ID: 915616316

View in Genome Browser
Species Human (GRCh38)
Location 1:157042270-157042292
Sequence CTGTCTTGGGGCTCCTACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915616316_915616322 10 Left 915616316 1:157042270-157042292 CCAAGGTAGGAGCCCCAAGACAG 0: 1
1: 0
2: 0
3: 8
4: 173
Right 915616322 1:157042303-157042325 GGGAAGACCTTGACTGCTGACGG 0: 1
1: 0
2: 1
3: 15
4: 148
915616316_915616323 11 Left 915616316 1:157042270-157042292 CCAAGGTAGGAGCCCCAAGACAG 0: 1
1: 0
2: 0
3: 8
4: 173
Right 915616323 1:157042304-157042326 GGAAGACCTTGACTGCTGACGGG 0: 1
1: 0
2: 0
3: 9
4: 90
915616316_915616320 -10 Left 915616316 1:157042270-157042292 CCAAGGTAGGAGCCCCAAGACAG 0: 1
1: 0
2: 0
3: 8
4: 173
Right 915616320 1:157042283-157042305 CCCAAGACAGAAAAGTAGAAGGG 0: 1
1: 0
2: 4
3: 29
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915616316 Original CRISPR CTGTCTTGGGGCTCCTACCT TGG (reversed) Intronic
901135386 1:6989693-6989715 CTGGCATGGGGGTGCTACCTCGG + Intronic
901380527 1:8870680-8870702 CAGTCTGAGTGCTCCTACCTAGG + Intronic
902639316 1:17756313-17756335 CTTTCTTGGGGACTCTACCTTGG + Intronic
906022888 1:42646651-42646673 CTGTCTAGGGGCTCATGCCCAGG - Intronic
912930226 1:113951966-113951988 CTGTCTTGGGTCTCCTAGGCTGG + Intronic
914848872 1:151299297-151299319 CTGTCTTGGGCTTTCTACTTAGG - Intronic
915170481 1:153973810-153973832 CTGTCTAGGGTCTCCCACCCAGG + Intronic
915616316 1:157042270-157042292 CTGTCTTGGGGCTCCTACCTTGG - Intronic
920420201 1:205827908-205827930 CTGTCCTTGGGCTCCTCCCAAGG - Intergenic
921069548 1:211647871-211647893 CTGGCTTGGTGCTCCTGGCTTGG + Intergenic
921670704 1:217920886-217920908 CTTTCTTGGGGCTCCTTCAGAGG - Intergenic
1067096858 10:43307297-43307319 CTGTCTGGGGGCTCCTAGTGTGG - Intergenic
1069314756 10:67083361-67083383 CTTTCTTGGGGCTACCATCTAGG + Intronic
1072561668 10:96581920-96581942 TTGATTTGGGGGTCCTACCTAGG - Intronic
1072767404 10:98106737-98106759 TGGTCTTGTGGCTCCTACCCAGG + Intergenic
1073627309 10:105112674-105112696 CTGCCTTGGCGCTACTCCCTGGG - Intronic
1075906512 10:126086308-126086330 ATGTCCTGGGGCTTCTACTTAGG + Intronic
1077530855 11:3094132-3094154 CTGCCTTGGGGAACCTTCCTTGG + Intronic
1077613646 11:3660188-3660210 CTGCCTTGGGGCCCCTATCAAGG + Exonic
1077914179 11:6600468-6600490 ATGTCTTGGGGCCCTCACCTTGG + Exonic
1083360392 11:62103310-62103332 CTATCTGAGGGCTGCTACCTAGG + Intergenic
1083749426 11:64753242-64753264 CTGCCCTGGGGCCCCTACCCTGG + Intronic
1084341609 11:68507295-68507317 AAGTCTTGGTGTTCCTACCTCGG + Intronic
1095465827 12:42487301-42487323 CTGCCTTGGGGCCCTTCCCTGGG - Intronic
1095575542 12:43734086-43734108 CATTCCTGGGGCTCCTTCCTGGG - Intronic
1096354891 12:50932198-50932220 ATGTTTAGGGGCTCTTACCTAGG - Exonic
