ID: 915615425

View in Genome Browser
Species Human (GRCh38)
Location 1:157034138-157034160
Sequence CTGGGGCTCTGAAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 1, 3: 60, 4: 520}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915615413_915615425 1 Left 915615413 1:157034114-157034136 CCTAGTGGTATTTTTCCCCTCTC 0: 1
1: 0
2: 1
3: 27
4: 372
Right 915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG 0: 1
1: 0
2: 1
3: 60
4: 520
915615411_915615425 20 Left 915615411 1:157034095-157034117 CCTGTGAAGACACTGAAATCCTA 0: 1
1: 0
2: 0
3: 24
4: 212
Right 915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG 0: 1
1: 0
2: 1
3: 60
4: 520
915615410_915615425 26 Left 915615410 1:157034089-157034111 CCTGTTCCTGTGAAGACACTGAA 0: 1
1: 0
2: 0
3: 18
4: 199
Right 915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG 0: 1
1: 0
2: 1
3: 60
4: 520
915615409_915615425 27 Left 915615409 1:157034088-157034110 CCCTGTTCCTGTGAAGACACTGA 0: 1
1: 0
2: 2
3: 29
4: 355
Right 915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG 0: 1
1: 0
2: 1
3: 60
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915615425 Original CRISPR CTGGGGCTCTGAAGGGAAGA GGG Intronic
900365930 1:2311988-2312010 CTGGGCCTCTGCAGGGACCACGG + Intergenic
900566582 1:3335164-3335186 CTGGGGCTGTGCAGGGCAGCTGG - Intronic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
900932524 1:5746152-5746174 CAGGCGCTCAGAAGGGAAGAGGG + Intergenic
902245448 1:15117728-15117750 CATGGGCTCTGATGGGAAGAGGG - Exonic
903342250 1:22661800-22661822 CTGAGGATCAGAAGGGATGAAGG + Intergenic
903684353 1:25120090-25120112 AGGGGGCTCAGGAGGGAAGAAGG - Intergenic
903800907 1:25967503-25967525 GTGGATCTCTGAAGTGAAGATGG + Intronic
904311583 1:29632781-29632803 CTGGAGGGCTGAGGGGAAGAGGG - Intergenic
904344028 1:29856477-29856499 CTGGGGCTCAGAGGCGGAGATGG - Intergenic
904344590 1:29859648-29859670 CTGGGGCTCAGAGCGGGAGAAGG + Intergenic
904564999 1:31423646-31423668 CTTGGGCGGTGAAGGGGAGAGGG + Intronic
904890283 1:33774421-33774443 CAGGGAATCTGAAGGAAAGAAGG + Intronic
905411995 1:37776955-37776977 CATGGGCTCTGAGGGTAAGATGG + Intergenic
905674902 1:39818331-39818353 CGGGGGTTCTGCTGGGAAGAAGG + Intergenic
906094478 1:43212264-43212286 GTAGGACTCTGAAGGGCAGATGG - Intronic
906640086 1:47436686-47436708 CTGGGGCACGGAAGGGGAGATGG - Exonic
907248651 1:53123483-53123505 GTGGGGCTCAGAAGGGAATGAGG + Intronic
907529454 1:55079306-55079328 CTGGGGCCCTGATGGGTAGCTGG + Intronic
907737470 1:57128713-57128735 TTGGGCCTCTGAAGGGATGTGGG - Intronic
907957215 1:59241390-59241412 CTAGGCCTCTGAAGGGTAGAAGG + Intergenic
909482406 1:76140324-76140346 CTGTGCCTCTGAAGGAAGGAAGG + Intronic
909502756 1:76353861-76353883 CTGGGGTTCTGAAGGTAAAGGGG - Intronic
911606453 1:99910967-99910989 ATGGGGAGATGAAGGGAAGAAGG - Intronic
912573662 1:110643985-110644007 GTGGGCCTCCCAAGGGAAGAGGG - Intergenic
912698929 1:111861703-111861725 GGAGGGCTCTGCAGGGAAGAGGG + Intronic
912940909 1:114043837-114043859 CTGGAGCTCAGAAGAGAAGTTGG - Intergenic
914228087 1:145738701-145738723 CTGGAGCTTAGGAGGGAAGAAGG - Exonic
915099398 1:153488092-153488114 CAGAGGCTGGGAAGGGAAGAGGG + Intergenic
915564811 1:156707388-156707410 CTGGGCTTCTGCAAGGAAGAGGG + Intergenic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
915853301 1:159351699-159351721 CTGGGGCTGTGATGGCAAGGAGG - Intergenic
916186898 1:162142237-162142259 CAGTGGCTCTGTAAGGAAGATGG + Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916608011 1:166362170-166362192 CTGGGGATCTGAGGGTTAGATGG - Intergenic
916872622 1:168933325-168933347 CTTGGGCTCTGAACAGCAGATGG - Intergenic
916891686 1:169117804-169117826 CTGGGGAGATGAAGGGAACAGGG + Intronic
917030109 1:170681061-170681083 TTGGGTCTCTTAATGGAAGAAGG + Intronic
917512776 1:175681892-175681914 ATGGGGGTCTGAAGGGAGGAAGG + Intronic
917535734 1:175873072-175873094 GTGGGGGGCTGAAGGGAGGAGGG - Intergenic
918180704 1:182084280-182084302 CTGGGGCTCTGCGGGGACCAGGG + Intergenic
918210235 1:182343912-182343934 CTGGTGTTCTTAAAGGAAGAGGG + Intergenic
918430563 1:184455678-184455700 CTGGAGCTATGATGGGAACAAGG - Intronic
919653509 1:200174696-200174718 CTGGGGCCTTCAAAGGAAGAGGG - Exonic
920199300 1:204249709-204249731 CTGAGACTTTGAAGGGAGGAGGG - Intronic
920285407 1:204875297-204875319 GGGAGGCACTGAAGGGAAGATGG + Intronic
920983615 1:210862902-210862924 CAGGGAATCTGTAGGGAAGAAGG - Intronic
921274564 1:213506107-213506129 AAGGGGCTCTGAGGGCAAGATGG + Intergenic
922784470 1:228276206-228276228 GTGGGGCACTGAGGGGAGGAGGG + Intronic
922923730 1:229330319-229330341 CTGGAGCTCAGGAGAGAAGATGG + Intronic
923029248 1:230234256-230234278 CTGTGCTTCTGAAGGGAAGTTGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924825201 1:247531560-247531582 CTGTGGCTCTGCAGGCAAGCTGG - Exonic
1064509520 10:16074527-16074549 CTGGGGCTCTGAAGAGGAAGAGG - Intergenic
1065945133 10:30599307-30599329 CAGGGGCTATGAAGGGACAAAGG - Intergenic
1066496334 10:35945979-35946001 CTGGGGCTCTGAATTGTAGGAGG + Intergenic
1067246607 10:44552509-44552531 CAGGGGCTGTGAAGAGAACAGGG - Intergenic
1067743498 10:48914716-48914738 CTGGGTCCATGAGGGGAAGAGGG - Intronic
1067743575 10:48915304-48915326 CTGAGGCTCAGAAGTGAGGAAGG + Intronic
1069083092 10:64109177-64109199 CTGTGACTCTGAAAAGAAGAAGG + Intergenic
1071404575 10:85317811-85317833 CTGGGGAAGTCAAGGGAAGAGGG + Intergenic
1073077134 10:100831142-100831164 CTGGGATTCTGATGGGAAGGAGG - Intergenic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1075333721 10:121594102-121594124 CTGGGACTCTGAGGTGAGGATGG - Intronic
1075741703 10:124700049-124700071 ATGGGGCTCAGAAAGCAAGATGG - Intronic
1076017905 10:127043658-127043680 CTGGGGCACAGACGGGCAGAGGG - Intronic
1076886863 10:133267016-133267038 CTGGGGCCCTGCAGGACAGATGG - Intronic
1077101054 11:822584-822606 CAGGGGCTCCGGCGGGAAGAGGG - Exonic
1077248341 11:1549762-1549784 ATGGGGCTCTGAATGGCAGGTGG - Intergenic
1078562971 11:12389369-12389391 CGAGGGCTCAGAGGGGAAGAGGG - Intronic
1079058531 11:17228221-17228243 CTGGGGTTTTTAAGGGAACATGG - Intronic
1079393132 11:20039453-20039475 CAGGGGCTGGGAAGGGACGAAGG - Intronic
1079710833 11:23680424-23680446 CTGCAGCTATGAAGGGAAGTGGG + Intergenic
1080666046 11:34337257-34337279 CAGGGGCTGTGTAGGGAAGGAGG + Intronic
1080867102 11:36204999-36205021 CTGGGAACCTGAGGGGAAGATGG - Intronic
1080869981 11:36228777-36228799 CTGGGCCTCTGATGGGAACATGG - Intronic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1083139042 11:60706501-60706523 TGGGGGCTCTGGAGGGGAGAAGG - Intronic
1083153985 11:60811188-60811210 CGCGGGCTCTGAAGAGAGGAAGG + Intergenic
1083306425 11:61764290-61764312 CTGGGGCTGGGAAGTGAGGACGG + Intronic
1083307863 11:61770231-61770253 GTGGGGCTCTGCAGGAGAGATGG - Exonic
1083410573 11:62489703-62489725 CTGGAGCTCGGAAGAGAAGCAGG + Intronic
1083439150 11:62664781-62664803 CCGGAGCTCTGCAGGGAGGAAGG + Intronic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1084036680 11:66515623-66515645 CTGGGGCTCAGATGGGATGAAGG - Intronic
1084386554 11:68846505-68846527 GTCCGGCTCTGAAGGGACGACGG - Intergenic
1084438361 11:69157050-69157072 CTGGGCCTCTGATGGCAAGGGGG - Intergenic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1084548759 11:69828232-69828254 CTTGGGGTCTGATGGGCAGACGG + Intergenic
1084671805 11:70611442-70611464 ATGGGGCATTGCAGGGAAGATGG - Intronic
1084929165 11:72540335-72540357 CTGGGGCTCTAAAGGTAGTAGGG + Intergenic
1085406039 11:76262847-76262869 CTGGAACTCTGAAGGGAATAAGG - Intergenic
1086917488 11:92547625-92547647 CTGGGGGTGAGAAGGGGAGAGGG - Intronic
1087002084 11:93431380-93431402 CTGGAGCTTAGAAGGGAAGAGGG + Intronic
1088835934 11:113577996-113578018 CTGGGGCTGAGAAGGGAAAAGGG + Intergenic
1089003796 11:115074157-115074179 CTGGGACTCAGAAGGGAATGTGG + Intergenic
1089383440 11:118052368-118052390 CTGGGGCCCTGCAGGGAAGCAGG + Intergenic
1089556719 11:119319293-119319315 CTGGGTCCCTGCAGGGTAGACGG - Intronic
1090592892 11:128291223-128291245 CTGGGGCTTCTAAGAGAAGAAGG + Intergenic
1090705118 11:129329308-129329330 CTGGAGCTCTGGAGGAGAGATGG - Intergenic
1091349702 11:134883093-134883115 CAGGGGATGTGAAGGGAAGTCGG + Intergenic
1091412567 12:253763-253785 CTGAGGCTCTGAAGAGGAGTTGG + Intronic
1091870569 12:3887208-3887230 CGGGGGCTTTAAAGGGAAAACGG - Intergenic
1092728132 12:11504440-11504462 CTGGGGCTGGGAAGGGCAGCAGG + Intergenic
1093022855 12:14219325-14219347 CGGTGGCTCTGAAAGAAAGAAGG + Intergenic
1093549676 12:20392960-20392982 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
1095690365 12:45081605-45081627 ATGGGTCTCTGATGGGAGGAAGG + Intergenic
1096485017 12:51974192-51974214 CTGGGGCTCGGAAGTGCTGAAGG - Intronic
1096808519 12:54155304-54155326 CTAGAGCTCTGGAGGGAAGAGGG - Intergenic
1097055119 12:56244543-56244565 CTGGGGTTCAGAAAGCAAGAGGG - Intronic
1097107141 12:56632561-56632583 CTGGGGCTCGGAAGGGGTGGGGG - Intronic
1097160951 12:57046428-57046450 CTGGGAGGCTCAAGGGAAGAGGG + Intronic
1098003515 12:65970599-65970621 CTCGGGCTCAAAAAGGAAGAAGG - Intergenic
1098360154 12:69646635-69646657 CTGATGCTCTGCAGGGAAAAAGG - Intronic
1098749059 12:74272312-74272334 CTGGGGCCCTGTTGGGAAAATGG + Intergenic
1101222633 12:102657176-102657198 GTGGGATTCTGAAGAGAAGAAGG + Intergenic
1101301901 12:103491870-103491892 CCAGGACTCTGAAGGGAAAAAGG + Intronic
1101850335 12:108396877-108396899 AGGGGGCCCTGAAGGGAAGGAGG + Intergenic
1102431531 12:112887939-112887961 CTGAGGATCTGATGGGAGGAGGG + Intronic
1102611213 12:114114026-114114048 CTGAGGCTTAGAAGGGCAGAGGG - Intergenic
1102612509 12:114124852-114124874 CTGAGGCTCAGAAGGGCAGATGG - Intergenic
1103483133 12:121264157-121264179 CTGGGGATGTGACGGGAAGGAGG - Intronic
1103649355 12:122421664-122421686 GTGGGGCTGTGCAGGGAGGAGGG + Intronic
1103896965 12:124279428-124279450 CTGGGGCTGGGAAGTGAAGGAGG + Intronic
1104250385 12:127088001-127088023 CTGAGGCTCTGAGCGGAAAAAGG + Intergenic
1104510242 12:129370863-129370885 ATGGGGCTGGAAAGGGAAGATGG + Intronic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104807642 12:131599694-131599716 CAGGGGCTCTGAGGCGGAGAGGG - Intergenic
1104814671 12:131638816-131638838 GAGGGGCTCTGAGGGGAACATGG + Intergenic
