ID: 915621667

View in Genome Browser
Species Human (GRCh38)
Location 1:157089928-157089950
Sequence GACTCTGCTGTGTCTCGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915621661_915621667 11 Left 915621661 1:157089894-157089916 CCGAGTGCCCAGGAGCAGGGCTG 0: 1
1: 0
2: 6
3: 63
4: 469
Right 915621667 1:157089928-157089950 GACTCTGCTGTGTCTCGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 151
915621657_915621667 28 Left 915621657 1:157089877-157089899 CCTTTGGTACGGTGGAGCCGAGT 0: 1
1: 0
2: 0
3: 0
4: 22
Right 915621667 1:157089928-157089950 GACTCTGCTGTGTCTCGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 151
915621665_915621667 3 Left 915621665 1:157089902-157089924 CCAGGAGCAGGGCTGGCAGGTGA 0: 1
1: 0
2: 3
3: 59
4: 471
Right 915621667 1:157089928-157089950 GACTCTGCTGTGTCTCGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 151
915621664_915621667 4 Left 915621664 1:157089901-157089923 CCCAGGAGCAGGGCTGGCAGGTG 0: 1
1: 0
2: 7
3: 97
4: 2267
Right 915621667 1:157089928-157089950 GACTCTGCTGTGTCTCGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915621667 Original CRISPR GACTCTGCTGTGTCTCGGCC CGG Intergenic
904977671 1:34470476-34470498 GACTTAGCTGTGTCTGGGGCTGG - Intergenic
907945158 1:59129217-59129239 GGCTCTTGTGTGTCTCTGCCTGG + Intergenic
908874872 1:68661563-68661585 GAATAGGCTGTGGCTCGGCCGGG - Intergenic
912884835 1:113459948-113459970 TTCTCTGTTGTGTCTCTGCCAGG - Intronic
913937240 1:125065936-125065958 GACTGGGCTGTGTCTGGGGCTGG - Intergenic
915070204 1:153260335-153260357 GGCTCTGCTGTGGCCCTGCCTGG - Intronic
915621667 1:157089928-157089950 GACTCTGCTGTGTCTCGGCCCGG + Intergenic
920851894 1:209633787-209633809 GGCTCACCTGTGTCTCAGCCAGG + Intronic
921617264 1:217284090-217284112 CACTGTGCTGTGTCTGGGCATGG - Intergenic
923053396 1:230404582-230404604 GACTTTGCTCTGTCTCACCCAGG - Intronic
1062979200 10:1707861-1707883 GACTCTGCTGTGTGTGGACCGGG - Intronic
1063800215 10:9568282-9568304 GTCTCTGTTGTGTCTTTGCCAGG - Intergenic
1064940917 10:20734747-20734769 GACTCTTCTGTGTCTCTACATGG - Intergenic
1066186664 10:33016151-33016173 GACTTTGGTGTTTCTCTGCCTGG + Intergenic
1066297889 10:34071157-34071179 TTTTCTGCTGTGTCTCTGCCAGG - Intergenic
1067183670 10:44009116-44009138 GTCTCTCCTGTGGCTTGGCCAGG + Intergenic
1069910729 10:71757656-71757678 CACCCTGCTGTGTCAGGGCCTGG - Intronic
1069949933 10:72011752-72011774 GACGCTGCTGTGTCTCACCAAGG - Exonic
1075638145 10:124044422-124044444 GACCCTGCTGGGTCTTTGCCTGG + Intronic
1077046024 11:545518-545540 GGCTCTGCTGTGCCTCTCCCGGG - Intronic
1077046035 11:545571-545593 GGCTCTGCTGTGCCTCTCCCGGG - Intronic
1083486827 11:62988414-62988436 GACTCTTATGTATCTTGGCCTGG - Intergenic
1083956113 11:65983732-65983754 GGCTGTGCTGTGTTTGGGCCAGG - Intergenic
1087225846 11:95597357-95597379 GACTATGATGTGTCTTGGCATGG + Intergenic
1087841719 11:102927520-102927542 GACTGTGCTTTGTCTAGGACAGG + Intergenic
1089329530 11:117679960-117679982 GACTTTGCTGGGTCTTTGCCTGG + Intronic
1089773186 11:120817734-120817756 GGCTCTGCTGGGTCTAGGCAGGG - Intronic
1091321026 11:134651603-134651625 GACTCTGATGTTTCTTGGCATGG + Intergenic