1098396831 12:70028473-70028495 GTATCTTGGGGCTCTTGCCTTGG + Intergenic
1098640342 12:72831383-72831405 TTGTCATGGGTCTCCTAACTTGG + Intergenic
1101693928 12:107106872-107106894 CTTTCTTAGGGCTGCGACCTGGG - Intergenic
1102582468 12:113899314-113899336 CTCTATTGTGGCTCCTGCCTCGG - Intronic
1103194529 12:119031115-119031137 TTCTCTTAGGGCTCCAACCTAGG + Intronic
1105273493 13:18900216-18900238 GTGTCTGGGAGCTCCTGCCTGGG - Intergenic
1106976219 13:35219674-35219696 CTCTCTTGGTTCTCCGACCTTGG - Intronic
1112911302 13:104487728-104487750 CTGTCTTAGTACTCCTTCCTGGG - Intergenic
1113302500 13:109037455-109037477 CTGTCTTGAGGCTGCTAAATAGG - Intronic
1113427774 13:110223783-110223805 CTCTCTGGGGGTTCCTGCCTGGG + Intronic
1113650664 13:112032093-112032115 CTGGCATGGGGCTCTTTCCTCGG - Intergenic
1114080483 14:19198787-19198809 CTGTCTCTGAGCTCCTTCCTGGG - Intergenic
1114757092 14:25271591-25271613 CTTTATTAGGGCTCCAACCTTGG - Intergenic
1118891283 14:69911295-69911317 CTCTCCTGGGCCTTCTACCTTGG - Intronic
1120745294 14:88146534-88146556 CTGTCCTGGGGTTCTTGCCTTGG - Intergenic
1121315591 14:92959291-92959313 CCGTCTGGTGGCTCCTTCCTGGG - Intronic
1122663970 14:103316262-103316284 CTGACTGGGGCCTCCTTCCTTGG + Intergenic
1122859017 14:104573964-104573986 CTGTCCTGGGCCTGCCACCTTGG - Intronic
1123458609 15:20447349-20447371 CTTCCTTGGGGCCCCTTCCTGGG - Intergenic
1123659454 15:22553060-22553082 CTTCCTTGGGGCCCCTTCCTGGG + Intergenic
1124264901 15:28223519-28223541 CTTCCTTGGGGCCCCTTCCTGGG - Intronic
1124313318 15:28647555-28647577 CTTCCTTGGGGCTCCTTCCTGGG + Intergenic
1125029449 15:35061638-35061660 CTGTCTTGTGGCCCCCACCCAGG + Intergenic
1126218651 15:46186287-46186309 CTGTCTTGGGCTTTCTTCCTGGG + Intergenic
1126699248 15:51353134-51353156 CTGTCTTGTGGCCCCCATCTAGG + Intronic
1127292288 15:57581456-57581478 CTGTCCTGGTCCTCATACCTGGG + Intergenic
1128084563 15:64877038-64877060 CTTCCTTGAGGCTCCAACCTGGG - Intronic
1128151936 15:65368629-65368651 GGGTCTTGGGTCTCCTGCCTTGG - Intronic
1130927997 15:88399354-88399376 CTGTCCTGGGGCTCCTCTCTAGG - Intergenic
1131046327 15:89318805-89318827 TTCTCTTGGGGCTTCTACCCTGG - Intronic
1131691265 15:94830484-94830506 CTTCCTTGGGGCTCAGACCTCGG + Intergenic
1132939351 16:2499257-2499279 CTGTCTTGGGGCGAAGACCTGGG - Intronic
1135164258 16:20124754-20124776 CTGTAGTCGGGCTCCTACCTCGG + Intergenic
1136390572 16:29961909-29961931 CTTTCTGGTGGCTCCTTCCTTGG + Intronic
1136703046 16:32160635-32160657 CTTCCTTGGGGCCCCTTCCTGGG - Intergenic
1136764653 16:32766961-32766983 CTTCCTTGGGGCCCCTTCCTGGG + Intergenic
1136803446 16:33103423-33103445 CTTCCTTGGGGCCCCTTCCTGGG - Intergenic
1137686213 16:50388734-50388756 CTGTTGTGGGCCTCCTACCCTGG + Intergenic
1138681214 16:58684699-58684721 CTGTCTCCGGCCACCTACCTTGG + Exonic
