ID: 915626708 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:157118378-157118400 |
| Sequence | CCTCACAGGCAGTAAGTGGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 915626697_915626708 | 29 | Left | 915626697 | 1:157118326-157118348 | CCTAAAACATAGGGAAACTGAGG | No data | ||
| Right | 915626708 | 1:157118378-157118400 | CCTCACAGGCAGTAAGTGGCAGG | No data | ||||
| 915626696_915626708 | 30 | Left | 915626696 | 1:157118325-157118347 | CCCTAAAACATAGGGAAACTGAG | No data | ||
| Right | 915626708 | 1:157118378-157118400 | CCTCACAGGCAGTAAGTGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 915626708 | Original CRISPR | CCTCACAGGCAGTAAGTGGC AGG | Intergenic | ||
| No off target data available for this crispr | |||||