ID: 915626708

View in Genome Browser
Species Human (GRCh38)
Location 1:157118378-157118400
Sequence CCTCACAGGCAGTAAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915626697_915626708 29 Left 915626697 1:157118326-157118348 CCTAAAACATAGGGAAACTGAGG No data
Right 915626708 1:157118378-157118400 CCTCACAGGCAGTAAGTGGCAGG No data
915626696_915626708 30 Left 915626696 1:157118325-157118347 CCCTAAAACATAGGGAAACTGAG No data
Right 915626708 1:157118378-157118400 CCTCACAGGCAGTAAGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915626708 Original CRISPR CCTCACAGGCAGTAAGTGGC AGG Intergenic
No off target data available for this crispr