1139900456 16:70323965-70323987 TTGTCTTAGGGCTTCTGCCTTGG - Intronic
1203067010 16_KI270728v1_random:1029086-1029108 CTTCCTTGGGGCCCCTTCCTGGG + Intergenic
1143465511 17:7133850-7133872 GTGTCCTGGGGTTCCTGCCTTGG + Intergenic
1144684148 17:17215167-17215189 CTGCCTGGGGGCACCCACCTCGG + Exonic
1144807679 17:17978536-17978558 CTGTCTTGGGGCCCCTAGGCTGG + Intronic
1145037754 17:19553084-19553106 CTGTCCTGGGGCCCTTCCCTAGG + Intronic
1148392234 17:47280819-47280841 CTCTGTTGTGGCTCCTCCCTAGG + Intronic
1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG + Intronic
1151011381 17:70501675-70501697 TTGTCTTGAGGCCCCTCCCTAGG - Intergenic
1151137489 17:71961192-71961214 TTGTATTGGGGCTACTACCCAGG - Intergenic
1152614877 17:81333455-81333477 TGGTCTTGGGGCTCCTACGGGGG + Intergenic
1154367217 18:13722189-13722211 CTGACTTGGGGGTCCTAATTGGG - Intronic
1154465250 18:14637781-14637803 GTGTCTGGGAGCTCCTGCCTAGG - Intergenic
1159190396 18:65034484-65034506 CTGTCTGTGGGCTTCTACCAGGG - Intergenic
1161084575 19:2328867-2328889 CCGTCTTGGGGGTCCAGCCTCGG + Intronic
1162918056 19:13884815-13884837 CTGTCCTGCTGCTCCTGCCTTGG + Intronic
1163157106 19:15445579-15445601 CTGTCTTGAGGCCCCAGCCTGGG - Intronic
1163437387 19:17303504-17303526 CTCTCATTGGGCTCCTAACTAGG - Intronic
1164486286 19:28658285-28658307 CCATCTTGGTGCCCCTACCTAGG + Intergenic
1165452042 19:35889476-35889498 CTGGCTGGGGGTTCCCACCTGGG + Intronic
1165814817 19:38635261-38635283 GTGTCTTGGGGCTCCCGCCCAGG + Intronic
1166777507 19:45322043-45322065 CTGTCTTGGGCCTGCTGACTTGG - Intronic
1166997846 19:46728254-46728276 CTGTCCTGTGACTCCTAGCTAGG - Intronic
1168563543 19:57403784-57403806 CTTCCTTGGGGCTCAGACCTTGG + Intronic
927409535 2:22808339-22808361 CTGTCTTGGGGCTGTCACCCTGG - Intergenic
927853843 2:26515997-26516019 CTCTCTTGGGCCTCCTCACTGGG + Intronic
928197876 2:29228143-29228165 CTATCTTTGGGCTCCCCCCTCGG + Intronic
930294562 2:49538397-49538419 TTGTATTGGGGCCCCTACCCAGG + Intergenic
933822552 2:86126913-86126935 CTGTCTTCAGTCTTCTACCTAGG - Intronic
937987603 2:127645466-127645488 CTGGCCTGGGGCTCCTCCCTGGG - Intronic
948036763 2:234863959-234863981 CTTTCTTGGGCCTCCTAGATTGG - Intergenic
948868224 2:240785889-240785911 CTGCCCTGGGCCTCCTGCCTGGG - Intronic
1168844613 20:935354-935376 CAGTCTTGGGGCTCTGGCCTCGG + Intergenic
1169055097 20:2614016-2614038 CTGTACTGGGGCCCTTACCTGGG - Intronic
1170873141 20:20226606-20226628 TTCTCTTGGGGCTTCAACCTGGG + Intronic
1172124089 20:32614787-32614809 CTCTCCTGGAGCTCCTAACTGGG + Intergenic
1174173319 20:48630118-48630140 CTGTCTTGGGGCTGTGAGCTGGG - Intronic
1174580651 20:51569230-51569252 CTGTCTTGGATCACCCACCTTGG + Intergenic
1174755299 20:53152621-53152643 CTGTCTTGGTTGTCCTACATAGG - Intronic