1104815654 12:131644174-131644196 CTGTGGCCCTGAAGAGAGGAAGG + Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1105053586 12:133077825-133077847 ATGGTGAACTGAAGGGAAGAAGG - Intergenic
1105899861 13:24745106-24745128 CTGGCGCTTTGCAGGGGAGAGGG - Intergenic
1106726460 13:32491133-32491155 CTGAGATTCTGAAGGGAAAAGGG + Intronic
1107903814 13:45044065-45044087 ATGGGACCGTGAAGGGAAGATGG - Intergenic
1110664659 13:78102364-78102386 CAGCTGCTCTGAAGGGAAGTTGG - Intergenic
1110868604 13:80424214-80424236 CTGAGGCTATGAAGGGCAGCAGG + Intergenic
1112107882 13:96261764-96261786 CTGTGGCTCTGTAGAGAATATGG + Intronic
1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG + Intergenic
1113040740 13:106101495-106101517 CTGAGGGACTGAAGGAAAGAAGG - Intergenic
1113748585 13:112763282-112763304 TTCAGGCTCTGATGGGAAGAGGG + Intronic
1113930417 13:113965311-113965333 CTGTGGCTCTGAGGGCAAAAGGG + Intergenic
1115495623 14:34001539-34001561 CTGGGGCTTTCCAGGGAGGAAGG + Intronic
1115622154 14:35151535-35151557 ATGGGGATATGAAGGAAAGAGGG - Intronic
1117708134 14:58494733-58494755 CTGGGGCTTGGAGGGGAAGAAGG + Intronic
1117881600 14:60318121-60318143 CTGGTGCTGTTATGGGAAGATGG - Intergenic
1118440104 14:65804440-65804462 CTGGGCCTCTGAAGGCAAACGGG + Intergenic
1120964903 14:90158489-90158511 CTGGGGACCAGAAGGGAAGGGGG + Intronic
1121566117 14:94910445-94910467 CTGGGAGCCTGAAGGGGAGAGGG - Intergenic
1121735888 14:96217831-96217853 CTGGGGCTCAGAAGGGACTTAGG - Intronic
1121825592 14:97007568-97007590 CTGGGACCCTGAGGGGAAAAGGG - Intergenic
1121960300 14:98253442-98253464 GAGGGGCTCTGAAGGGAGGGGGG + Intergenic
1122131915 14:99609241-99609263 CTGGGGCTCTGAGAGGACAAGGG - Intergenic
1122284022 14:100640222-100640244 AAGGGGCTCTGCAGGGCAGAGGG - Intergenic
1122408655 14:101514839-101514861 CTGGGCCTCAGAATGCAAGAGGG - Intergenic
1122787130 14:104168939-104168961 CTGGGGGTCTGCGGGGAACAAGG + Intronic
1123772148 15:23539498-23539520 CTGTAACTCTGAAGGGAAAAAGG - Intergenic
1124395094 15:29294078-29294100 CTGGTGCTCAGAAGCAAAGAGGG + Intronic
1124554654 15:30713147-30713169 CAGGGGCTGGGAAGGGAAGTGGG - Intronic
1124631847 15:31342393-31342415 CTGGGTCTCAGGAGGGAAGGCGG - Intronic
1124676594 15:31692533-31692555 CAGGGGCTGGGAAGGGAAGTGGG + Intronic
1125587167 15:40828974-40828996 CTGGGGTCCTGAAGGGTACAGGG + Intergenic
1125790362 15:42360995-42361017 CTAGGGTCCTGAAGGGAAGATGG + Intronic
1126453232 15:48833418-48833440 TTGGGGCACTGAAAGGAAGCTGG - Intronic
1126514619 15:49520984-49521006 CTTGTGCTCACAAGGGAAGAGGG - Intronic
1126706081 15:51406354-51406376 CTGGGGCTCTGCAGCCAGGAAGG + Exonic
1127661050 15:61100515-61100537 CTGGAGCCCTGAAGTGGAGAAGG - Intronic
1128087964 15:64898691-64898713 CTGGGGATCTGGAGGGCAAATGG + Intronic
1128638474 15:69318178-69318200 CAGGGGCTCAGAGGAGAAGAGGG + Intronic
1128744532 15:70104073-70104095 CTGTGGCTCAGAGGGGAGGAAGG + Intergenic
1129111646 15:73340533-73340555 GAGGGGCTGTGAAGGAAAGATGG - Intronic
1129988170 15:79936925-79936947 CTGGGGCTGGGAAAGGAACAAGG - Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130995194 15:88899571-88899593 CTGGGGCTCTGAGGGGAGGGGGG - Intronic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132256938 15:100384238-100384260 TTGAGGCTCTGAAGGGGACATGG + Intergenic
1132463451 16:66848-66870 CTGGGGCTCTGCATGGGTGAGGG - Intronic
1132503593 16:296131-296153 CTGGGGCTCCCGAGGGAACAGGG - Intronic
1132655886 16:1041501-1041523 CTGAGAGTCTCAAGGGAAGAAGG - Intergenic
1132703530 16:1231667-1231689 CTGGGGCTCAGAAGCGGAGGAGG - Intergenic
1132704981 16:1239694-1239716 CTGGGGCTCAGAAGCGGAGGAGG + Intergenic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133050973 16:3117225-3117247 TTGGGGCTTGGAAAGGAAGATGG - Intronic
1133055591 16:3144121-3144143 CTGGGGCTCAGCAGGGAGGCAGG - Intergenic
1133983890 16:10653261-10653283 CTGGAACTCTGGTGGGAAGAGGG + Intronic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1135303809 16:21352269-21352291 GTGGGGCTCTCATGGGAAGGGGG + Intergenic
1136300542 16:29331406-29331428 GTGGGGCTCTCATGGGAAGGGGG + Intergenic
1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG + Intronic
1137943421 16:52710859-52710881 CTGGACCGCTCAAGGGAAGACGG + Intergenic
1138027716 16:53535677-53535699 CTGAGGCTCTGAAGTGTTGAGGG - Intergenic
1138084174 16:54118736-54118758 CGGAGGCTGGGAAGGGAAGAAGG - Exonic
1138086281 16:54136509-54136531 CTGGTGGACTGAAGGGGAGAGGG - Intergenic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1138534629 16:57653349-57653371 CTGGGGCTGTGAGGGGAGGCAGG + Intronic
1138574270 16:57897544-57897566 CTGGGGCAGAGAAGGGAGGAAGG + Intronic
1139591466 16:67935582-67935604 CCAGGGCTGTGAAGGGCAGACGG + Exonic
1139599783 16:67979766-67979788 CTGGGGGTGTGAAGGTCAGATGG + Intronic
1140338124 16:74130854-74130876 CTGAGGCTGGGAAGGGTAGAGGG + Intergenic
1140526309 16:75625791-75625813 CATGAGATCTGAAGGGAAGAAGG - Intergenic
1140657438 16:77155304-77155326 CTGGGGCTCTTCAGGGAAGCTGG + Intergenic
1141693191 16:85607829-85607851 GTGGGGGCCTCAAGGGAAGAAGG - Intergenic