1092671476 12:10866928-10866950 GATTCTTCTGTCTCTAGGCCAGG - Intronic
1092671497 12:10867068-10867090 GATTCTTCTGTCTCTTGGCCAGG - Intronic
1096660968 12:53123789-53123811 GACCATGCTGTTTCTAGGCCAGG + Exonic
1098299877 12:69043218-69043240 TACTCTGCTGGGTGTCTGCCTGG - Intergenic
1100300880 12:93306669-93306691 GACTATGATGTGTCTTGGCATGG - Intergenic
1101906397 12:108829740-108829762 GACTCTGCTGAGGCTGGACCTGG - Intronic
1103749874 12:123151185-123151207 GTCCCTGCGGAGTCTCGGCCCGG + Intergenic
1105236265 13:18556109-18556131 GACAGTGCTGTTTCTCGACCTGG + Intergenic
1111573811 13:90123348-90123370 GACTATGCTGTGTCTGGGTGTGG - Intergenic
1113392321 13:109909489-109909511 GAATCTCCAGTGTCTGGGCCTGG - Intergenic
1113727798 13:112618119-112618141 GCCTCTGCTGTGACCTGGCCGGG - Intergenic
1113867776 13:113539267-113539289 GGCTCTGCTGGGTCTCGGGGTGG + Intronic
1114193571 14:20458612-20458634 GGCTGTGCTGTGTTTGGGCCGGG - Exonic
1120967836 14:90183368-90183390 GAGGCTGCTGTTTCTCTGCCTGG + Intronic
1121307753 14:92917657-92917679 GACTCTGCTGTTCCATGGCCTGG + Intergenic
1123061659 14:105597306-105597328 GACTCAGCTGTGTCCTGGGCTGG + Intergenic
1123086397 14:105719036-105719058 GACTCAGCTGTGTCCTGGGCTGG + Intergenic
1124397881 15:29320542-29320564 TTCTCTGCTGTGTCTCAGTCTGG - Intronic
1127161958 15:56197882-56197904 GACTCTGCTTTCTCTCCCCCAGG + Intronic
1129632482 15:77276275-77276297 GACTTTGATGTGTTTTGGCCTGG - Intronic
1129867378 15:78919588-78919610 GAATATGGTGTGCCTCGGCCGGG + Intergenic
1131052406 15:89357594-89357616 GACCCTACAGTGTCTCTGCCTGG - Intergenic
1132110243 15:99097463-99097485 GACCCCGCTGTGTCTTGGGCAGG - Intergenic
1132546558 16:535945-535967 CACCCTGCTGTCCCTCGGCCTGG + Intronic
1133302014 16:4788110-4788132 AACTCTGCTGTGTGTCCCCCTGG - Intronic
1133747347 16:8697210-8697232 GCATCTGCTGTGTCCCTGCCTGG - Intronic
1138536233 16:57661844-57661866 GACACTGCTGGGCCTCAGCCTGG + Exonic
1139349814 16:66327921-66327943 GACTCAGCTGGGCCTGGGCCTGG - Intergenic
1141142096 16:81503269-81503291 GGCTCTGCTGTGTGACAGCCGGG + Intronic
1141831520 16:86512065-86512087 GACTCAGCTGTGGGTCTGCCAGG - Intronic
1141841873 16:86578849-86578871 GCTTCTGCGGGGTCTCGGCCCGG - Exonic
1141931199 16:87204527-87204549 GACTCTGATGTGTCTAGGCATGG - Intronic
1203142485 16_KI270728v1_random:1777404-1777426 GACTACACTGTGTCTGGGCCAGG - Intergenic
1142617357 17:1144048-1144070 GGCTCAGCTGTTTCTCAGCCAGG - Intronic
1145045632 17:19613143-19613165 GACATTGCTGTGTCTCAGTCTGG + Intergenic
1146901408 17:36591881-36591903 GACTCTGGTGGGTCTAGGCGCGG + Exonic
1148872553 17:50667391-50667413 GCCTGTGCTGTGCCTTGGCCTGG - Intronic
1149107462 17:52986436-52986458 GACTCTGTTGTGCCTCTTCCTGG - Exonic
1152366175 17:79857838-79857860 GCCTCTGCTGGGGCTCGCCCAGG + Intergenic
1153724989 18:7945156-7945178 GAATCTGCAGAGTCCCGGCCGGG + Intronic
1154513272 18:15133889-15133911 GACAGTGCTGTTTCTCGACCTGG - Intergenic
1157681215 18:49608540-49608562 GCCTCTGCAGTGTCCAGGCCAGG - Intergenic
1160188794 18:76697533-76697555 GACTCCGCTGAGTCTCGGGCAGG + Intergenic
1160458698 18:79021073-79021095 GTCTCTGCTGTTTCTAAGCCCGG - Intergenic
1160543411 18:79637938-79637960 GACTCTGCCGAGGCACGGCCTGG + Intergenic