1175914356 20:62418863-62418885 GTATCTTGGGGATCCAACCTGGG + Intronic
1176809290 21:13520605-13520627 GTGTCTGGGAGCTCCTGCCTAGG + Intergenic
1180500296 22:15923897-15923919 CTGTCTCTGAGCTCCTTCCTGGG + Intergenic
1181120411 22:20664217-20664239 GTGTCTGGGAGCTCCTGCCTGGG + Intergenic
1181305656 22:21916028-21916050 CTGTCTTGGATCTGCTTCCTGGG - Intergenic
1182524394 22:30906484-30906506 CTTTCTTGGGACTCCCACCTTGG + Exonic
1182566886 22:31206733-31206755 CTGACTTGGGACTCCTGGCTCGG + Exonic
1185042423 22:48511979-48512001 GTGCCATGGGGCTCCAACCTTGG - Intronic
1185112039 22:48905531-48905553 CTGACTTGTGTCTCCTCCCTCGG + Intergenic
950449267 3:13056392-13056414 CTTTCTGGGGGGTCCTTCCTGGG + Intronic
951313717 3:21162258-21162280 CTCTCTTTGACCTCCTACCTAGG - Intergenic
951706074 3:25545657-25545679 CTGTCCTGCAGCTCCTCCCTGGG + Intronic
954716361 3:52528824-52528846 CTGTATAGGGGCTCCCTCCTTGG - Intronic
958472673 3:94541229-94541251 CTCTCCAGGTGCTCCTACCTGGG - Intergenic
960993864 3:123328604-123328626 GTGGCTTGGGGCCCCGACCTGGG - Intronic
962278661 3:134033984-134034006 CTGTCTTGGGCCTCCTCCTGGGG + Intronic
964365997 3:155951265-155951287 CCGTCTTGGGACTCCTGCCTGGG + Intergenic
967880003 3:194295061-194295083 CTGGCTAGGGGCTCCTCTCTGGG + Intergenic
968300257 3:197607524-197607546 CTGTGATGTGGCTTCTACCTTGG - Intergenic
968934371 4:3602263-3602285 CTGCCTTGGGGGCCCTGCCTGGG + Intergenic
969921321 4:10543034-10543056 CTGTCAAGGTGCTCCTAGCTGGG + Intronic
970268539 4:14317486-14317508 CTATCTTGGTTCTCCTACCCTGG + Intergenic
972981657 4:44711589-44711611 CTGTCTTCTGACTCCTAACTTGG + Intronic
973779594 4:54276120-54276142 TGATCTTGGGGCCCCTACCTAGG + Intronic
977389030 4:96384111-96384133 CTGTCTTGTGGCCCCCACCCAGG - Intergenic
979558275 4:122075671-122075693 CTGACTTGGGACTCCTGGCTTGG - Intergenic
980840648 4:138256530-138256552 CTTCCTTGGGGCTCAGACCTCGG + Intergenic
982079261 4:151771721-151771743 CAGTCTTACGGCTCTTACCTTGG - Intergenic
982791083 4:159592266-159592288 CTGTCTTAGGGTTCCTGGCTGGG + Intergenic
984757436 4:183337519-183337541 CTGTCTGGGGGCACCCAGCTGGG + Intergenic
990845280 5:60130687-60130709 TTGTCTTGGGGCTACTATCATGG + Intronic
991250627 5:64557454-64557476 CTGTCTTGGGTATCCTGGCTGGG - Intronic
992654957 5:78900123-78900145 CTGACTAGGGGTTCCTGCCTAGG - Intronic
999366963 5:151029520-151029542 CTGCTTTTTGGCTCCTACCTTGG + Intergenic
999860827 5:155643802-155643824 CTGTTTTGGGGCTGCCACGTGGG + Intergenic
999866841 5:155709835-155709857 CTGTCTTGGATCTACAACCTAGG + Intergenic
1000091659 5:157934793-157934815 CAGTCTTGTGGCCCCTACCTAGG - Intergenic
1001115614 5:168936895-168936917 CTGTCCTGGAGCTTCTACTTTGG + Intronic
1001181167 5:169521988-169522010 GTGTCCTGGGGTTCCTGCCTTGG - Intergenic