1141696852 16:85624265-85624287 CAGGGCCTCTGGAGGGAGGAAGG + Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141852652 16:86657943-86657965 CTGGTGCTTTGAGAGGAAGAAGG - Intergenic
1142057498 16:88007475-88007497 CAGAGGCTCTCAGGGGAAGACGG - Intronic
1142062274 16:88038198-88038220 GTGGGGCTCTCATGGGAAGGGGG + Intronic
1142157813 16:88540589-88540611 CTGGGGCTCTGAGGGGACAGAGG - Intergenic
1142293296 16:89202250-89202272 CTGGTTCTCGGAAGGGGAGAAGG - Intergenic
1142299486 16:89247980-89248002 CTGGTTCTCGGAAGGGGAGAAGG - Intergenic
1142348203 16:89567607-89567629 CTGTGCCTCTGAAGGGCGGACGG + Intergenic
1143136826 17:4716796-4716818 CTGGGGATGAGAAGGGAAGAAGG - Intronic
1144028600 17:11300406-11300428 CTCGGATTCTGAAGGAAAGAGGG - Intronic
1144129975 17:12237423-12237445 CAGGTGCTCTCAAAGGAAGAGGG + Intergenic
1144956932 17:19023405-19023427 CTTGGGCTCTGCAGAGGAGATGG - Intronic
1145045757 17:19614261-19614283 CTGGAGCTCTACTGGGAAGACGG + Intergenic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1145940483 17:28740996-28741018 CTTGGGCTCTGGAGGTCAGAGGG + Intronic
1146315765 17:31805703-31805725 CTGGGGCATGGAAGGGAGGAGGG + Intergenic
1146399755 17:32493603-32493625 CTGGGGCTCAGTGGGGAAGGTGG + Exonic
1146533991 17:33633896-33633918 CTGGGGCTTTGCACAGAAGATGG - Intronic
1146835418 17:36106827-36106849 CTGGGGCTCTGGAATGATGAGGG - Intergenic
1147308281 17:39578562-39578584 CTGGGTCTCTGCAGGGACCATGG - Intergenic
1147363692 17:39946671-39946693 CTGGGGAGCAGAAGGGGAGATGG - Intergenic
1147646654 17:42038325-42038347 CTGGGGATCTGGAGGGAGGGAGG - Intronic
1147744571 17:42687395-42687417 CTGGAGCTCTGTTGGGAAGCTGG + Intronic
1147905968 17:43823270-43823292 GTGGGGCTTTGAGGGGAGGATGG - Intronic
1147968037 17:44204573-44204595 CTAGGCCTCTGATGGGAAGCAGG - Intergenic
1148535533 17:48435365-48435387 TTGGGGATCTGAAGTGGAGATGG + Intergenic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1148766296 17:50040510-50040532 CTGGGGCTTGGCAGGGGAGAGGG - Intergenic
1148786263 17:50147709-50147731 GTGGGGTTCTGAAGGGAATGGGG - Intronic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1149544897 17:57496259-57496281 CTGTGGCTCTGTAGGGCACACGG - Intronic
1149595323 17:57861808-57861830 CTGGGGCCCTGGAGGGAGGGGGG - Exonic
1150122337 17:62614567-62614589 CAGGCGATCTTAAGGGAAGATGG + Intronic
1150189705 17:63225051-63225073 ATGGGTCTGTGAAGGGTAGAGGG - Intronic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1151038486 17:70829175-70829197 CTTGGGCACTGAAGGGGAAAAGG + Intergenic
1151278768 17:73056108-73056130 TCGGGGCTCTGTGGGGAAGATGG - Intronic
1151820628 17:76494888-76494910 TTGGGGCAATGAAGGGAAGGGGG + Intronic
1152031599 17:77846554-77846576 CAGGGGCTCTGTGGGGAAGGAGG - Intergenic
1152574704 17:81134865-81134887 CTGGGGCTGGGAAGGGAACATGG + Intronic
1152595282 17:81234782-81234804 CTGGGCTCCTGCAGGGAAGATGG - Intronic
1152862250 17:82703221-82703243 CTCTGCTTCTGAAGGGAAGAGGG - Intergenic
1153149553 18:2075647-2075669 CTGGGGCCCTGTCTGGAAGAAGG - Intergenic
1154338048 18:13481722-13481744 CTGAGGCTCTGAAGGGATCCAGG + Intronic
1156114105 18:33766486-33766508 ATGGGGCTTTGGAAGGAAGAAGG + Intergenic
1156479717 18:37428410-37428432 CTGGGTCTCTGTAAGGAAGGAGG + Intronic
1157658455 18:49416917-49416939 CTGGGGCTCTGAAGGGTGTAGGG - Intronic
1158570110 18:58590993-58591015 TGGGGGCTGGGAAGGGAAGAAGG + Intronic
1158928976 18:62302383-62302405 AGGGGGCTCTGATGGGGAGAAGG + Intronic
1159037687 18:63293328-63293350 TTGGGGCTGTGAAGGGAGGGTGG + Intronic
1159347195 18:67221465-67221487 GTGGGGCGGTGAAGGGAAGGAGG - Intergenic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1159883778 18:73885066-73885088 CTCAGGCTCTGCAGGGAACAGGG - Intergenic
1159923632 18:74247817-74247839 CTGGCGCTGAGAAGGGAAGCGGG - Intergenic
1160323686 18:77920086-77920108 CCGGGGCTCAGCAGGGAAGGTGG + Intergenic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1160967483 19:1753071-1753093 CTGGGGGTCTGTAGGGAACGGGG + Exonic
1161220458 19:3115864-3115886 CTGAGGCTGTGAGGGGAGGAGGG + Intronic
1161385028 19:3986818-3986840 TTGAGGCTCTGAAAGGCAGAGGG + Intergenic
1161984319 19:7645358-7645380 CCGGGGCTCTGCAAGGCAGAGGG + Intronic
1161994941 19:7706259-7706281 CTGGGGTTACGAAGGGGAGAAGG + Intergenic
1162103585 19:8355717-8355739 CTGGTGCTCAGAAGGGAACGGGG - Intronic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1163113980 19:15178348-15178370 CTGGAGGTTTGAAGGGAAAAGGG - Intronic
1163427747 19:17248280-17248302 CTGGGGCTCGGCAGGGTACAGGG + Intronic
1165800911 19:38549235-38549257 CTGAGGCTCAGAAGAAAAGATGG - Intronic
1165929157 19:39344845-39344867 CTTGATCTCTGAAGGGAAGAGGG - Intronic
1166190963 19:41176250-41176272 CTGGGGCTCTGAGAGGAGAATGG + Intergenic
1166302644 19:41921204-41921226 CTGGGTCTCTGAGGGGAGGCGGG - Intronic
1166478400 19:43149241-43149263 CTGGAGCTAGAAAGGGAAGAAGG + Intronic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1167084249 19:47298301-47298323 CTGAGGCTGAGAAGGGAAGGTGG - Intronic
1167666185 19:50823818-50823840 GTGGGGCTCTGAGGGGATAAGGG - Intergenic
1167772959 19:51532090-51532112 CTGGGACAGTGAAAGGAAGAAGG + Intergenic
