ID: 915619812

View in Genome Browser
Species Human (GRCh38)
Location 1:157074298-157074320
Sequence CAGCTCGGACAACTTGGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 3, 1: 9, 2: 11, 3: 13, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915619812_915619820 5 Left 915619812 1:157074298-157074320 CCAACGCCAAGTTGTCCGAGCTG 0: 3
1: 9
2: 11
3: 13
4: 48
Right 915619820 1:157074326-157074348 CGCCCTGCAGCGGGCCAAGCAGG 0: 8
1: 13
2: 16
3: 28
4: 136
915619812_915619817 -5 Left 915619812 1:157074298-157074320 CCAACGCCAAGTTGTCCGAGCTG 0: 3
1: 9
2: 11
3: 13
4: 48
Right 915619817 1:157074316-157074338 AGCTGGAGGCCGCCCTGCAGCGG 0: 12
1: 14
2: 7
3: 33
4: 301
915619812_915619818 -4 Left 915619812 1:157074298-157074320 CCAACGCCAAGTTGTCCGAGCTG 0: 3
1: 9
2: 11
3: 13
4: 48
Right 915619818 1:157074317-157074339 GCTGGAGGCCGCCCTGCAGCGGG 0: 12
1: 16
2: 20
3: 49
4: 391
915619812_915619823 16 Left 915619812 1:157074298-157074320 CCAACGCCAAGTTGTCCGAGCTG 0: 3
1: 9
2: 11
3: 13
4: 48
Right 915619823 1:157074337-157074359 GGGCCAAGCAGGACATGTTGCGG 0: 1
1: 1
2: 10
3: 24
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915619812 Original CRISPR CAGCTCGGACAACTTGGCGT TGG (reversed) Intergenic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
914932817 1:151949895-151949917 CAGCTCTGCCAGCGTGGCGTTGG + Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
923211602 1:231808654-231808676 CAGGTCAGACAACTAGGCATTGG - Intronic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1072717647 10:97762304-97762326 CAGCTCCCACAGCCTGGCGTGGG + Intergenic
1075438554 10:122462026-122462048 CAGCTGGCACAGGTTGGCGTAGG - Exonic
1075966385 10:126615322-126615344 CATCTGGGATAACTTGGGGTAGG - Intronic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1081182382 11:39999872-39999894 GAGGTGGGACAACTTGGAGTGGG - Intergenic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1093997373 12:25656260-25656282 CAGCTTGGGCAACATGGCGAGGG + Intergenic
1096540836 12:52306124-52306146 CAGCTCGGCCAACTTGCAGCGGG - Exonic
1096603399 12:52746721-52746743 GAGCTCTGCCAACTTGGCCTGGG + Intergenic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1096757078 12:53808610-53808632 CAGCTGGGAAAACTTGGAGCCGG + Intergenic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1104947733 12:132424089-132424111 CAGCTGGGACAATTAGGCGAGGG - Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1126877533 15:53060419-53060441 CAGTTCTGACCACTTGGCCTCGG + Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1136389164 16:29951464-29951486 CAGCTCGGACACAGTGGGGTAGG - Intronic
1137726718 16:50661617-50661639 CAGCTAGAAAAACTTGGCTTTGG + Intergenic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141102779 16:81210219-81210241 CAGCCCTGACACCTTGGTGTCGG - Intergenic
1145166015 17:20614060-20614082 CAGAACGAACAACTTGACGTTGG - Intergenic
1155304863 18:24469177-24469199 CAGTTGGGACAACTTGCCTTGGG - Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
932224968 2:70032323-70032345 CTGCTCAGACACCTTGGCTTAGG + Intergenic
933971192 2:87471169-87471191 CAGCTGGGACACCTGTGCGTGGG - Intergenic
936322537 2:111479020-111479042 CAGCTGGGACACCTGTGCGTGGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
1171992190 20:31705072-31705094 CAGGTAGGACAAGTTGGCTTTGG + Intronic
1175440811 20:58989895-58989917 CAGCACGGACATCATGGCCTGGG - Exonic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
961235154 3:125359954-125359976 CAGCTGGCACAACTGGGCCTGGG + Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
964392119 3:156208546-156208568 CATCTCTGACAACTTGGAGGGGG + Intronic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
965605779 3:170496477-170496499 CAGCTCCGACCGCTTGGCGCTGG - Intronic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG + Intronic
988609626 5:32712315-32712337 CATCTCGCCCATCTTGGCGTAGG - Exonic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1027171949 7:75878930-75878952 CGGATTGGACAACTTGGCATGGG + Exonic
1029259101 7:99289336-99289358 TAGCTCTGCCACCTTGGCGTTGG - Intergenic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1032572428 7:133014481-133014503 CTGCTGGGACAATTTGCCGTTGG - Intronic
1033977166 7:147116513-147116535 CAGCTGGGACAACCTGCCCTGGG + Intronic
1038063308 8:23936322-23936344 CAGCTCTGAGAACTTTGCGCGGG + Intergenic
1038878216 8:31576030-31576052 CAGCTCCTACAACTTTGTGTGGG - Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042321746 8:67482915-67482937 CAGCTAGAATAACTGGGCGTGGG - Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1060027390 9:120184762-120184784 CACCTTGGACAACTTGCCTTTGG - Intergenic
1060425019 9:123497142-123497164 CAGCACGGACCACGTGGTGTTGG + Intronic
1062419720 9:136474373-136474395 CAGCTCCGAAAACATGGCTTTGG + Exonic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1196734899 X:118974828-118974850 CAGCAGCGACAACTTGGAGTCGG + Exonic
1200408770 Y:2841384-2841406 CAGCTCAGCCAACTTGACGGGGG + Intergenic
1200920983 Y:8612700-8612722 CAGCTCTGACAATTGGGCGCTGG + Intergenic