1008881355 6:56383525-56383547 CTGTCTTCAGGTACCTACCTGGG - Intronic
1010378517 6:75202282-75202304 CTGGCTCGGGGCTGCGACCTCGG - Intronic
1010661911 6:78581270-78581292 CTGTCTTGCTGCTATTACCTTGG - Intergenic
1011277004 6:85642121-85642143 CTTTCTGGGGGCTCCGACCGCGG - Intronic
1011284372 6:85707432-85707454 CATTCTTGTGACTCCTACCTAGG + Intergenic
1013618299 6:111865276-111865298 CTGACTTGGGTCTCCTTCTTGGG - Intronic
1019035164 6:169048488-169048510 TTGTCCTGAGGCTCCTCCCTTGG - Intergenic
1019498958 7:1354971-1354993 CTGCCTTGGGGCTGCTCCCAAGG + Intergenic
1019518500 7:1450120-1450142 CTGCCTTGGGAGTCCTGCCTGGG - Intronic
1021732441 7:23608989-23609011 TGGTCTTGTGGCTCCCACCTAGG - Intronic
1024140466 7:46458027-46458049 CTCTCTGAGGGCTGCTACCTGGG - Intergenic
1025263720 7:57439350-57439372 CTGCCTTGGGTCTCTTGCCTTGG - Intergenic
1029690148 7:102175714-102175736 CTGTCCTGGTCCTCCTACCCTGG + Intronic
1035041309 7:155929701-155929723 CAGCCTCGGGGCTCCAACCTGGG + Intergenic
1036643018 8:10595760-10595782 CTGCCTCGGGGCTCCTGCCTTGG + Intergenic
1039578721 8:38646512-38646534 CAGTCTTGGGCCTGCTTCCTAGG + Intergenic
1040918799 8:52593024-52593046 GTGTCCTGGAGCTCCTAGCTGGG + Intergenic
1044991357 8:97799087-97799109 AGGTCTTGGGGTTCCAACCTTGG + Intronic
1049434942 8:142582204-142582226 CTGTCTCAGGGCCCCTGCCTGGG - Intergenic
1052197563 9:25736126-25736148 CTTTCTGAGGGCTCCAACCTGGG + Intergenic
1053857594 9:42354657-42354679 CTGTCTTGGAGCTACTGCCCGGG - Intergenic
1054253582 9:62741583-62741605 CTGTCTTGGAGCTACTGCCCGGG + Intergenic
1054567698 9:66776082-66776104 CTGTCTTGGAGCTACTGCCCGGG + Intergenic
1056795262 9:89654836-89654858 CTTTCTTGCAGCTCCTTCCTGGG + Intergenic
1057134921 9:92680722-92680744 CTGGCTTAGGGCTGCTCCCTGGG + Intergenic
1057728828 9:97591004-97591026 CTGTCGTGGAGCTCTTACTTGGG + Intronic
1060782537 9:126423464-126423486 GTGTCTTGAGGCTGTTACCTTGG - Intronic
1062107767 9:134765171-134765193 CAGTCTTGGGGTTCCCACCAGGG + Intronic
1062586764 9:137253064-137253086 TTGAGTTGGGGCTGCTACCTGGG + Intronic
1062592917 9:137282027-137282049 CAGTCCTGGGGGTCCTGCCTGGG - Exonic
1187968958 X:24640433-24640455 CTTTCTTAGGGTTCCAACCTGGG + Intronic
1189684024 X:43545095-43545117 CTCTCTTAGGACTGCTACCTTGG - Intergenic
1190258741 X:48785069-48785091 CTGACCTGGGGCTCCACCCTTGG + Intergenic
1190686163 X:52875695-52875717 CTGGCCTGGGGCTCCTGTCTTGG + Intergenic
1195343793 X:103928603-103928625 CTGTCACGGGGCTACTACCATGG + Intronic
1195584282 X:106546200-106546222 CTGTGTTGGGAATCCTATCTTGG + Intergenic
1195907821 X:109863060-109863082 TGGGCTTGGGGATCCTACCTTGG + Intergenic
1196594595 X:117529200-117529222 CTGTCATGGGGCTACTATATGGG + Intergenic
1201393308 Y:13522025-13522047 CTGTCCTGCTGCTCCTAGCTAGG + Intergenic