1168105394 19:54162980-54163002 TTGGGTCCCTGAAGGAAAGATGG - Intronic
925142611 2:1560258-1560280 CTGGGGCTCAGCAGTGAAGGGGG + Intergenic
925393096 2:3512432-3512454 CTGAGGCTCTGTAGGGCAGAGGG - Intronic
925905963 2:8539806-8539828 CTGGGGCCCTGCAGCGAGGACGG - Intergenic
926352822 2:12012349-12012371 GTGGGCCTCTGAAGGCCAGAAGG + Intergenic
927707965 2:25308602-25308624 CTGGGTCTCTGAAGAGGTGAGGG + Intronic
928287580 2:30006726-30006748 CTGGATCTCTCAAGGGAAGCTGG - Intergenic
928707494 2:33966123-33966145 ATGGGGCTTTGATGGAAAGACGG + Intergenic
928996719 2:37300363-37300385 CAGAGGCTCTGAAGGGTAGTGGG + Intronic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929339792 2:40801504-40801526 GTGGAGCTATGAAGGGAGGAAGG - Intergenic
929882310 2:45847674-45847696 CTGGGGCCATGAATGGAAGCAGG - Intronic
931211327 2:60198842-60198864 CAGGGGTTCAGAAGGAAAGAAGG + Intergenic
931396315 2:61890894-61890916 CTGGTCCTCTGAAGAGAAGTCGG - Intronic
931428576 2:62192537-62192559 CTGGGGCTCTGAGGAGAGGCTGG - Intergenic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
932186385 2:69699795-69699817 TTGAGGCTTTCAAGGGAAGAGGG + Intronic
932404969 2:71506729-71506751 CTGAGGCTCTTAAGGGAAAGTGG - Intronic
932418584 2:71588217-71588239 CTGGGGGTCTGAATGGGAGAAGG + Intronic
932764461 2:74461215-74461237 CTCTGGCTCTGAAGGGACAAAGG - Exonic
933700774 2:85254022-85254044 ATGGGGCTCTCATGGCAAGAGGG - Intronic
933711597 2:85330170-85330192 CAGAGGCTGGGAAGGGAAGATGG + Intergenic
935580618 2:104753067-104753089 CTGTGGCTGGGAAGGGTAGAGGG + Intergenic
937104108 2:119294382-119294404 ATTTGGCTGTGAAGGGAAGATGG + Intergenic
937437331 2:121891223-121891245 TTTGGTATCTGAAGGGAAGAGGG + Intergenic
938870743 2:135473750-135473772 CTGGGGGTCTAAAAGAAAGATGG - Intronic
941456839 2:165719123-165719145 CTGAGGCTCTGAAAGGAATAAGG + Intergenic
942229591 2:173847691-173847713 GAGGGGCTCTGGAGGGCAGAAGG + Intergenic
942848159 2:180451056-180451078 CTGAGGCTGGGAAGGGTAGAAGG - Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
945178993 2:207072481-207072503 CAGGGGCTTTGAAGTGAGGAGGG - Intergenic
945915052 2:215694806-215694828 CTGGGGATGGGAGGGGAAGAGGG + Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946419415 2:219556578-219556600 CTGGGGCCCTGGAGTGACGACGG + Exonic
946848876 2:223885805-223885827 CTGTGGCTGGGAAGGGAAGGGGG - Intronic
947949168 2:234133133-234133155 CTTGGGCTCTGTAGGGAGGCAGG - Intergenic
948476161 2:238221261-238221283 CTGGGCCTGTGAGGGGAGGAGGG + Intergenic
948644419 2:239394887-239394909 CTGGGGCTCTGTAGGATTGAGGG - Intronic
948671560 2:239571771-239571793 GTGAGCCTCTGATGGGAAGAGGG + Intergenic
948672588 2:239578031-239578053 CTCGGGCTATGAAGGGTAGGAGG + Intergenic
948781436 2:240324170-240324192 CTGGGGCCCCGAAGGGCCGAGGG - Intergenic
948809512 2:240467517-240467539 CTGGGGCACAGGAGGGAAGGAGG - Exonic
1168951590 20:1805526-1805548 CTGGGGATGAGAAGGGAAGGTGG + Intergenic
1169150572 20:3286243-3286265 CTGGGGCTGTGATGGGACAAAGG + Intronic
1169276570 20:4237096-4237118 ATGTGGATCTGAAGGGGAGAGGG + Intronic
1171021049 20:21584426-21584448 GTGGGGCTCCCCAGGGAAGATGG - Intergenic
1171116771 20:22531565-22531587 CTGAAGCTCTGAAAGGAACATGG + Intergenic
1171229776 20:23475169-23475191 GTGGGGCTCTGAAGGGTGCAAGG - Intergenic
1171415802 20:24979703-24979725 GTGGGGCTCTGAATAGAGGAAGG - Intronic
1171966964 20:31537871-31537893 CAGGGGTTCTGAAGGGATAAGGG - Intronic
1172188153 20:33044327-33044349 CTTGGGATCTGGAGGGAAGCTGG + Intergenic
1172230747 20:33334037-33334059 CTGAAGATCTGATGGGAAGATGG - Intergenic
1172245653 20:33443617-33443639 CGGGGGCTCGGAGGCGAAGATGG - Exonic
1172392998 20:34578977-34578999 CTGAGGCTCTGAAGGGAAAGTGG - Intronic
1172614684 20:36275347-36275369 CTGGGGCTCTGGAAGGAGGCAGG + Intergenic
1172786958 20:37474728-37474750 CTGGGGCTCGGCAGGGATGGAGG - Intergenic
1173285855 20:41670924-41670946 CTGGGCCTCTGAAGGGAACCTGG - Intergenic
1173860134 20:46277860-46277882 GTTGGGCTTTGAAGGGAAGGAGG + Intronic
1173936593 20:46871327-46871349 CTTGGGCTATGAAGAGAACAGGG - Intergenic
1174503371 20:51001546-51001568 CTGGGGTTGTGCAGGGAAGCCGG - Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1175582797 20:60113430-60113452 CTGGTGCTCAGCAGGCAAGAAGG + Intergenic
1175825644 20:61935097-61935119 CTGTGGCTCTGCAGGGATCACGG + Intronic
1176139982 20:63540753-63540775 TTGGCGCTCTGCAGGGAGGAGGG + Intergenic
1176298735 21:5088511-5088533 CTGGGGTGGTGAAGGGGAGAGGG - Intergenic
1176656285 21:9591409-9591431 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1178797521 21:35758630-35758652 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
1179050917 21:37888009-37888031 CTGGAGCTGTGTAGGGAAGGTGG + Intronic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1179273399 21:39868926-39868948 CTGGGGCTCTGAAATAGAGATGG + Intronic
1179407551 21:41137961-41137983 TTGGGGCTGAGAATGGAAGAGGG - Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1179858291 21:44173438-44173460 CTGGGGTGGTGAAGGGGAGAGGG + Intergenic
1180244776 21:46539642-46539664 CTGGTGCTCCAAAGGGCAGAAGG - Intronic
1180706602 22:17814163-17814185 CAGGGGCTCTAAAGTGAGGATGG - Intronic
