ID: 915617370

View in Genome Browser
Species Human (GRCh38)
Location 1:157049521-157049543
Sequence CTCTGTAAGCTATAGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915617366_915617370 18 Left 915617366 1:157049480-157049502 CCATCTGCAGTTTGTAAGGATTT No data
Right 915617370 1:157049521-157049543 CTCTGTAAGCTATAGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915617370 Original CRISPR CTCTGTAAGCTATAGAGTGC TGG Intergenic
No off target data available for this crispr