1161081092 19:2310523-2310545 GACTCTGCAGTGGTTCTGCCCGG + Intronic
1161240528 19:3220787-3220809 GACTCAGCTGAGGCTTGGCCGGG - Intergenic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1161736864 19:5996874-5996896 GACACTGCTGTGTCCTGGCACGG + Intronic
1162568555 19:11457600-11457622 GTCTCTGCTCTGTTTGGGCCAGG + Intronic
1163358948 19:16833336-16833358 AATTCTGCTGCTTCTCGGCCAGG + Intronic
1163440803 19:17321778-17321800 GGCTGTGCTGTGCCTGGGCCTGG - Exonic
1165084660 19:33335711-33335733 GACTCTGTTGTGGCCCGGCCAGG + Intergenic
1167117972 19:47499112-47499134 GACTCTGCAGGGTGTGGGCCTGG - Intronic
925326934 2:3030218-3030240 GCCTCTGATGTGTCTTGGCATGG - Intergenic
926744650 2:16140929-16140951 GATTCTGCTGTGACTCAGACAGG + Intergenic
926786532 2:16523691-16523713 GTCTCTGCTCTGGCTCAGCCTGG - Intergenic
930229805 2:48831796-48831818 TTCTCTGTTGTGTCTCTGCCAGG - Intergenic
930568859 2:53059201-53059223 GACTTTGCTGTTTATCTGCCAGG - Intergenic
930672690 2:54168127-54168149 AAATCTGCTGTGTCCAGGCCAGG + Intronic
935390665 2:102549498-102549520 GACTCTGATGTGTCTAGGTGTGG - Intergenic
936149361 2:110005154-110005176 TTCTTTGCTGTGTCTCTGCCAGG + Intergenic
936195319 2:110366221-110366243 TTCTTTGCTGTGTCTCTGCCAGG - Intergenic
938513521 2:131978500-131978522 GACAGTGCTGTTTCTCGACCTGG - Intergenic
943820401 2:192314680-192314702 TGCTCTGCTTTGTCTCAGCCTGG + Intergenic
946747526 2:222861037-222861059 GACGCTGCTGTGGCTGCGCCGGG + Exonic
948189289 2:236045712-236045734 CACTTCGCTGTGTCTCGGCCTGG - Intronic
1170340432 20:15320887-15320909 GCCTCTGCTGTGGCTAGGCAGGG - Intronic
1174126440 20:48310380-48310402 GACTCTGCTATTTCTTGGCGAGG + Intergenic
1175483053 20:59325169-59325191 AACTCCACTGTGTATCGGCCTGG - Exonic
1176022289 20:62967945-62967967 CACTTTGCTGTGTCTCTGGCGGG + Exonic
1176780259 21:13184394-13184416 GACAGTGCTGTTTCTCGACCTGG + Intergenic
1177977927 21:27873416-27873438 GACAGTGCTGTTTCTCGACCTGG + Intergenic
1178917286 21:36713311-36713333 GACTCAGCTTTGTCTCTCCCTGG + Intronic
1179549671 21:42135880-42135902 GACGCTGCTGTGTGTCCCCCAGG - Intronic
1183498288 22:38162996-38163018 GCCTCTGCTGTGTCTCTGCTGGG + Intronic
1184106238 22:42368966-42368988 GGCTCCGCGGGGTCTCGGCCGGG - Intergenic
1185219769 22:49623486-49623508 GCCTCTGCTGTGCCCCGTCCTGG + Intronic
1185230353 22:49677103-49677125 GACTCTGCTGTATCCCAGCATGG - Intergenic
950408073 3:12816879-12816901 GAATGTGCAGTGCCTCGGCCAGG - Exonic
957049264 3:75398783-75398805 GACACTGAAGGGTCTCGGCCTGG - Intergenic
957104935 3:75875037-75875059 TTTTCTGCTGTGTCTCTGCCAGG + Intergenic
957543201 3:81602979-81603001 GACTCTGCTTACTCTCTGCCTGG + Intronic
961354762 3:126330182-126330204 GATTCTGCTGTGACTCAGGCTGG - Intergenic
965224418 3:165970691-165970713 TTCTCTGTTGTGTCTCTGCCAGG + Intergenic
971679374 4:29676819-29676841 GTTGCTGCTGTGTCTCTGCCAGG - Intergenic
975219140 4:71794119-71794141 GTTTCTGTTGTGTCTCTGCCAGG + Intronic
975306420 4:72854451-72854473 TTTTCTGTTGTGTCTCGGCCAGG - Intergenic
976976958 4:91177282-91177304 TTTTCTGCTGTGTCTCTGCCAGG + Intronic
981851141 4:149231502-149231524 GATTTTGTTGTGTCTCTGCCAGG - Intergenic
985080716 4:186261490-186261512 GACACTGGTGTTTCTCTGCCCGG + Intergenic