1180713980 22:17859056-17859078 CTGGGGGGCTGAGGGGAGGAAGG + Intronic
1181572096 22:23773150-23773172 CTGGGGGTGTGAAGGGGAGCCGG + Intronic
1183072282 22:35404725-35404747 CTGGGGCTCTCAAAGAAAGCAGG - Intronic
1183376119 22:37466468-37466490 CTGAGGCACAGAAGGGGAGAAGG - Intergenic
1183582976 22:38736496-38736518 CTGGGGCTCTGAAGAGAACCAGG + Intronic
1184838813 22:47040535-47040557 GTGTGGCTCTGATGGGGAGAGGG + Intronic
1184946963 22:47810699-47810721 TTGGGGTTCTGAAGGGACGGGGG + Intergenic
1185070643 22:48654004-48654026 CGGCGGCTCTGGAGGGAAGGGGG + Intronic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185108780 22:48889340-48889362 CGGGGGCACTGGAGGGGAGAGGG - Intergenic
949115498 3:316144-316166 ATGTGGCTGGGAAGGGAAGATGG + Intronic
949482800 3:4510106-4510128 CTGGGGCTGTGAAGGTGAGTGGG + Intronic
950111714 3:10422981-10423003 CTGGGGATCTGAGTGGAAGGTGG + Intronic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
951707475 3:25557855-25557877 TTGGAGCTCTGCAGGGAATAGGG - Intronic
952314789 3:32223333-32223355 TTGGGGATCTGAAGGGAGTATGG + Intergenic
952976966 3:38704854-38704876 TTGGGGCTCCTAAGGGGAGAAGG + Intronic
952980121 3:38727536-38727558 CTGTGGCTCTGCAGGGATGGTGG + Intronic
953117975 3:40011377-40011399 CTAGGTCACTGAAGGAAAGAAGG - Intronic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
957205186 3:77188428-77188450 CTGGGGCACTGATGAGAAGCAGG - Intronic
957916420 3:86693449-86693471 CTGGGTCTCTGTGGGGATGATGG + Intergenic
958568249 3:95844171-95844193 CAGAGGCTCAGAAAGGAAGAGGG + Intergenic
959063367 3:101635155-101635177 CTGGGGCTCTTCAGAGAAGGGGG - Intergenic
959995424 3:112675444-112675466 CTGGAGATCGCAAGGGAAGAGGG + Intergenic
960220869 3:115106798-115106820 CTGGGGGGCAGAGGGGAAGAAGG - Intronic
960229061 3:115203265-115203287 CTGGGACTCTGACAGGAAGTGGG + Intergenic
960300753 3:115999774-115999796 CTCGGGCTCTCATGGGAAGGAGG + Intronic
960690086 3:120337704-120337726 ACAGGACTCTGAAGGGAAGAAGG - Intronic
960844381 3:121993293-121993315 CTGGAGCTCTGAAGAGGACAAGG - Exonic
960969609 3:123130268-123130290 CTGGGGCTTTGCGGGGAAGGTGG + Intronic
961683960 3:128617088-128617110 CTGGGGATCTGAATGGGAGTGGG + Intergenic
961824291 3:129590769-129590791 CTGAGGCTCAGAGGGGAAAATGG + Intronic
962416931 3:135191839-135191861 CTGGGCCTCTGCAGGAAAGCCGG - Intronic
962525146 3:136231238-136231260 CTGTAGGTCTGAAGTGAAGAAGG - Intergenic
963018573 3:140849545-140849567 CTGGGGCTCAGAAGGGTTGGAGG - Intergenic
963470827 3:145739832-145739854 CTGAAATTCTGAAGGGAAGAAGG + Intergenic
964148310 3:153493172-153493194 CAGAGGCTGTGAAGGGTAGAAGG + Intronic
964793485 3:160474196-160474218 ATGTGGCTCTGAAGGGGAGGAGG - Intronic
966917509 3:184593163-184593185 CTTGGGCTGTGATGGGAAAAAGG + Intronic
967085121 3:186087997-186088019 CCTGCGGTCTGAAGGGAAGAAGG + Intronic
967887993 3:194346223-194346245 CCCGGGCTCTGCAGGGAAGATGG + Intronic
968751670 4:2393121-2393143 CTGGGGCTCTGCAGATGAGATGG - Intronic
969344466 4:6562587-6562609 CTGGGCCCCTGAAGGGAGGAGGG + Intronic
969495091 4:7521953-7521975 CTGTGCCACTGAAGGGAAGCCGG - Intronic
969525597 4:7702457-7702479 CTGAGGCTCTGAGGGGTGGAGGG - Intronic
970578154 4:17447845-17447867 CTTGGGCTCTGAAGTGAAACTGG + Intergenic
971349690 4:25844812-25844834 ATGGGGCTCTGCCTGGAAGAGGG + Intronic
971884253 4:32423388-32423410 CTGAGGCCCTGAAGGGCAGGAGG + Intergenic
972354064 4:38264088-38264110 CTAGGGCTCTAAAGGGAAATGGG - Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
974062330 4:57046654-57046676 CTGGAGCTCTTAATGGAACAAGG - Intronic
976189903 4:82477813-82477835 CTGGGGCTCTGAGAGGGTGATGG - Intergenic
976212091 4:82681616-82681638 CTGGGGCTATCAAGGGTGGAGGG + Intronic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
982138788 4:152297640-152297662 CTGGGACTCAGAAGAGAAAAGGG - Intergenic
982176814 4:152713443-152713465 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
984615918 4:181897112-181897134 CTGGCAGGCTGAAGGGAAGAAGG - Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
984644988 4:182209743-182209765 CTGGGGCTTTGAGAGGTAGATGG + Intronic
984833831 4:184000580-184000602 CTGGGGCACAGAAGCGAAGGGGG - Intronic
985139429 4:186823742-186823764 TTGGTGCTCTGAAGGGTGGAGGG - Intergenic
985864481 5:2503526-2503548 TTGCAGCTGTGAAGGGAAGAGGG + Intergenic
986963371 5:13242095-13242117 CAGGGGCTCTGTCGGGAACATGG - Intergenic
987503513 5:18743195-18743217 CAGTGGCTCTGAAAGAAAGAAGG - Intergenic
989427482 5:41313504-41313526 CTGAGTCTCTGAAGGGAATAGGG - Exonic
991125705 5:63067493-63067515 CTGGGGGACTGAAAGGGAGAGGG - Intergenic
993449004 5:88051400-88051422 ATGGCTCTCTGAAGAGAAGAGGG + Intergenic
993971948 5:94430214-94430236 CTGGTGCTCTGAATGTATGAAGG + Intronic
994147298 5:96409685-96409707 CAGGGGCTCTGAAGACAAGTGGG + Intronic
994340097 5:98617005-98617027 CAGAGGCTCAGAAAGGAAGAGGG - Intergenic
995947970 5:117672906-117672928 CTTTGGCTGTGAAGGGAAAAGGG - Intergenic
998167439 5:139852198-139852220 CTGGTGCTCCCGAGGGAAGAAGG + Intronic
998817750 5:146031101-146031123 TTTGGGCCCTGTAGGGAAGAAGG + Intronic
