ID: 915620990

View in Genome Browser
Species Human (GRCh38)
Location 1:157084044-157084066
Sequence AGACCAGGCAGGGCAACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915620990_915620994 -4 Left 915620990 1:157084044-157084066 CCTGTGGTTGCCCTGCCTGGTCT No data
Right 915620994 1:157084063-157084085 GTCTGAGCCTCCGAAATGTTTGG No data
915620990_915620995 -3 Left 915620990 1:157084044-157084066 CCTGTGGTTGCCCTGCCTGGTCT No data
Right 915620995 1:157084064-157084086 TCTGAGCCTCCGAAATGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915620990 Original CRISPR AGACCAGGCAGGGCAACCAC AGG (reversed) Intergenic
No off target data available for this crispr