986769161 5:10956175-10956197 GACTCAGCTGTGTCTCTGCTGGG - Intergenic
988119888 5:26947856-26947878 CAGCCTGCTGTGTCTTGGCCAGG - Intronic
993900549 5:93581516-93581538 GACTCGGCTGTGTGCCGCCCGGG + Intergenic
994609862 5:102022316-102022338 TACTTTGTTGTGTCTCTGCCAGG - Intergenic
995635843 5:114189240-114189262 GACTCTCCTGGGTCTCTGCCTGG - Intergenic
998139652 5:139692755-139692777 GACTCTGCTGCTTCTAGGCTAGG - Intergenic
1000198691 5:158986383-158986405 GACTCTGGTGTTTCTCAGGCAGG + Intronic
1001922457 5:175611237-175611259 GTCACTGCTTTGTCTTGGCCAGG - Intergenic
1006043246 6:31271823-31271845 GACACCGCCGTGTCCCGGCCCGG - Exonic
1011207600 6:84916881-84916903 GACTCCGCTGTGTAAGGGCCAGG - Intergenic
1013946590 6:115729137-115729159 GCCTCTGCTGTGTGTCACCCAGG + Intergenic
1015132579 6:129830761-129830783 GAGTCTGCTCTGTCTCTGCCAGG + Intergenic
1015600035 6:134902823-134902845 GGCTCTGCTGTGTTTCAGGCTGG - Intergenic
1016792516 6:148080210-148080232 AACTCTGCTGTGTCTCAACAGGG - Intergenic
1018072870 6:160181471-160181493 GACTCTGCTGTGTTTCTTCTAGG + Intronic
1018619756 6:165718652-165718674 CACTCTCCTGTGTCTCGTCCGGG - Intronic
1019510337 7:1414500-1414522 GACTCTGCTGTGTGCAGGCCGGG - Intergenic
1019641707 7:2106877-2106899 CACTCAGCTGTCTCTCAGCCAGG - Intronic
1024081478 7:45859567-45859589 GGCTCAGCTGGGTCTCTGCCTGG - Intergenic
1024220236 7:47281368-47281390 CACTCTGCTGTGTCCAGGCTGGG + Intronic
1033072039 7:138212352-138212374 GTCTCTGCAGTGTCTTGGCAGGG + Intergenic
1035038885 7:155913355-155913377 GACTCTCCTCTGTCTCAGGCTGG - Intergenic
1035394841 7:158527979-158528001 GTCCCTGCTGTGTGTCGGGCGGG - Intronic
1036537062 8:9660265-9660287 TTTTCTGCTGTGTCTCTGCCAGG - Intronic
1039838679 8:41278160-41278182 TACTCCGCTGTGTCTTGGACAGG - Intronic
1040479497 8:47811113-47811135 GATTATGATGTGTCTAGGCCTGG - Intronic
1040537095 8:48319933-48319955 GACTCTCCTGTGGCTGGGCTTGG + Intergenic
1040756035 8:50777036-50777058 GACTATGATGTGTCTTGGCAAGG + Intronic
1042108315 8:65352553-65352575 TTCTCTGTTGTGTCTCTGCCAGG + Intergenic
1047318934 8:123760835-123760857 GGCTCTGCTGTGTGACAGCCAGG + Intergenic
1049509732 8:143021485-143021507 GCCTCTGCTGAGCCCCGGCCCGG - Intronic
1052087057 9:24281027-24281049 TTTTCTGCTGTGTCTCTGCCAGG - Intergenic
1055728288 9:79255440-79255462 GTCTCTGCTGTGTCTACGCTTGG - Intergenic
1056928875 9:90858169-90858191 GACTCTGCTGGGGCATGGCCTGG - Intronic
1057198317 9:93127247-93127269 GCCTCTGCTGTGTCGGGGCCGGG - Intronic
1060901109 9:127259013-127259035 GACTCAGCAGTGGCTAGGCCTGG - Intronic
1061007388 9:127935838-127935860 GGCTCTGCTGTGTCATGCCCTGG - Intronic
1061893256 9:133633796-133633818 GACTCTCCTGTGTCTGAGACAGG + Intergenic
1189280317 X:39816420-39816442 GACTCTGGTATATCTCTGCCAGG - Intergenic
1190121598 X:47664473-47664495 GACTCTGATGTGCCTCAGCATGG + Intergenic
1190830186 X:54052668-54052690 TTTTCTGCTGTGTCTCTGCCAGG + Intergenic
1195478555 X:105316488-105316510 GACCCTGCTCTTTCTCTGCCTGG - Intronic
1199007634 X:142720936-142720958 GACAATGTTGTGTCTCTGCCAGG - Intergenic
1199343029 X:146704566-146704588 GACTCTGCCGTGGCTGGGCATGG - Intergenic
1199549609 X:149044349-149044371 GACTCTGCTGTGTCTCCTGAGGG + Intergenic