999089261 5:148921052-148921074 CTGGGGATGTGAAGGTAAGGAGG + Intergenic
999254235 5:150200929-150200951 CTGGGTGTGTGAAGGGAGGAGGG + Intronic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
1000224838 5:159250470-159250492 CTGGGCCACAGAAGGGAAGTGGG - Intergenic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1001317052 5:170651072-170651094 CTCTGCCTCTGAAGGGCAGAGGG + Intronic
1001546571 5:172574211-172574233 CGGGGACTCAGAAGGAAAGAAGG - Intergenic
1001581728 5:172803135-172803157 CTGGAGCACTGTTGGGAAGAGGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1001953925 5:175835047-175835069 CTGAGGCTGTGAAGGCAAGCAGG + Intronic
1002102869 5:176866039-176866061 CTGGGGCTCTGAGGCCAAGCTGG - Intronic
1002874882 6:1201965-1201987 CTGGGTCTCTGAGGTCAAGATGG - Intergenic
1003368022 6:5495542-5495564 CTGGAGCTAGGAAGGGAAAATGG + Intronic
1004280120 6:14273407-14273429 CTGTGCCTCTGAATGGAAAATGG + Intergenic
1005907559 6:30277748-30277770 GTGGGGGGCTGAAGGGAAGGTGG - Intergenic
1006437247 6:34032520-34032542 CTGGGCCTCTGAACGGGAGGCGG - Intronic
1006615020 6:35320307-35320329 CAGGGGCTTGGAAGGGTAGAAGG - Intronic
1007078564 6:39083223-39083245 CTGGTGCTCTGAAGGGAGACAGG - Intronic
1007683225 6:43648800-43648822 CTGGGGCTCTGGAAGGCAGGTGG + Intronic
1007742384 6:44020807-44020829 GTGGGGCTCTGAAGGAAGGAAGG + Intergenic
1012934428 6:105351281-105351303 CTGGAGCTCTGAATGGATCATGG + Intronic
1013512371 6:110856766-110856788 TTCAGGCTCTGGAGGGAAGAAGG + Intronic
1013580654 6:111531011-111531033 GTGGGGCACTGAACAGAAGAGGG - Intergenic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1014778513 6:125537435-125537457 CTGGTGCTGTGGAGTGAAGAAGG - Intergenic
1016292157 6:142537961-142537983 CTGAGGCTTTGAAGGGAGAAGGG - Intergenic
1017094080 6:150788824-150788846 CCTGGGCTCTAAAAGGAAGAAGG - Intronic
1018266909 6:162035029-162035051 CTGAGGCTCTTAAGAGAAGCAGG - Intronic
1018605308 6:165591477-165591499 CTTGGGTTTTGAAGGGAAGATGG - Intronic
1018988824 6:168658086-168658108 CTGGGGGACTGATGGGGAGATGG + Intronic
1019096304 6:169582836-169582858 CTGGGGCGCTGATGGGTTGAAGG + Exonic
1019256820 7:57580-57602 CTGGGTTTCAGAAGGGAGGATGG + Intergenic
1019512737 7:1426116-1426138 CCGGGGCTCTGCAGGGACGTGGG - Intergenic
1019571827 7:1716434-1716456 CTAAGGCTCTGGAGGGAGGATGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1020040911 7:5000207-5000229 TTGAGGCTTTCAAGGGAAGAGGG + Intronic
1020168098 7:5823652-5823674 CTGGGTCTCTAGGGGGAAGAAGG + Intergenic
1020283541 7:6663779-6663801 GTGGGGGGGTGAAGGGAAGAGGG + Intergenic
1021673563 7:23057821-23057843 CTGGATCTGGGAAGGGAAGAAGG - Intergenic
1021788304 7:24174619-24174641 CTGGTGCTGTGAAGGGAAAGTGG + Intergenic
1021964613 7:25905410-25905432 TTGGAGTTCAGAAGGGAAGAGGG + Intergenic
1022360084 7:29649361-29649383 CTGGGGCTGTGAACGTATGAGGG + Intergenic
1022880997 7:34587256-34587278 CTGTTGATCTGAAGGGAACATGG - Intergenic
1023057588 7:36302379-36302401 CCGGGGCTGGGAGGGGAAGAAGG + Intergenic
1023706955 7:42950996-42951018 CTGGGCCTTTGAAGAGAAGTTGG - Intergenic
1024229903 7:47355847-47355869 CTGAGGCTCTGCTGGGAAGTGGG + Intronic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024292110 7:47812260-47812282 CTGGGCTGCTGCAGGGAAGAGGG - Intronic
1024531301 7:50394609-50394631 CTGAGGCTCAGAAGGGGTGATGG + Intronic
1025228962 7:57186741-57186763 CTGGAGCTCAGAAGTGAAAAGGG - Intergenic
1026120476 7:67532499-67532521 CTGTGGCCCTGAAGGGACGCAGG + Intergenic
1026911897 7:74095849-74095871 GTGGGGCCTTGAAGGGCAGATGG - Intronic
1027221660 7:76218033-76218055 CTGAGGCTCAGAAAGGAAAAGGG + Intronic
1027724840 7:81791036-81791058 CTGGGAATCTTCAGGGAAGAGGG - Intergenic
1029298894 7:99562975-99562997 CTGGGGATCTTAAGGGGTGAGGG - Intronic
1029599179 7:101553779-101553801 CTGGGGGACTGAAGGGGACAGGG + Intronic
1030029997 7:105360268-105360290 GTGTGTCTCTGAAGGTAAGATGG + Intronic
1031009395 7:116509770-116509792 CTTGGGTTCTGCAGGGATGACGG + Intergenic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032087606 7:128892033-128892055 GTGTGTCTCTGAGGGGAAGAAGG + Intronic
1032853423 7:135814539-135814561 CTGCGGCTGTGAAAGCAAGAGGG - Intergenic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1034276854 7:149827656-149827678 CTGTGGCTGAGAAGGCAAGATGG + Intergenic
1034527574 7:151675466-151675488 GTCGGGCTCTGGAAGGAAGACGG + Exonic
1034944174 7:155251208-155251230 CTGGGGCACTGGAAGGCAGATGG + Intergenic
1035130689 7:156650451-156650473 GTGGGGTTCTAAAGGCAAGATGG + Intronic
1035309254 7:157954696-157954718 CTGGGGCTCGGCAGGGAGGCGGG - Intronic
1036160911 8:6387883-6387905 CTAGGGCTCTGAAAGGAGCAAGG - Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1037123752 8:15320142-15320164 CTGGAACTCTGAAGGGAGTAAGG - Intergenic
1037998425 8:23369829-23369851 GTGTGGCTCTGAAGGGAATCAGG + Intronic
1039455261 8:37701732-37701754 GTGGGTCTCTGAAGGAAAGAGGG - Intergenic
1040031655 8:42830327-42830349 ATGGGGCTATGAATGGGAGATGG + Intergenic
1041005976 8:53497335-53497357 CTGAGGCTCTGCAGGGCAAAGGG - Intergenic
1041132860 8:54721341-54721363 CTGGAGCTCTGAAGGGAAACAGG + Intergenic
