ID: 915625876

View in Genome Browser
Species Human (GRCh38)
Location 1:157113819-157113841
Sequence CAGGGAAGACAGGAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915625876_915625883 -6 Left 915625876 1:157113819-157113841 CCTTCCTGCTCCTGTCTTCCCTG No data
Right 915625883 1:157113836-157113858 TCCCTGGGGTCTCCTGCACTGGG No data
915625876_915625882 -7 Left 915625876 1:157113819-157113841 CCTTCCTGCTCCTGTCTTCCCTG No data
Right 915625882 1:157113835-157113857 TTCCCTGGGGTCTCCTGCACTGG No data
915625876_915625886 3 Left 915625876 1:157113819-157113841 CCTTCCTGCTCCTGTCTTCCCTG No data
Right 915625886 1:157113845-157113867 TCTCCTGCACTGGGCCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915625876 Original CRISPR CAGGGAAGACAGGAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr