGAAATAGG - Intergenic
1016055745 6:139576272-139576294 TCTGCAACTCCACTTGAAGTAGG + Intergenic
1018284345 6:162220895-162220917 TTTCACTCTCCTCTTGAAATGGG + Intronic
1019873783 7:3791063-3791085 TTTGTCACTCCCCAGGAACTAGG - Intronic
1021303175 7:18997875-18997897 TTTGAGACACCCTTTGAAATAGG + Intronic
1023198784 7:37670659-37670681 TTTCCCACTTCCTTTCAAATGGG - Intergenic
1026063356 7:67046454-67046476 TTGGCCACTCATCTTTAAATGGG + Intronic
1026714987 7:72781043-72781065 TTGGCCACTCATCTTTAAATGGG - Intronic
1028601953 7:92610925-92610947 GTTGCCTCTTCCCTTGAAATGGG + Exonic
1040615827 8:49037418-49037440 TTCCCCACTCCCCTTGCAACTGG - Intergenic
1041632730 8:60106180-60106202 TTTTCCCCTTCCCTTGAATTTGG - Intergenic
1047941518 8:129831329-129831351 TTTGCCCCTGCCCTAGAGATTGG - Intergenic
1048211944 8:132461705-132461727 TTAGCCACCCCCATTCAAATAGG + Intronic
1048337074 8:133510715-133510737 TTTGTAAATCCACTTGAAATTGG - Intronic
1048514750 8:135096007-135096029 TTTTCCCCTCCCCTAGAAAAAGG + Intergenic
1050880743 9:10697152-10697174 TTTGCCTATCCCATTGATATTGG + Intergenic
1053337861 9:37293079-37293101 ATTCCAACTCCACTTGAAATGGG - Intronic
1053730097 9:41045185-41045207 TTTGCCATTCACTTGGAAATTGG - Intergenic
1055993811 9:82135790-82135812 TTTGCCAATCCTATTGTAATAGG + Intergenic
1056972384 9:91217302-91217324 TTTGCCACTCTCATTGCAACAGG + Exonic
1058397769 9:104574912-104574934 ATTGCTATTCCCCTTGAAACTGG + Intergenic
1188526492 X:31093660-31093682 TCTCCCACTCCCATTGAGATGGG + Intergenic
1188687443 X:33085506-33085528 TTTGTCACAACCCTAGAAATGGG - Intronic
1189289351 X:39874290-39874312 TTTTCCTCTCCCCTTGAACCTGG + Intergenic
1191972942 X:66838059-66838081 CTGTCCACTCCCCTTGAAAGGGG + Intergenic
1192098422 X:68238223-68238245 TTTTCCACTCCCCATTAATTTGG + Intronic
1194982262 X:100452852-100452874 TTTGCCACTGCCCTAGAGATTGG + Intergenic
1196545513 X:116960387-116960409 TTTGCCACTCCATATGAAAATGG - Intergenic
1197718660 X:129729018-129729040 TTGTCCACTCCCCTTGAAACTGG - Intergenic
1198155910 X:133960345-133960367 TTAGCCATACACCTTGAAATTGG + Intronic
1198439424 X:136647867-136647889 TTTGTCACTTTCCTTGAAACTGG + Intergenic
1199394574 X:147320192-147320214 ATTGCCACCTACCTTGAAATTGG - Intergenic
1199546967 X:149016758-149016780 CATGCCACTCCCTTTAAAATGGG + Intergenic
1201469357 Y:14316964-14316986 TTTGCCCCTGCCCTAGAAACTGG + Intergenic