1041383699 8:57278379-57278401 CTGGGGCCCAGAGGGGAAGCGGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042794605 8:72647655-72647677 CTGGGTCTTTGAAAGGGAGAAGG + Intronic
1043912649 8:85880954-85880976 CTAAAGCTCTGTAGGGAAGATGG + Intergenic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1044684942 8:94817444-94817466 GTTTGGCTCTGAAGAGAAGAGGG - Intronic
1044722814 8:95167445-95167467 ATGCGGCTCTGCAGGGAAGGGGG - Intergenic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045981014 8:108187344-108187366 CAGGTGGTCAGAAGGGAAGATGG - Intergenic
1046481268 8:114821617-114821639 CTGGGGCTCTACAGGGCAGTGGG + Intergenic
1046768598 8:118097003-118097025 CTGAGGCTCTGAAGGTATAATGG + Intronic
1047251327 8:123183580-123183602 CTGGGGATCAAAATGGAAGAGGG - Intronic
1047874160 8:129116709-129116731 CTGGGTCTCTAAATGGAAGATGG + Intergenic
1048730688 8:137437508-137437530 ATGGGGCTAAGAAAGGAAGAGGG - Intergenic
1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG + Intergenic
1049589315 8:143449059-143449081 CTGGGGCTGTGCAGGGCAGTGGG + Intronic
1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG + Intronic
1050301559 9:4264016-4264038 CTGGAGCTCTGGAGTGAAGTGGG - Intronic
1051318577 9:15872738-15872760 CTGTGGTTCAGAAGGGTAGAAGG + Intronic
1052321182 9:27169480-27169502 CCGGGGCACTGAATGGATGAAGG - Exonic
1052787344 9:32841625-32841647 CTGGAGCTCTAAAGGGCAGAAGG - Intergenic
1053199557 9:36143256-36143278 CTGGGGCTCTGAAGAGGAGGGGG - Intronic
1055241409 9:74190858-74190880 CTGGAGATCTCAATGGAAGAAGG - Intergenic
1055610637 9:78020737-78020759 GTGGGGCTTGGAAGGGCAGAGGG - Intronic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1056040061 9:82656128-82656150 CAGAGGCTGGGAAGGGAAGAAGG + Intergenic
1056198659 9:84253279-84253301 ATGAGGCTGTGTAGGGAAGAGGG - Intergenic
1056628444 9:88273307-88273329 CTGGTTCACTGTAGGGAAGAGGG + Intergenic
1056647615 9:88428334-88428356 CGGGGACTCTAAAGGGAAGGAGG - Intronic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1057507785 9:95650198-95650220 GTGGGGCTCTGACTGCAAGAAGG - Intergenic
1057702869 9:97376334-97376356 CTGGGGCTTGGAGGGGAAGCTGG - Intronic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1060206755 9:121686819-121686841 CTGGGGCTCTGGAGGAAATGTGG - Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1060888033 9:127169293-127169315 CTGGGGCTCTACGGGGAAGGAGG - Intronic
1061218515 9:129235697-129235719 CTGGGACGCTGGAGGGATGAGGG - Intergenic
1061412717 9:130430018-130430040 CTGGGGCACTGAAGGGCTGAGGG + Intronic
1061417975 9:130458332-130458354 CTGGGGCTCTGTATGCCAGATGG + Intronic
1061497122 9:130981516-130981538 CTGTGGCCCTGAGGGGAAGTGGG - Intergenic
1061520981 9:131117692-131117714 CTGGGGCTTAGCAGGGAAGCTGG - Intronic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1061670352 9:132185011-132185033 CTGGGGCTCTGAGGAGGAGCTGG + Intronic
1062249192 9:135585846-135585868 CTGGGGCCTGGGAGGGAAGATGG - Intergenic
1062288372 9:135783758-135783780 GTGGGGCTCTGATGAGAAGGTGG - Intronic
1062388441 9:136324497-136324519 CTGGGGCTCTGGACGGAGGTGGG - Intergenic
1203745362 Un_GL000218v1:38200-38222 CTGAGGCTCAGATGGGCAGATGG - Intergenic
1203564746 Un_KI270744v1:81284-81306 CTGAGGCTCAGATGGGCAGATGG + Intergenic
1203634001 Un_KI270750v1:94891-94913 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1185767049 X:2733752-2733774 CTAGGACACTGCAGGGAAGAGGG - Intronic
1187178770 X:16922322-16922344 CAGAGGCTGGGAAGGGAAGAGGG + Intergenic
1187291652 X:17960091-17960113 CTAGGACTATGAAGGCAAGAAGG + Intergenic
1187468912 X:19551299-19551321 GTGGCGCTCTGAAGCCAAGAGGG + Intronic
1188947288 X:36321386-36321408 GTGGGGCCATGAGGGGAAGAGGG + Intronic
1189579304 X:42388929-42388951 GTGGGGTTGGGAAGGGAAGATGG + Intergenic
1190723716 X:53172360-53172382 CTGGGGCACTGGAAGTAAGATGG - Intergenic
1192268728 X:69558337-69558359 CTTTGGGTCTGAAGGCAAGATGG + Intergenic
1193312466 X:80024493-80024515 CTGGTGGTCAGAAGGGAAGCGGG + Intronic
1194887921 X:99340883-99340905 CAGAGGCTCAGAGGGGAAGAGGG - Intergenic
1195210851 X:102651582-102651604 CTGGGCCTCTGAAGGCAAGTAGG + Exonic
1195221143 X:102746161-102746183 CTGGGCCTCTGAAGGCAAGTGGG + Exonic
1195481031 X:105345461-105345483 CTGGGTCTCAGAAGGGCAGGAGG - Intronic
1195619583 X:106939607-106939629 ATGAGGCTTTAAAGGGAAGAAGG - Intronic
1196883187 X:120218995-120219017 CAGAGGCTGTGAAGGGTAGAGGG + Intergenic
1197907585 X:131442842-131442864 CTGGGGCTAAGCAGGGGAGAAGG + Intergenic
1197911838 X:131491388-131491410 CTGGGGCTAAGCAGGGGAGAAGG + Intergenic
1198532769 X:137562105-137562127 CTGGGACTCTGAAGAGAGGGTGG + Intergenic
1198627686 X:138596856-138596878 CTGGGGCTGTGCAGGGGAAAAGG + Intergenic
1198766135 X:140080895-140080917 CTTAGACTCTGAAAGGAAGAAGG + Intergenic
1199996372 X:153029101-153029123 CTGGGGCTATGCAGGGAAACTGG - Intergenic
1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG + Intergenic
1201158681 Y:11153211-11153233 CTGAGGCTCAGATGGGCAGATGG - Intergenic
1201396555 Y:13554897-13554919 CTGAGACTCTGAAGAGAAAATGG + Intergenic
1201947361 Y:19526486-19526508 CTGAGGCCCTGAAGGGCTGAGGG - Intergenic