ID: 915617366

View in Genome Browser
Species Human (GRCh38)
Location 1:157049480-157049502
Sequence AAATCCTTACAAACTGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915617366_915617370 18 Left 915617366 1:157049480-157049502 CCATCTGCAGTTTGTAAGGATTT No data
Right 915617370 1:157049521-157049543 CTCTGTAAGCTATAGAGTGCTGG No data
915617366_915617372 23 Left 915617366 1:157049480-157049502 CCATCTGCAGTTTGTAAGGATTT No data
Right 915617372 1:157049526-157049548 TAAGCTATAGAGTGCTGGGCAGG No data
915617366_915617371 19 Left 915617366 1:157049480-157049502 CCATCTGCAGTTTGTAAGGATTT No data
Right 915617371 1:157049522-157049544 TCTGTAAGCTATAGAGTGCTGGG No data
915617366_915617367 -6 Left 915617366 1:157049480-157049502 CCATCTGCAGTTTGTAAGGATTT No data
Right 915617367 1:157049497-157049519 GGATTTAATATGAACAAGCCTGG No data
915617366_915617368 -5 Left 915617366 1:157049480-157049502 CCATCTGCAGTTTGTAAGGATTT No data
Right 915617368 1:157049498-157049520 GATTTAATATGAACAAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915617366 Original CRISPR AAATCCTTACAAACTGCAGA TGG (reversed) Intergenic
No off target data available for this crispr